Arch Microbiol DOI 10.1007/s00203-014-1003-1

Original Paper

Bacteriocin production and gene sequencing analysis from vaginal Lactobacillus strains Galina Stoyancheva · Marta Marzotto · Franco Dellaglio · Sandra Torriani 

Received: 7 March 2014 / Revised: 19 May 2014 / Accepted: 30 May 2014 © Springer-Verlag Berlin Heidelberg 2014

Abstract  The human vagina is a complex and dynamic ecosystem containing an abundance of microorganisms. In women of childbearing age, this system is dominated by Lactobacillus spp. In the present work, seventeen newly isolated vaginal strains were identified by 16S rDNA sequencing and were investigated for their antimicrobial properties. Twelve of the isolated Lactobacillus strains showed activity against one or more microorganisms. Six and five of them produced substances that inhibited the growth of two different Klebsiella strains and Staphylococcus aureus, respectively. Two lactobacilli strains were active against an Escherichia coli strain, one isolate was active against an Enterococus faecalis strain and another lactobacilli strain showed antimicrobial activity against a Candida parapsilosis strain. The nature of the active compounds was additionally studied, and the presence of bacteriocin-like substances was proved. The genes related to the bacteriocin production in three of the newly isolated strains were identified and sequenced. The presence of gassericin A operon in the genome of the species Lactobacillus crispatus was described for the first time. The presence of antimicrobial activity contributes to their possible use as potential probiotic strains after further research. Keywords  Bacteriocin genes · Lactobacillus gasseri · Gassericin · Lactobacillus crispatus · Human microbiota G. Stoyancheva (*)  Department of Microbial Genetics, Institute of Microbiology, Bulgarian Academy of Sciences, Acad. G. Bonchev str. bl. 26, 1113 Sofia, Bulgaria e-mail: [email protected] M. Marzotto · F. Dellaglio · S. Torriani  Dipartimento di Biotecnologie, Università degli Studi di Verona, Strada le Grazie 15, Verona, Italy

Introduction The human microbiota is an aggregate of all microorganisms that live in human host and colonize the skin, oral cavity, conjunctiva, gastrointestinal tract and vagina. Most of the microbes associated with humans contribute in maintaining processes necessary for a healthy body. A number of recent studies indicated the importance of these microorganisms for human health (Klaenhammer et al. 2012; Cox et al. 2013; Fujinaka et al. 2013; Martín et al. 2013; Selle and Klaenhammer 2013). The microbiota of the healthy human vagina contains bacteria belonging to the genus Lactobacillus playing an important role in protecting the host from urogenital infections. The indigenous lactobacilli represent the primary microbiological barrier to infections produced by urogenital pathogens (Andreu 2004; Atassi et al. 2006; De Gregorio et al. 2012; Chapman et al. 2013; MacPhee et al. 2013). Lactobacilli exert antagonistic activity against many microorganisms as a result of the production of organic acids, hydrogen peroxide, diacetyl, inhibitory enzymes and bacteriocins (Piard and Desmazeaud 1992). Bacteriocins are antimicrobial proteinaceous substances secreted by some bacteria against microorganisms that are usually closely related to the producer microorganism. According to the classification of Cotter et al. (2005), the bacteriocins are divides into two distinct categories. Class I bacteriocins (lantibiotics) are lanthionine-containing small peptides, which are active through the formation of pores and efflux of small metabolites from sensitive cells or through enzyme inhibition. Class II bacteriocins are non-lanthionine-containing bacteriocins. The majority of class II bacteriocins are active by inducing membrane permeabilization and the subsequent leakage of molecules from target bacteria. Class II bacteriocins contain four groups: class IIa pediocin-like

13



Arch Microbiol

Table 1  Antibacterial activity of Lactobacillus isolates determined by agar spot test and well-diffusion agar test Indicator strains Escherichia coli LMG 8063 T

Agar spot test

Well-diffusion agar test

9a

G3(14)b, G7(14)

Enterococus faecalis LMG 7937

7

G6(20)

Enterococus sp. PO-2 (human isolate)

7

–

Staphylococcus aureus LMG 8224

7

G4(14), G10(14), G19(20), G20(28), G25(12)

Klebsiella ozaenae (isolate)

7

G2(12), G5(10), G6(8), G27(30), G25(30), G20(34)

Klebsiella pneumoniae (NBIMCC 8651)

6

G5(10), G10(10), G11(14), G19(10), G3(10), G4(10)

Candida parapsilosis (human isolate)

1

G27(12)

Lactococcus lactis subsp. cremoris LMG 7951

4

–

Lactobacillus acidophilus LA1 (isolate)

4 8

– G2(22), G4(10), G5(26), G6(28), G10(20), G3(13)

7

G2(20), G4(14), G5(24), G6(26), G10(20), G3(8)

Lactobacillus plantarum ATCC 14917

4

–

Lactobacillus sakei LMG 9468T

6

G6(18), G10(15), G3(15)

Lactobacillus curvatus LMG 9198

7

–

Lactobacillus casei A (isolate)

2

–

Lactobacillus helveticus ATCC15009T

7

G2(20), G4(8), G5(22), G6(12), G10(12),G19(12)

Lb. delbrueckii subsp. bulgaricus ATCC 11842T Lb. delbrueckii subsp. lactis ATCC 12315 T

a

 Number of active Lactobacillus strains; bActive strain and diameters of inhibition zone (mm)

bacteriocins, class IIb two-peptide bacteriocins, class IIc cyclic bacteriocins and class IId non-pediocin-like linear bacteriocins (Drider et al. 2006; Nissen-Meyer et al. 2009). The large, heat-labile antimicrobial proteins Cotter et al. (2005) separate in designation called ‘Bacteriolysins.’ They have a domain-type structure and mechanism of action through the lysis of sensitive cells by catalyzing cell wall hydrolysis. The use of lactobacilli as therapeutic agents for the treatment and prevention of urogenital infections is an alternative to conventional antibiotic therapy. The aims of this study were first to identify different vaginal lactobacilli species potentially bacteriocin producers and determine their antimicrobial activities against human pathogen microorganisms. Second, we analyzed the genes encoding for bacteriocins and determined primary the physicochemical nature of those active substances.

Materials and methods Bacterial strains and culture conditions The strains were isolated from vaginal samples of healthy reproductive-age women and were identified by classical phenotypic methods. The Lactobacillus strains were maintained as frozen stocks at −80 °C in De Man-Rogosa-Sharpe broth (MRS, Oxoid Ltd, Basingstoke, Hampshire, UK) containing 20 % (v/v) glycerol. They were subsequently cultivated on MRS broth and then on MRS agar for 24–48 h at 37 °C, under anaerobic conditions, assured by the use of BBL® Gas Pak® Anaerobic System Envelopes, USA.

13

ATCC, LMG, NBIMCC reference culture and pathogenic bacteria were used as test microorganisms (Table 1). Indicator bacteria were grown in the following media: MRS (at 30, 37 or 42 °C under anaerobic conditions for LAB) and Brain–Heart Infusion broth (BHI; Scharlau Chemie S.A. at 37 °C) for the rest of the strains. Bacterial cultures were maintained as frozen stocks at −80 °C, in appropriate media supplemented with 20 % glycerol. Antimicrobial activity Antimicrobial activity of the isolates was determined by agar spot test and well-diffusion agar test according to Hernández et al. (2005). The Lactobacillus isolates were propagated twice in MRS (Oxoid) medium before use. Agar spot test. Lactobacillus strains were grown in 5 ml of MRS broth, under anaerobic conditions for 20 h in order to avoid H2O2 production. Aliquots (2 µl) of the culture were spotted onto agar plates containing 10 ml of MRS medium. After 18 h at 37 °C, the plates were overlaid with 5 ml of the appropriate soft agar (1 % agar) inoculated with the cell suspension of the indicator strain (105 CFU/ ml). The plates were incubated for 24–72 h, depending on the growth of the indicator strain, and the inhibition zones were measured. Inhibition was scored positive if the zone was wider than 4 mm. Well-diffusion agar test. Antimicrobial activity of the isolates was determined by analysis of the cell-free supernatants (CFS) as follows: Overnight cultures of each strain (1 % v/v) were used to inoculate 5 ml of MRS. After 24 h of incubation at 37 °C, the cells were removed by

Arch Microbiol

centrifugation (12,000g, 10 min, 4 °C). CFS were adjusted to pH 6.5 with 1 M NaOH to exclude the effect of the organic acids. The neutralized CFS were treated with catalase (Sigma, Burch, Switzerland; 1 mg/ml) 0.01 M phosphate buffer to eliminate the inhibitory effect of H2O2 (1 h at 37 °C). The MRS medium treated with catalase was used as a negative control. CFS were filter-sterilized (0.45-μm pore size; Sartorius, Goettingen, Germany) to eliminate the cells. The CFS were not concentrated. The indicator strains were used to inoculate 20 ml of 1.5 % agar medium (105 CFU/ml). After homogenization, the agar was poured in Petri dishes, air-dried for 30 min, and wells (6 mm diameter) were made. Fifty μl of the CFS was placed into each well of the plates. After prediffusion at 4 °C for 2 h, the plates were incubated under conditions appropriate for each indicator strain. The antimicrobial activity was determined by measuring the diameter of the inhibition zone. The experiments were carried out in triplicate.

The partial sequences of 16S rRNA ribosomal gene obtained in this study were deposited in the NCBI GenBank database under accession numbers: KF684059 (for Lactobacillus gasseri G1), KF684060 (for Lactobacillus crispatus G2), KF684061 (for Lactobacillus gasseri G3), KF684062 (for Lactobacillus crispatus G4), KF684063 (for Lactobacillus crispatus G5), KF684064 (for Lactobacillus crispatus G6), KF684065 (for Lactobacillus gasseri G7), KF684066 (for Lactobacillus crispatus G10), KF684067 (for Lactobacillus gasseri G11), KF684068 (for Lactobacillus vaginalis G12), KF684069 (for Lactobacillus jensenii G16), KF684070 (for Lactobacillus plantarum G19), KF684071 (for Lactobacillus plantarum G20), KF684072 (for Lactobacillus rhamnosus G23), KF684073 (for Lactobacillus rhamnosus G24), KF684074 (for Lactobacillus fermentum G25) and KF684075 (for Lactobacillus rhamnosus G27). Detection of the genes related to bacteriocin production

DNA isolation and PCR amplification of 16S rRNA gene The pure chromosomal DNA was isolated from 2 ml 24-h old cultures, using Gene JET Genomic DNA Purification Kit (Fermentas). Polymerase chain reaction (PCR) was performed with primer pair, universal for eubacterial 16S rRNA genes (forward primer 27F: 5′-AGAGTTTGATCCTGGCTCAG-3′ and reverse primer 1492R: 5′-GGTTACCTTGTTACGACTT-3) (Eden et al. 1991). The PCR amplification was done in a QB-96 Satellite Gradient thermal cycler (LKB Vertriebs GmbH, Vienna, Austria). The 1.5-kb PCR products were visualized in 1 % agarose gel. Obtained PCR amplification product was purified using Gel Band Purification kit (Amersham Biosciences, Uppsala, Sweden), Wizard SV Gel and PCR Clean-Up system (Promega, USA). DNA sequencing, phylogenetic tree and accession numbers To investigate the phylogenetic relationships of Lactobacillus isolates, 16S rRNA gene was partially sequenced (about 700 bp). The nucleotide sequences of the PCR products were determined by BMR-Genomics (Padova, Italy) and Macrogen Inc. (Amsterdam, the Netherland). Primers used for sequencing were as follows: primer Lac 16S-F (AATGAGAGTTTGATCCTGGCT) and primer 800R (TACCAGGGTATCTAATCC) (Lane 1991). The sequences were blasted against the NCBI GenBank database (BLAST, htt p://www.ncbi.nlm.nih.gov/BLAST). Sequence alignment was performed using CLUSTALW (Thompson et al. 1994). Phylogenetic tree was constructed using MEGA4 software (Molecular Evolutionary Genetic Analysis, Tamura et al. 2007), Kimura two-parameter method (Kimura 1980) and neighbor-joining method (Saitou and Nei 1987).

The presence of the following genes associated with bacteriocin production was determined by PCR: gassericin A, gassericin T and acidocin LF221A (Kawai et al. 1998, 2000; Canzek Majhenic et al. 2003). PCR primers and annealing temperatures are shown in Table 2. The following conditions were used for our new primers GTF, GTR and GAF, GAR: denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing 62 °C for 45 s and polymerization at 72 °C for 45 s. An extra final elongation step was performed at 72 °C for 8 min. The sequences of the genes related to bacteriocin production were deposited in the NCBI GenBank database under accession numbers: KF724911 (for gassericin T operon of Lactobacillus gasseri G7 strain), KF724910 (for gassericin A operon of Lactobacillus gasseri G7 strain), KF724908 (for gassericin A operon of Lactobacillus gasseri G3 strain) and KF724909 (gassericin A operon of Lactobacillus crispatus G4 strain). Partial characterization of the antimicrobial substance To study the nature of the inhibitory substances, the active CFS were autoclaved (121 °C for 15 min). After the treatment, the samples were allowed to cool down to room temperature, and the remaining activity was determined. The sensitivity of the antimicrobial substances to proteolytic enzymes was assayed by incubating the CFS (2 h at 37 °C) with: proteinase K, pepsine and trypsin. The enzymes (Sigma, USA) were used at a final concentration of 2 mg ml−1 for proteinase K and 1 mg ml−1 for pepsine and trypsin. The CFS without enzymes, as well as the enzyme solutions, were exposed to the same conditions. After each treatment, the residual antimicrobial activity

13



Arch Microbiol

Table 2  Primers for genes related to bacteriocin production Bacteriocin

Primer

Sequence (5′–3′)

Annealing temperature (C°)

MgCl2 (mM)

Reference

Gassericin A

gaAF gaAR gaTF gaTR LFAF LFAR GTF GTR GAF

GACCACAGCGAACATT AATGAGGCACCAGAAG GGAGTAGGTGGAGCGACAGT TCCACCAGTAGCTGCCGTTA GTTGCAGGATCATGTG TGTTGCAGCTCCGTTA GGTGGGAGAAATAATTGGGC CCTATTACAAACGATATGGCC GAACAGGTGCACTAATCGGT

50

2.5

Kawai et al. (1998)

65

2.5

Kawai et al. (2000)

50

2.5

Canzek Majhenic et al. (2003)

62

2.5

This study

62

2.5

This study

GAR

CAGCTAAGTTAGAAGGGGCT

Gassericin T Acidocin LF221A Gassericin T Gassericin A

was determined by the well-diffusion agar test. All determinations were carried out in duplicate.

Results Identification of vaginal isolates The studied strains are Gram-positive, catalase negative, non-motile, non-sporulating with rod-shaped cell morphology and high ability for medium acidification. Seventeen isolates were identified to species level by 16S rRNA gene sequence analysis. The sequencing of 16S ribosomal RNA gene confirmed the affiliation of all isolates to the genus Lactobacillus. Sequence comparison with the GenBank data (NCBI) showed over than 98 % identity with 16S rRNA genes of the corresponding Lactobacillus type-strain. In this study, the 16S rDNA sequence of four lactobacilli strains belonged to L. gasseri specie, five strains to L. crispatus specie, three strains to L. rhamnosus specie, two strains to L. plantarum specie, one strain to L. jensenii specie, one strain to L. vaginalis specie and one strain to L. fermentum specie. The 16S rDNA sequences from type-strains of different Lactobacillus species with those sequences obtained from these isolated lactobacilli strains were used to establish phylogenetic relationships by the construction of a phylogenetic tree (Fig. 1). Screening for antimicrobial activity The seventeen new Lactobacillus strains isolated from human vagina were screened for their antimicrobial activity (Fig. 2). The inhibition spectra of the isolates tested against 16 Gram (+) and Gram (−) pathogenic and nonpathogenic bacteria are reported in Table 1. Initially, the antimicrobial screening was performed by the agar spot test. All isolates were tested for activity against the 11 indicator bacteria.

13

Only those isolates that showed activity were further tested by well-diffusion test. According to the agar spot test, the highest percentage of vaginal isolates inhibit the growth of Escherichia coli and L. delbrueckii subsp. bulgaricus. According to the well-diffusion test using neutralized, treated with catalase CFS, the number of isolates showing activity was lower. We found that six of the tested strains produced inhibitory substances against two Klebsiella strains, while five lactobacilli strains were active against Staphylococcus aureus LMG 8224. Two vaginal lactobacilli inhibited the growth of Escherichia coli LMG 8063, one isolate was active against Enterococus faecalis LMG 7937T, and one inhibited the growth of Candida parapsilosis strain. Detection of genes related to bacteriocin production All isolates belonging to species of L. acidophilus group were tested for the presence of genes encoding the bacteriocins: gassericin A, gassericin T and acidocin LF221A. Positive results were obtained for one strain (L. gasseri G7) with primers targeting gene-encoding gassericin T and for three strains (L. gasseri G7, L. gasseri G3 and L. crispatus G4) with primers targeting acidocin LF221A. These results were confirmed by sequencing of the PCR products. Multiple unspecific PCR products with different sizes were obtained for strain L. crispatus G6 and L. crispatus G10 using primers amplifying the gene-encoding acidocin LF221A. Unspecific products were amplified also for eleven strains with primers for the gene-encoding gassericin A. Some of the PCR fragments were selected, purified from the gel and sequenced. The sequenced fragments showed no identity with the searched genes. Based on comparison of the sequences with the GenBank database, new primer pairs were designed, targeting gassericin T and gassericin A bacteriocin operons (Table 2). PCR products of 700 bp for gassericin T and of 800 bp for gassericin A operon were observed with our new primers GTF, GTR and GAF, GAR. After sequencing of these amplicons, the

Arch Microbiol

Fig. 1  Phylogenetic tree presents the evolutionary relationships of 35 Lactobacillus taxa (including new isolated strains) based on 16S rRNA partial gene sequences. GenBank accession numbers are indicated in parentheses. Analyses were conducted in MEGA4 software

sequences of gassericin T operon of strain G7 and gassericin A operon of strains G7, G3 and G4 were determined. Effect of different treatments on the antimicrobial substance Partial characterization of the antimicrobial substance was made for the three strains containing genes for bacteriocin production: L. gasseri G7, L. gasseri G3 and L. crispatus G4. The antimicrobial activity of CFS from these strains was completely lost after autoclave treatment.

The filter-sterilized CFS of L. gasseri G7, L. gasseri G3 and L. crispatus G4 strains were inactivated by the proteolytic enzymes proteinase K, pepsine and trypsin, indicating the proteinaceous nature of the inhibitory substances.

Discussion In this study, 17 vaginal lactobacilli strains were recovered from different vaginal samples, obtained from a total of 20 healthy women in reproductive age. All strains belong to

13



Arch Microbiol

Fig. 2  Antimicrobial activity produced by a lactobacilli strain on the growth of indicator strain by agar spot test (a) and well-diffusion agar test (b)

the genus Lactobacillus and were successfully identified by 16S rDNA sequencing analysis. The species L. crispatus (five strains) and L. gasseri (four strains) prevailed among the isolates. Both species belong to the so-called acidophilus group (Berger et al. 2007; Bull et al. 2013). Our studies are fully consistent with studies of other authors on the frequency and identification of lactobacilli from vaginal origin. According to research conducted by Zhou et al. (2004) and Fredricks et al. (2005), the major phylotypes detected by gene amplification in healthy women with a lactobacillus-dominant vaginal microflora are L. crispatus and L. iners, while according to Verhelst et al. (2004), they are L. crispatus and L. gasseri. A culture-independent investigation of vaginal lactobacilli reported that the dominant species were as follows: L. crispatus, L. gasseri and L. jensenii (Pavlova et al. 2002). In a study carried out by El Aila et al. (2009), L. crispatus is the most frequently isolated Lactobacillus species from the vagina, followed by L. jensenii, L. gasseri and L. iners. L. gasseri is a widespread commensal bacterium that inhabits human mucosal niches and demonstrates potential probiotic applications by fulfilling many desirable probiotic attributes (Selle and Klaenhammer 2013). L. jensenii, L. vaginalis, L. fermentum, L. rhamnosus and L. plantarum were also found among our isolates, which is in agreement with results obtained in other studies (Zhou et al. 2004; Stoyancheva et al. 2006; Witkin 2007; Ravel et al. 2011; Sabia et al. 2014). According to some authors, vaginal lactobacilli play an important role in controlling the health of the host. For example, they can positively influence and stabilize the host’s vaginal microbiota via the production of acidic and antimicrobial compounds or exert a direct inhibiting action toward pathogenic bacteria (Boris and Barbe´s 2000; Witkin 2007; Al Kassaa et al. 2014). The production of bacteriocins is one of the main antagonistic mechanisms against colonization by undesirable bacteria (Collado et al. 2005).

13

The antimicrobial activity of the lactobacilli is a phenomenon, which depends on many factors. In our experiments, inhibition caused by hydrogen peroxide and organic acids was ruled out by culturing the producer strains were anaerobically, neutralizing the culture supernatants and treating with catalase before assessing the antimicrobial activity. We can note that the strain shows antimicrobial activity immediately after their isolation as pure cultures. After multiple passages and storage at −80 °C, some strains reduce their activity. Some authors suggest that the bacteriocin production may be a result of strong competition among the microorganisms in the ecosystem they inhabit (Navarro et al. 2000; Corsetti et al. 2004), and the presence and the close contact between competing microorganisms can to be an environmental factor affecting the bacteriocin production by some LAB (Maldonado et al. 2004). The antimicrobial activity was evaluated in all isolated Lactobacillus strains. The inhibitory spectrum of different strains varies greatly. Our results show that some of the observed bacteriocin-like substances were active only against strains of the genus Lactobacillus, whereas others also inhibit pathogenic Gram-positive and Gram-negative bacteria. Approximately 50 % of Lactobacillus isolates showed activity against one or more microorganisms by a well-diffusion test and only 20 % of them suppressed growth of three or more test microorganisms such as: Escherichia coli, Staphylococcus aureus, Klebsiella pneumoniae and Candida parapsilosis. These results are similar to results obtained by other authors for lactobacilli active against a wide spectrum of Gram-positive, Gram-negative bacteria and yeasts (Miteva et al. 1998; Ayeni et al. 2009; Simova et al. 2009; Messaoudi et al. 2011; Gerbaldo et al. 2012; Chen et al. 2014). The inhibitory activity of lactobacilli from vaginal origin is investigated by Al Kassaa et al. (2014), wherein seven strains are active against all pathogens G. vaginalis, S. aureus, E. coli and C. albicans,

Arch Microbiol

while in our study, the different vaginal isolates show activity against different pathogens (Table 1). In our research, we found two L. gasseri strains (G3 and G7) that show inhibitory activity against E. coli, similar to the activity of L. gasseri strains in the work of Al Kassaa et al. (2014). Our L. rhamnosus G27 strain shows 12-mm inhibitory zone against Candida parapsilosis similar to strains from other studies (Simova et al. 2009; Al Kassaa et al. 2014; Sabia et al. 2014). We did not find any isolate that demonstrated inhibitory activity against all tested indicator bacteria. Also no indicator strain that is sensitive to CFS from all isolates was found. It is worth mentioning that the presence of bacteriocin genes in strains is in correlation with the activity of those CFS. There are many studied proteins with antimicrobial activity of the genus Lactobacillus, but only some of the responsible genes are sequenced. The genetic organization of Gram-positive bacteriocins is very diverse (Riley and Wertz 2002; Drider et al. 2006). It is noteworthy that some bacteriocins described in the species L. gasseri show similarity in the gene sequences, but have different names. Most likely, this is the same bacteriocin (according to the nucleotide sequence). The difference in names is probably due to the fact that in some cases, the nucleotide sequence is determined first, while in others, the biochemical characteristics and amino acid sequence were examined in the beginning. The genes, corresponding to our nucleotide sequences, are named according to the name of the first described similar gene. Studying the strain L. gasseri G7, we found and sequenced two operons for different bacteriocins: gassericin A (similar to gassericin K7 A and acidocin LF221A) and gassericin T (similar to gassericin K7 B and acidocin LF221B). Our sequence with accession number KF724910 includes orfA1 putative complemental factor partial cds, orfA2 gassericin K7 A and orfA3 putative immunity protein complete cds. It showed 99 % similarity with nucleotide sequences EF392861.1 (for gassericin K7 A) and AY295874.1 (for acidocin LF221A). It is important to note that gassericin K7 A and acidocin LF221A are two bacteriocins with similar nucleotide sequences from two different strains L. gasseri, described from Majhenic et al. (2003, 2004). Strains L. gasseri K7 and L. gasseri LF221 are of human origin like our isolates. The operon for gassericin K7 A structural gene was also sequenced in two other vaginal strains: L. gasseri G3 (KF724908) and L. crispatus G4 (KF724909). Despite the presence of genes, associated with the production of the bacteriocin, the listed strains showed relatively low antimicrobial activity (Table 1). L. gasseri G3 strain showed antimicrobial activity against Escherichia coli, Klebsiella pneumoniae and certain species Lactobacillus; L. crispatus G4 showed activity against Klebsiella pneumoniae, Staphylococcus aureus

and certain species Lactobacillus; L. gasseri G7 was only active against Escherichia coli. It is interesting to note that gassericin A gene operon is described for the first time in the genome of the species L. crispatus. Similar results were obtained from Kawai et al. (2004) where L. gasseri LA39 and L. reuteri LA6 isolated from human infant were found to produce similar cyclic bacteriocins (named gassericin A and reutericin 6, respectively) that cannot be distinguished by molecular weights or primary amino acid sequences. As mentioned above, the gassericin T region (including gatA and gatX genes) of L. gasseri strain G7 was sequenced. Our sequence with accession number KF724911 shows 100 % similarity with nucleotide sequences for gassericin T gene region (AB710328.1 from L. gasseri SBT2055 and AB029612.1 from L. gasseri LA158) (Kawai et al. 2000). The sequence showed 99 % similarity with acidocin LF221B (AY297947.1, L. gasseri LF221) and gassericin K7 B (AY307382.1) (Majhenic et al. 2004) as well. In conclusion: This study proves that some Lactobacillus strains obtained from human vaginal samples and able to produce active bacteriocins can affect the development of unwanted bacterial species in the human ecosystem. Seventeen strains of the genus Lactobacillus were isolated and identified using 16S rDNA sequencing. Twelve strains producing bacteriocin substances active against various Gram+ and Gram− microorganisms and Candida were found. The genes related to bacteriocin production of three strains were sequenced, and for the first time, gassericin A gene was described in the L. crispatus species. Most inhibitory spectra of vaginal isolates were specific at the strain level, which suggests the use of a combination of bacteriocinogenic strains to inhibit diverse undesired microorganisms. The study of the hemolytic activity, antibiotic sensitivity, hydrophobicity and autoaggregation properties of these strains will be the object of our future research, which could lead to the development of new probiotic therapeutic preparations. Acknowledgments This work was financially supported by research Grant from Federation of European Microbiological Societies (FEMS).

References Al Kassaa I, Hamze M, Hober D, Chihib N, Drider D (2014) Identification of vaginal lactobacilli with potential probiotic properties isolated from women in North Lebanon. Microb Ecol. doi:10.1007/s00248-014-0384-7 Andreu A (2004) Lactobacillus as a probiotic for preventing urogenital infections. Rev Med Microbiol 15:1–6 Atassi F, Brassart D, Grob P, Graf F, Servin AL (2006) Vaginal Lactobacillus isolates inhibit uropathogenic Escherichia coli. FEMS Microbiol Lett 257:132–138. doi:10.1111/j.1574-6968.2006.00163.x

13

Ayeni F, Adeniyi B, Ogunbanwo S, Tabasco R, Paarup T, Peláez C, Requena T (2009) Inhibition of uropathogens by lactic acid bacteria isolated from dairy foods and cow’s intestine in western Nigeria. Arch Microbiol 191:639–648. doi:10.1007/ s00203-009-0492-9 Berger B, Pridmore R, Barretto C, Delmas-Julien F, Schreiber K, Arigoni F, Brussow H (2007) Similarity and differences in the Lactobacillus acidophilus group identified by polyphasic analysis and comparative genomics. J Bacteriol 189:1311–1321. doi:10.1 128/JB.01393-06 Boris S, Barbe´s C (2000) Role played by lactobacilli in controlling the population of vaginal pathogens. Microbes Infect 2:543–546. doi:10.1016/S1286-4579(00)00313-0 Bull M, Plummer S, Marchesi J, Mahenthiralingam E (2013) The life history of Lactobacillus acidophilus as a probiotic: a tale of revisionary taxonomy, misidentification and commercial success. FEMS Microbiol Lett 349:77–87. doi:10.1111/1574-6968.12293 Chapman C, Gibson G, Todd S, Rowland I (2013) Comparative in vitro inhibition of urinary tract pathogens by single-and multi-strain probiotics. Eur J Nutr 52:1669–1677. doi:10.1007/ s00394-013-0501-2 Chen Y, Wang Y, Chow Y, Yanagida F, Liao C, Chiu C (2014) Purification and characterization of plantaricin Y, a novel bacteriocin produced by Lactobacillus plantarum 510. Arch Microbiol 196:193– 199. doi:10.1007/s00203-014-0958-2 Collado M, Hernandez M, Sanz Y (2005) Production of bacteriocinlike inhibitory compounds by human feacal Bifidobacterium strains. J Food Protect 5:900–1111 Corsetti A, Settanni L, Van Sinderen D (2004) Characterization of bacteriocin-like inhibitory substances (BLIS) from sourdough lactic acid bacteria and evaluation of their in vitro and in situ activity. J Appl Microbiol 96:521–534. doi:10.1111/j.1365-2672.2004.02171.x Cotter P, Hill C, Ross R (2005) Bacteriocins: developing innate immunity for food. Nat Rev Microbiol 3:777–788. doi:10.1038/ nrmicro1273 Cox M, Cookson W, Moffatt M (2013) Sequencing the human microbiome in health and disease. Hum Mol Genet 22:R88–R94. doi:10.1093/hmg/ddt398 De Gregorio P, Tomás M, Santos V, Nader-Macías M (2012) Beneficial lactobacilli: effects on the vaginal tract in a murine experimental model. Antonie van Leeuwenhoek J Microbiol 102:569– 580. doi:10.1007/s10482-012-9752-9 Drider D, Fimland G, Héchard Y, McMullen L, Prévost H (2006) The continuing story of class IIa bacteriocins. Microbiol Mol Biol Rev 70:564–582. doi:10.1128/MMBR.00016-05 Eden P, Schmidt T, Blakemore R, Pace N (1991) Phylogenetic analysis of Aquaspirillum magnetotacticum using polymerase chain reaction- amplified 16S rRNA- specific DNA. Int J Syst Bacteriol 41:324–325. doi:10.1099/00207713-41-2-324 El Aila N, Tency I, Claeys G et al (2009) Identification and genotyping of bacteria from paired vaginal and rectal samples from pregnant women indicates similarity between vaginal and rectal microflora. BMC Infect Dis 9:167. doi:10.1186/1471-2334-9-167 Fredricks D, Fiedler T, Marrazzo J (2005) Molecular identification of bacteria associated with bacterial vaginosis. N Engl J Med 353:1899–1911. doi:10.1056/NEJMoa043802 Fujinaka H, Takeshita T, Sato H, Yamamoto T, Nakamura J, Hase T, Yamashita Y (2013) Relationship of periodontal clinical parameters with bacterial composition in human dental plaque. Arch Microbiol 195:371–383. doi:10.1007/s00203-013-0883-9 Gerbaldo GA, Barberis C, Pascual L, Dalcero A, Barberis L (2012) Antifungal activity of two Lactobacillus strains with potential probiotic properties. FEMS Microbiol Lett 332:27–33. doi:10.1111/j.1574-6968.2012.02570.x Hernández D, Cardell E, Zárate V (2005) Antimicrobial activity of lactic acid bacteria isolated from Tenerife cheese: initial

13

Arch Microbiol characterization of plantaricin TF711, a bacteriocin-like substance produced by Lactobacillus plantarum TF711. J Appl Microbiol 99:77–84. doi:10.1111/j.1365-2672.2005.02576.x Kawai Y, Saito T, Suzuki M, Itoh T (1998) Sequence analysis by cloning of the structural gene of gassericin A, a hydrophobic bacteriocin produced by Lactobacillus gasseri LA39. Biosci Biotechnol Biochem 62:887–892. doi:10.1271/bbb.62.887 Kawai Y, Saitoh B, Takahashi O, Kitazawa H, Saito T, Nakajima H, Itoh T (2000) Primary amino acid and DNA sequences of gassericin T, a lactacin F-family bacteriocin produced by Lactobacillus gasseri SBT2055. Biosci Biotechnol Biochem 64:2201–2208. doi:10.1271/bbb.64.2201 Kawai Y, Ishii Y, Arakawa K et al (2004) Structural and functional differences in two cyclic bacteriocins with the same sequences produced by lactobacilli. Appl Environ Microbiol 70:2906–2911. doi :10.1128/AEM.70.5.2906-2911.2004 Kimura M (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16:111–120. doi:10.1007/BF01731581 Klaenhammer T, Kleerebezem M, Kopp M, Rescigno M (2012) The impact of probiotics and prebiotics on the immune system. Nat Rev Immunol 12:728–734. doi:10.1038/nri3312 Lane D (1991) 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M (eds) Nucleic acid techniques in bacterial systematics. Wiley and Sons, New York, pp 115–175 MacPhee R, Miller W, Gloor G, McCormick J, Hammond J, Burton J, Reid G (2013) Influence of the vaginal microbiota on toxic shock syndrome Toxin 1 production by Staphylococcus aureus. Appl Environ Microbiol 79:1835–1842. doi:10.1128/AEM.02908-12 Majhenic A, Matijasic B, Rogelj I (2003) Chromosomal location of the genetic determinants for bacteriocins produced by Lactobacillus gasseri K7. J Dairy Res 70:199–203. doi:10.1017/ S0022029903006162 Majhenic A, Venema K, Allison G, Matijasic´ B, Rogelj I, Klaenhammer T (2004) DNA analysis of the genes encoding acidocin LF221 A and acidocin LF221 B, two bacteriocins produced by Lactobacillus gasseri LF221. Appl Microbiol Biotechnol 63:705–714. doi:10.1007/s00253-003-1424-2 Maldonado A, Ruiz-Barba J, Jiménez-Díaz R (2004) Production of plantaricin NC8 by Lactobacillus plantarum NC8 is induced in the presence of different types of gram-positive bacteria. Arch Microbiol 181:8–16. doi:10.1007/s00203-003-0606-8 Martín R, Miquel S, Ulmer J, Kechaou N, Langella P, BermúdezHumarán L (2013) Role of commensal and probiotic bacteria in human health: a focus on inflammatory bowel disease. Microb Cell Fact 12:71. doi:10.1186/1475-2859-12-71 Messaoudi S, Kergourlay G, Rossero A, Ferchichi M, Prévost H, Drider D, Manai M, Dousset X (2011) Identification of lactobacilli residing in chicken ceca with antagonism against Campylobacter. Int Microbiol 14:103–110. doi:10.2436/20.1501.01.140 Miteva V, Ivanova I, Budakov I, Pantev A, Stefanova T, Danova S, Moncheva P, Mitev V, Dousset X, Boyaval P (1998) Detection and characterization of a novel antibacterial substance produced by a Lactobacillus delbrueckii strain 1043. J Appl Microbiol 85:603–614. doi:10.1046/j.1365-2672.1998.853568.x Navarro L, Zarazaga M, Sáenz J, Ruiz-Larrea F, Torres C (2000) Bacteriocin production by lactic acid bacteria isolated from Rioja red wines. J Appl Microbiol 88:44–51. doi:10.1046/j.1365-2672.2000.00865.x Nissen-Meyer J, Rogne P, Oppegard C, Haugen H, Kristiansen P (2009) Structure-function relationships of the non-lanthionine-containing peptide (class II) bacteriocins produced by gram-positive bacteria. Curr Pharm Biotechnol 10:19–37. doi:10.2174/138920109787048661 Pavlova S, Kilic A, Kilic S, So J, Nader-Macias M, Simoes J, Tao L (2002) Genetic diversity of vaginal lactobacilli from women in

Arch Microbiol different countries based on 16S rRNA gene sequences. J Appl Microbiol 92:451–459. doi:10.1046/j.1365-2672.2002.01547.x Piard J, Desmazeaud M (1992) Inhibiting factors produced by lactic acid bacteria. 2. Bacteriocins and other antimicrobial substances. Lait 72:13–142. doi:10.1051/lait:199229 Ravel J, Gajer P, Abdo Z et al (2011) Vaginal microbiome of reproductive-age women. Proc Natl Acad Sci USA 108:4680–4687 Riley M, Wertz J (2002) Bacteriocin diversity: ecological and evolutionary perspectives. Biochimie 84:357–364. doi:10.1016/ S0300-9084(02)01421-9 Sabia C, Anacarso I, Bergonzini A, Gargiulo R, Sarti M, Condò C, Messi P, De Niederhausern S, Iseppi R, Bondi M (2014) Detection and partial characterization of a bacteriocin-like substance produced by Lactobacillus fermentum CS57 isolated from human vaginal secretions. Anaerobe 26:41–45. doi:10.1016/j. anaerobe.2014.01.004 Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425 Selle K, Klaenhammer T (2013) Genomic and phenotypic evidence for probiotic influences of Lactobacillus gasseri on human health. FEMS Microbiol Rev 37:915–935. doi:10.1111/1574-6976.12021 Simova E, Beshkova D, Dimitrov Zh (2009) Characterization and antimicrobial spectrum of bacteriocins produced by lactic acid bacteria isolated from traditional Bulgarian dairy products. J Appl Microbiol 106:692–701. doi:10.1111/j.1365-2672.2008.04052.x

Stoyancheva G, Danova S, Boudakov I (2006) Molecular identification of vaginal lactobacilli isolated from Bulgarian women. Antonie van Leeuwenhoek J Microbiol 90:201–210. doi:10.1007/ s10482-006-9072-z Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599. doi:10.1093/molbev/msm092 Thompson J, Higgins D, Gibson T (1994) Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680 Verhelst R, Verstraelen H, Claeys G, Verschraegen G, Delanghe J, Van Simaey L, De Ganck C, Temmerman M, Vaneechoutte M (2004) Cloning of 16S rRNA genes amplified from normal and disturbed vaginal microflora suggests a strong association between Atopobium vaginae, Gardnerella vaginalis and bacterial vaginosis. BMC Microbiol 4:16–26. doi:10.1186/1471-2180-4-16 Witkin S (2007) Bacterial flora of the female genital tract: function and immune regulation. Best Pract Res Clin Obstet Gynaecol 21:347–354. doi:10.1016/j.bpobgyn.2006.12.004 Zhou X, Bent S, Schneider M, Davis C, Islam M, Forney L (2004) Characterization of vaginal microbial communities in adult healthy women using cultivation independent methods. Microbiology 150:2565–2573. doi:10.1099/mic.0.26905-0

13