PROTEIN

EXPRESSION

AND

PURIFICATION

3, 169-177 (19%)

Protein Expression from an Escherichia co/i/Baci//~s subtilis Multifunctional Shuttle Plasmid with Synthetic Promoter Sequences William R. Trumble,* Bruce A. Sherf,? Jenny L. Reasoner,? Patricia D. Seward,* Barbara A. Denovan,? Richard J. Douthart,? and James W. West? *Department and tBattelle

Received

January

of Bacteriology and Biochemistry, University of Idaho, N. W. Laboratories, Richland, Washington 99352

15,1992,

and

in revised

form

March

Idaho

83843;

23,1992

A plasmid shuttle vector (pSPl0) was designed and constructed to simplify screening of cloned DNA and to facilitate expression of the protein products. The plasmid contained the following features: (i) a selection gene, chloramphenicol acetyltransferase; (ii) an indicator gene encoding &galactosidase for visual identification of colonies containing DNA inserts; (iii) a cloning region immediately upstream from the indicator gene; (iv) origins of replication recognized by both Escherichia coli and Bacillus subtilis; and (v) a synthetic DNA expression control sequence, including -35 and -10 regions, ribosomal binding site, and transcriptional and translational start sites. The promoter region is a synthetic consensus sequence derived from published B. subtilis promoters. The plasmid has been shown to replicate actively in E. coli and B. subtilis and to confer chloramphenicol resistance to both hosts. DNA inserted at the cloning region inactivates the indicator gene, resulting in white colonies on 5’-bromo-4-chloro-3-indolyl-B-D-galactopyranoside plates. @Galactosidase has been expressed from pSPl0 in both E. coli and Bisubtilis. A comparison was made of the expression levels of B-galactosidase from the same plasmid which had been modified to contain: (i) the synthetic control region, (ii) no promoter region, (iii) the synthetic control region cloned in the opposite orientation, or (iv) the tat promoter. 0 1992 Academic Press, Inc.

Escherichia coli is unquestionably the best understood and most utilized host organism for recombinant DNA studies; however, bacteria within the genus Bacillus possess a number of valuable properties including secretion of certain enzymes into the growth medium, production of antibiotics, absence of pathogenicity for humans and 1046-5928/92 $5.00 Copyright 0 1992 by Academic Press, All rights of reproduction in any form

Moscow,

animals, and favorable growth conditions (1). Functional shuttle vectors between E. coli and B. subtilis were demonstrated in the late 1970s (2,3) and have subsequently been modified to simplify the passage of DNA between these and other host cells with respect to cloning, screening, and expression of genes of interest. Antiobiotic resistance genes, such as chloramphenicol acetyltransferase (cat), are now widely used to allow selection of host cells containing a desired vector (4). The identification of vectors containing the appropriate cloned DNA has been further simplified by the use of indicator genes such as la& (5). However, expression of gene products from shuttle vectors may be complicated due to mechanistic differences for transcriptional and translational initiation between E. coli and B. subtilis. In vitro transcriptional and translational studies with B. subtilis RNA polymerase have shown that the enzyme is extremely sensitive to ionic strength when transcribing DNA from gram-negative organisms (6-9). Moreover, in vitro translation systems derived from B. subtilis and other gram-positive organisms were unable to translate most mRNA from gram-negative organisms (10-17). Such work has lead to the hypothesis that the RNA polymerases in B. subtilis and other gram-positive organisms may have more stringent requirements for contact with conserved nucleotide sequences throughout the promoter region (18,19). We have designed and constructed a multifunctional plasmid shuttle vector (pSP10) to simplify screening of cloned DNA and to facilitate expression of the protein products in both E. coli and B. subtilis. This plasmid incorporates several desirable features. First, origins of replication are included for both E. coli and B. subtilis that allow pSPl0 to replicate actively in both hosts. The second feature is a selection gene, cat, which encodes 169

Inc. reserved.

170

TRUMBLE

ET

TABLE Bacteria Strain

Genotype

or plasmid

E. coli HBlOl TBl MS229 B. subtilis BR151 Plasmids pSKS107 pBR322 pUBll0 PC194 pUC4K pRRR pONU13 pA4 pCLS14 pDHP pSPl0 pSPa pCLS:TAC pSPlOK

or relevent

and

Plasmids Source

F- hsdR hsdM pro leu thi rpsL recA ara (lac-pro) strA thi 8061acZ Ml5 r- m+ Mini-cell-producing strain

American Type Culture T. Baldwin Texas A&M H. R. Kaback University

trpC2

Bacillus

lys-3

met

bio

LacZ+ oril bla+ ori cat+ aph+ cat+ bla+ oril bla/lacZ+ cat+ oril bla/lacZ+ cat+ oril bla/lacZ+ cat+ oril ori -/lacZ+ cat+ oril ori secf/lacZ+ cat+ oril ori antisecf/lacZ+ cat+ oril tac/lacZ+ cat oril ori secf/aph+ cat+ oril ori

AND

1

characteristics

ori

chloramphenicol resistance and allows selection against host cells that do not harbor the cut gene. A third feature, an indicator gene (1ac.Z) encoding P-galactosidase, allows visual identification of colonies containing DNA inserts. The plasmid also incorporates a cloning region immediately upstream of the indicator gene. A final important design feature of pSPl0 is a chemically synthesized consensus DNA sequence which includes -35 and -10 promoter regions, a ribosomal binding site, and transcriptional and translational start sites. The broad host range observed with this plasmid should allow genetic engineering of desirable foreign genes in E. coli and subsequent protein expression from a number of bacterial hosts in selected environments.

MATERIALS

AL.

METHODS

Bacteria and plasmids. The bacterial strains and plasmids used in this study are listed in Table 1. Enzymes and chemicals. Restriction enzymes and DNA-modifying enzymes were obtained from the following suppliers: New England Biolabs (Beverly, MA), Bethesda Research Labs (Gaithersburg, MD) and International Biotechnologies, Inc. (New Haven, CT). [T-“~P]ATP and [a-32P]dCTP were obtained from New England Nuclear (Boston, MA). All other reagents were of the highest quality commercially available. Oligonucleotide synthesis and DNA sequencing. DNA constructs and linker planning and analysis were done using the CAGE/GEM software tool kit (20).

Genetic

Stock

Collection University of CA, Los Center,

Angeles

Columbus,

OH

M. Casadaban University of Chicago Bethesda Research Laboratories, Gaithersburg, American Type Culture Collection American Type Culture Collection Pharmacia LKB Biotechnology, Pleasant Hill, This study This study This study This study This study This study This study This study This study

MD

CA

Oligonucleotides ranging in size from 47 to 58 nucleotides were synthesized on an Applied Biosystems Model 308A, utilizing the automatic cleavage and deblocking steps. The deblocked oligonucleotides were separated from benzoic acid by Sephadex G-50-50 chromatography and full-size synthetic oligonucleotides were isolated by excision from 15% polyacrylamide gels containing 7 M urea. The DNA was eluted from the crushed gel slice by soaking overnight at 4°C in 2 M triethylammonium bicarbonate, pH 8.0, and desalted by G-50-50 chromatography prior to quantification. DNA sequencing was performed as previously described by Chen and Seeburg (21). DNA preparation and transformation. Large-scale preparations of both E. coli and B. subtilis plasmid DNA were made from cleared lysates followed by a CsCIEtBr density gradient centrifugation (4). E. coli transformation was performed as described by Lederberg and Cohen (22). B. subtilis preparations were transformed as previously described by Boylan et ul. (23). P-Galactosidase assays. P-Galactosidase assays followed the procedures described by Miller (24). Single colonies were used as inocula for overnight cultures; dilutions of the overnight cultures were used to inoculate supplemented minimal medium (24). Isopropyl-O-Dthiogalactopyranoside (IPTG, 0.5 mM) was added to the growth medium (at the times indicated by an arrow in Figs. 3, 4, and 5) as an inducer for the tat promoter in the plasmid pCLS:TAC and as a control for constitutive promotion from pSP10. At each time point, 3.0-ml ali-

EXPRESSION

SHUTTLE

VECTOR

WITH

quots were collected. Portions of the aliquots were diluted for viable cell counts and the remaining cells were sonicated. Supernatants from sonicated cells were assayed for /3-galactosidase activity. P-Galactosidase activity was normalized to viable cell count from each time point. The measured P-galactosidase activity was compared between otherwise identical plasmids containing the following different expression controls: the tat promoter (pCLS:TAC), the synthetic promoter (pSPlO), the synthetic promoter cloned in the opposite orientation (pSPa), and no promoter (pDHP). Luria brothagar plates containing 20 pg/ml5’-bromo-4-chloro-3-indolyl-P-D-galactopyranoside (X-gal) were used to qualitatively assess bacterial colonies expressing active fi-galactosidase.

SYNTHETIC

PROMOTER

171

I

RESULTS

Plasmid construction. In designing an E. colilB. subtilis shuttle vector that would simplify screening procedures associated with DNA cloning and gene expression, several features were identified as desirable components. These features included: (i) an origin of replication for each host, (ii) a selection gene, (iii) an indicator gene, (iv) a cloning region, and (v) a region of expression control. The construction of a plasmid incorporating these features is diagrammed in Fig. 1. The plasmid pRRR, constructed in our laboratory, confers resistance to E. coli for the antibiotics chloramphenicol and ampicillin. Additionally, this plasmid, composed of AccIIHindIII fragments from both pC194 and pBR322, contains the oriE from pBR322. A promoterless ZacZ gene, carried on a SmaIIAhaIII fragment isolated from the plasmid pSKS107 (25), was cloned into a ScaI endonuclease recognition site within the /3-lactamase bla gene of pRRR, creating the plasmid pONU13. This DNA insertion placed the la& gene under control of the bla gene promoter, resulting in production of a P-lactamaselp-galactosidase fusion protein. In plasmid pONU13, the cut gene was the selection gene, the la& gene served as the indicator gene, and the replication origin was oriE (Host 1). When transformed into E. coli TBI or HBlOl, pONU13 replicated actively in the presence of chloramphenicol. In the E. coli host TBl, pONU13 mediated expression of P-galactosidase from the 1ac.Z gene, producing blue colonies when grown on X-gal indicator plates. P-Galactosidase expression was not evaluated in host HBlOl due to that host’s intrinsic P-galactosidase activity. To include an origin of replication functional in B. subtilis (Host 2), the plasmid pUBll0 was digested with restriction endonucleases EcoRI and BgZII, generating two fragments. These fragments were cloned independently into pONU13 restricted with EcoRI and BamHI; clones containing the smaller pUBll0 fragment gave

FIG.

1. Genealogy of pSPl0 (ori, origin encoding chloramphenicol acetyltransferase; galactosidase; bla, gene encoding (J’-lactamase; pression control fragment).

of replication; cat, gene lac.Z, gene encoding (5 and secf,synthetic ex-

rise to the plasmid pA4, and insertion of the larger pUBll0 fragment generated the plasmid pCLS14. Gryczan et al. (26) and Tanaka and Sueoka (27) have reported that an active B. subtilis origin of replication is located on the larger pUBll0 EcoRIIBgZII fragment. This conclusion was confirmed by our observations of autonomous replication of pCLS14, but not of pA4, in B. subtilis BR151. Restriction of pONU13 with EcoRI and BamHI excised a DNA fragment containing the bla control region, which was controlling expression of the la& gene. The plasmid pCLS14 now contained each of the desired design features (an origin of replication for each host, a selection gene, and an indicator gene) except expression control, allowing incorporation of an expression control sequence of choice. Design and synthesis of an expression control region. An expression control sequence, which included -10 and -35 promoter regions, a ribosome binding site, and transcriptional and translational start sites, was

172

TRUMBLE

PstI

Comp

TthIII

ET AL.

I

End

Transcription ,GT3:TGAfl:AAGGfiCC5:GGGATCC uCATACTATATAATTTCCATTGGGCCCTAGG BstEII

S.D.

SmaI,

XmaI

BalllliI

in pSP10.

Both

Sequence

TTTCTCCTTAAGTCGTACGGAGATCTT EcoRI

SphI

XbaI

90 100 * AU Ala Glv Arg & AGATCTGCAGGGCGCCTGCA T C ‘I’ A G A C G T C C C G C G G BglII

FIG. 2. endonuclease

Sequence sites

of the synthetic in bold type.

PstI

promoter

NarI

and

schematic

view

Pst1

of the promoter

designed and synthesized in our laboratory (Fig. 2). A synthetic approach was chosen for several reasons. The expression control region would be required to function in both E. coli and B. subtilis and the spacing between specific control elements could be predetermined. The conserved nucleotides identified from published promoter and DNA control region sequences could also be maintained. Additionally, within the constraints of the B. subtilis transcription and translation system, restriction endonuclease recognition sequences unique within the plasmid were incorporated. These restriction sites provide a cloning linker that would facilitate insertion of gene-coding sequences under the control of the desired promoter and allow isolation or “cassetting” of each DNA control element for modifying or interchanging elements before or after cloning of foreign DNA.

region

views

display

unique

restriction

The B. subtilis transcription machinery contains a family of sigma factors that recognize different promoter sequences (28-30). In this sense, the transcriptional apparatus is much more complex than that in E. coli, where one sigma factor (of three or more) appears to recognize a majority of the promoters of the genome (31). The inability of B. subtilis to express genes from E. coli and other gram-negative bacteria (2,32) apparently results because the promoter region recognized by the majority of vegetative B. subtilis RNA polymerase is more sequence specific than that of E. coli. On the basis of this information and the suggestion that B. subtilis promoters might contain conserved nucleotide sequences other than the -10 and -35 regions, an expression control sequence was designed as a consensus of published B. subtilis promoter sequences, in-

EXPRESSION

SHUTTLE

VECTOR

eluding a B. subtilis ribosomal binding site. Promoter sequences for B. subtilis vegetative and tms promoters (33,34), sigma promoters (29,35-37), and SPO promoters (29,34,37) were compiled and analyzed. Published E. coli promoter sequences were also examined (38-40). Figure 2 illustrates the sequence of the synthetic expression control region. This sequence was generated by first aligning published B. subtilis promoter sequences at the -35 and -10 regions and then selecting the nucleotide most utilized among the listed promoters at each position from +l to -45. Exceptions were allowed for incorporating unique restriction sites, setting the desired spacing between control elements, positioning the sequence “A-A-A” in the -40 region, and accommodating some decisions intended to increase the compatibility of the synthetic expression control sequence for E. coli hosts. Spacing was set at 17 nucleotides between the -35 and -10 regions and 7 nucleotides between the Pribnow box and the transcriptional start site. These spacings appear to provide nearly optimal promoter efficiency in both E. coli (37-40) and B. subtilis (33,34,37). The ribosomal binding site was designed complementary to the Bacillus 16s rRNA (30,34,41). It precedes the translational start site by eight nucleotides and is followed immediately by an engineered region containing several restriction endonuclease sites (the cloning region) unique to the plasmid. The synthetic expression control region terminates at the “cloning region” end (3’) with a sequence compatible for cloning into a PstI restriction site which allows regeneration of the PstI endonuclease recognition site. The other end (5’) is likewise compatible for cloning into a PstI restriction site but will not regenerate the PstI recognition sequence. Prior to inserting the synthetic expression control regions into a vector, the plasmid pCLS14 was partially restricted with PstI, and one of the PstI sites was removed, utilizing T4 DNA polymerase in the presence of dCTP. Following selection of a plasmid containing the desired unique PstI site, a Hind111 site was altered by partial digestion with Hind111 and a fill-in reaction, utilizing the large fragment of DNA polymerase (Klenow) plus dATP, dCTP, dGTP, and dTTP. The resulting plasmid, designated pDHP, contained appropriate unique PstI and Hind111 sites configured to accept the synthetic expression control fragment. Insertion of the synthetic expression control fragment into the PstI site of pDHP occurred in both orientations because restriction site compatibilities were identical for both termini. Two plasmids (8668 bp) were isolated (Fig. 1): pSP10, with the desired orientation of the synthetic expression control fragment, and pSPcu, with the opposite or anti-orientation. The sequence of the synthetic control region and the integrity of the in-

WITH

SYNTHETIC

173

PROMOTER

0

1.5

3

4

5

6

7

6

9

IO 24

25

Time (hours)

FIG. 3.

fl-Galactosidase activity measurements for Escherichiu coli MS229. The activities are expressed as Miller units (1 unit is equivalent to the release of 1 wmol of orthonitrophenol per minute, from o-nitrophenyl-@-n-galactopyranoside; see Materials and Methods). The plasmid constructs examined for P-galactosidase expression were similar except for promoter regions and were designated as follows: pSP10, containing the synthetic expression control fragment; pCLS:TAC, containing the TAC promoter; pSPol, containing the synthetic expression control fragment cloned in the anti-orientation; and pDHP, containing no promoter region. The arrow indicates the time of induction if IPTG were added, and induced strains are indicated by the designation (Ind). Each data point shown represents the average of at least two individual data determinations.

frame fusion were confirmed by DNA sequence analysis. Both plasmids, pSPl0 and pSPa, were shown to replicate and confer resistance to chloramphenicol in both E. coli and B. subtilis. The lac- E. coli and B. subtilis host cells both showed lac- phenotypes when transformed with either the plasmids pSP, or pDHP, but showed lm+ phenotype when harboring the pSPl0 plasmid. Relative P-galactosiAnalysis of expression control. dase levels were assayed in E. coli TBl and MS229 and B. subtilis BR151 to assess the effectiveness of the synthetic expression control region in directing protein expression from pSP10. These expression levels were compared with levels from the same vector containing other expression control regions: (i) no synthetic expression control sequence (plasmid pDHP), (ii) the synthetic expression control region cloned in the opposite orientation to that in pSPl0 (plasmid pSPa), and (iii) the well-characterized tat promoter (plasmid pCLS:TAC) substituted for the synthetic expression control region. The expression of P-galactosidase in the E. coli or B. subtilis hosts did not alter the cell growth characteristics (growth curve) or cell count at specified sampling times from values seen for the same host-bearing control plasmids that did not express fi-galactosidase (data not shown). The data in Fig. 3 shows the results of experiments to measure P-galactosidase activity from each plasmid transformed into the E. coli host MS229. At the indi-

174

TRUMBLE

0

0

12

pCLS:TAC

3

(Ind)

4

5

6

7

02425

Tfme (hours)

FIG. 4. P-Galactosidase activity measurements for E. coli TBl. The plasmid constructs used are as described previously and P-galactosidase activities are expressed as Miller units (see the legend to Fig. 3). The arrow indicates the time of induction if IPTG were added, and induced strains are indicated by the designation (Ind). Each data point shown represents the average of at least two individual data determinations.

cated time points (Fig. 3), cell counts were determined and &galactosidase activity was measured spectrophotometrically (24). IPTG (0.5 mM), added at the time inthe tat promoter dicated by an arrow, induced (pCLS:TAC) but did not increase expression of /3-galactosidase in E. coli TBl or MS229 containing pSP10. This suggests a constitutive nature for the synthetic promoter. In the absence of IPTG, pSPl0 (uninduced) routinely produced slightly higher levels of P-galactosidase than pSPl0 in the presence of IPTG (data not shown), but consistently lower levels than induced pCLS:TAC. The pCLS:TAC and pSPl0 plasmids each effectively directed expression of P-galactosidase in MS229, while the plasmids pSPcv and pDHP expressed barely detectable levels of /3-galactosidase. Similarly, relative P-galactosidase expression data from pSP10, pCLS:TAC, pSPcu, and pDHP in the E. coli host TBl are shown in Fig. 4. While fi-galactosidase expression levels were reduced from levels seen in E. coli MS229 host cells, maximum /I-galactosidase expression was observed in TBl cells at 24 h of cell growth. Under these experimental conditions, pSPl0 exhibited the most effective P-galactosidase expression; pCLS:TAC was minimally functional, while pSPa and pDHP expressed ,&galactosidase poorly. As shown in Fig. 5, pSPl0 also expressed ,&galactosidase in B. subtilis BR151 host cells. Expression levels from pSPl0 rose to an experimental maximum at 22 h (final time point). In this host, only pSPl0 was capable of expressing significant levels of fi-galactosidase. The plasmids pCLS:TAC, pSPa, and pDHP all failed to direct more than minimal expression of @galactosidase in B. subtilis BR151.

ET

AL.

It should be noted that B. subtilis does not utilize the lac repressor protein; therefore, it was not anticipated that IPTG would cause any induction of pCLS:TAC in B. subtilis. The results with pCLS:TAC suggest that IPTG, in itself, had no significant influence on P-galactosidase expression in B. subtilis. Enhancement of screening and selection. The previous data indicate the utility of two of the design components of the multifunctional shuttle plasmid pSP10: the origins of replication for E. coli and B. subtilis hosts and the synthetic expression control region. The promoterless kanamycin resistance gene (aph (42)), carried on a 1500-bp BamHI fragment of pUC4K (43), was inserted into the cloning region of pSPl0 (producing pSP1OK) to test the usefulness of two other design features of pSPl0 (the selection gene and indicator gene functions). This plasmid construct was transformed into both E. coli TBl and B. subtilis BR151 hosts and plated on LB agar plates containing 25 pg/ml chloramphenicol and the chromogenic indicator X-gal. The proper function of the selection gene (cat) would be to select against host cells without a plasmid conferring resistance to chloramphenicol. Moreover, proper function of the indicator gene (1ac.Z) would be to indicate, on the same transformation plate, the successful insertion of the kanamycin resistance gene into the cloning region of the vector. Cloning of the aph gene interrupted expression of ,&galactosidase and resulted in white, rather than blue, colonies. Plasmid DNA, isolated from white colonies grown on LB-agar plates containing 50 @g/ml of kanamycin sulfate, contained the 1500-bp fragment (presumed to be the aph gene) when restricted with BamHI (data not shown).

6

012345

22

23

Time (hours)

FIG. 5. /3-Galactosidase activity measurements for the Bacillus subti.!is BR151. The plasmid constructs used are as described previously and P-galactosidase activities are expressed as Miller units (see the legend to Fig. 3). The arrow indicates the time of induction if IPTG were added, and induced strains are indicated by the designation (Ind). Each data point shown represents the average of at least two individual data determinations.

EXPRESSION

SHUTTLE

VECTOR

Four white transformed B. subtilis colonies were also picked for plasmid isolation and growth tests on kanamycin-containing plates. None of the four colonies grew in the presence of 50 pg/ml of kanamycin sulfate (see Discussion). Since Kreft et al. (2) reportedly could not express kanamycin resistance in B. subtilis, plasmid DNA was reisolated from these Bacillus and retransformed into E. coli TBl. The resulting recombinant E. coli were kanamycin resistant and the plasmid DNA contained the 1500-bp BamHI fragment (data not shown). In similar experiments, a small synthetic gene encoding an IgG binding protein was cloned into pSPl0 (manuscript in preparation) and this plasmid was transformed into B. subtilis BR151 host cells. From one B. subtilis transformation plate, five white colonies were chosen and grown in liquid culture, and the plasmid DNA was isolated and analyzed by restriction mapping. In all five cases, the plasmid DNA contained the sequence for the small synthetic gene. In these experiments, the multifunctional shuttle vector greatly enhanced our ability to screen for: (i) DNA inserted into the cloning region of pSP10, (ii) transformed colonies which contained the shuttle vector plasmid, and (iii) colonies that produced the protein encoded by the inserted gene. The potential usefulness of pSPl0 is increased by its relatively broad host range. The plasmid has been successfully transformed into E. coli, B. subtilis, (this laboratory), Streptomyces Ziuidans (D. Crawford, Department of Bacteriology and Biochemistry, University of Idaho, personal communication), and Clauibacter michigunensis subsp. sepedonicus (C. Orser, Department of Bacteriology and Biochemistry, University of Idaho, personal communication). DISCUSSION

The plasmid pSPl0 has been shown to perform as a multifunctional E. colilB. subtilis shuttle vector, with design features that simplify selection and screening efforts. Moreover, it directs protein production in both hosts utilizing a synthetic expression control region. While the P-galactosidase protein was expressed in both E. coli and B. subtilis hosts, kanamycin resistance was observed only in E. coli. The lack of kanamycin resistance in B. subtilis is not attributed to unsuccessful transformation, lack of autonomous replication by the plasmid, or modification of the DNA since the plasmid DNA reisolated from B. subtilis conferred kanamycin resistance when transformed into E. coli. Kreft and coworkers (2) have reported that several E. coli gene-encoded antibiotic resistance proteins, including kanamytin, could not be expressed in B. subtilis. From our study, we cannot resolve whether the inability to express kanamycin resistance in B. subtilis resides within

WITH

SYNTHETIC

PROMOTER

175

the shuttle vector synthetic expression control region or some other control mechanism. We suggest that a plausable reason is the effect of species specificity of protein translation (see above). The intent of this plasmid construct was not to provide a high-level expression system for E. coli and/or B. subtilis, but rather to design a vector that would allow protein expression from cloned gene-coding sequences at a detectable level in either host. The ability of the synthetic expression control region to be removed as a cassette was incorporated to allow postcloning modification of expression control should higher protein expression levels be required. The 1ucZ gene, encoding P-galactosidase, was used in pSPl0 for two purposes. First, selected genes inserted into the cloning region of pSPl0 result in a disruption of fl-galactosidase expression, allowing the 2uc.Z gene to provide an indicator function for DNA appropriately cloned into the vector. Second, the lacZ gene served as a “foreign” cloned gene, suitable to allow testing of the ability of the synthetic control region to express a heterologous gene product in both E. coli and B. subtilis. Expression of P-galactosidase controlled by the synthetic promoter was compared to that from the wellcharacterized tuc promoter in both E. coli and B. subtilis. In E. coli, the synthetic promoter was constitutive and resulted in elevated P-galactosidase expression levels of the same order of magnitude as those expressed by the tuc promoter. Using B. subtilis as the host organism, the difference in expression levels from the synthetic and tat promoters was much more pronounced. The synthetic promoter in B. subtilis expressed P-galactosidase at the same relative level as that seen in E. coli MS229. Expression of @galactosidase in B. subtilis from the tuc promoter was barely detectable using o-nitrophenyl-fiD-galactopyranoside as the substrate and could not be seen at all on X-gal indicator plates. In addition to providing an E. colilB. subtilis shuttle vector with simplified screening characteristics, we expect the prototype plasmid, pSP10, to serve as a valuable tool for further elucidation of the requirements and characteristics affecting expression control in both E. coli and B. subtilis. Since the synthetic expression control region, which contains cassetted DNA control elements, functions in both hosts, it will be possible to selectively modify expression control parameters such as spacing, putative conserved sequences throughout expression-control regions, alternative promoters, or ribosomal binding requirements by synthesis of new sequences. These can be readily interchanged with existing control elements of pSP10, and the effects of such changes on gene expression can be evaluated in both gram-positive and gram-negative hosts. The broad host range of the pSPl0 plasmid is expected to support a wide spectrum of applications, allowing genetic engineering of desirable foreign genes in

176

TRlJMBLE

E. coli and subsequent expression in a number of bacterial hosts in selected environments. ACKNOWLEDGMENTS This work was supported in part by Corporate Technical Development, Battelle Memorial Institute, NSF Grant RII-890-2065 (to W.R.T.), EPA Grant R-815250-01-0 (to W.R.T.), and the Idaho State Board of Education Specific Research Grant Program 91-055 (to W.R.T.). This is a publication of the Idaho Agricultural Experiment Station. REFERENCES

AL.

16.

Legault-Demare, L., and Chambliss, G. H. (1975) Selective messenger translation of Bacillus subtilis ribosomes. Mol. Gen. Genet. 142, 277-287. 17. McLaughlin, J. R., Murray, C. L., and Rabinowitz, J. C. (1981) Initiation factor-independent translation of mRNAs from grampositive bacteria. Proc. Natl. Acad. Sci. USA 78, 4912-4916.

18.

Murray, C. L., and Rabinowitz, J. C. (1982) of transcription and translation initiation phage $29 early genes. J. Biol. Chem. 257,

19.

Graves, M. transcription Biol. Chem.

C., and Rabinowitz, of the Clostridium 261, 11,409-11,415.

J. C. (1986) pasteurianum

Nucleotide regions

sequences in Bacillus

1053-1062.

In uiuo and in vitro ferredoxin gene. J.

Douthart, R. J., Thomas, J. J., Rosier, S. D., Schmaltz, J. E., and West, J. W. (1986) Cloning simulation in the CAGE environment. Nucleic Acids Res. 14, 285-297. 21. Chen, E. Y., and Seeburg, P. H. (1985) Supercoil sequencing: A fast and simple method for sequencing plasmid DNA. DNA 4, 20.

V. G. (1982) The industrial 1. Debahov, ular Biology of the Bacilli” (Dubnau, 370, Academic Press, New York.

use ofbacilli, D. A., Ed.),

in “The MolecVol. 1, pp. 330-

2. Kreft, J., Bernhard, K., and Goehel, W. (1978) Recombinant mids capable of replication in B. subtilis and E. coli. Mol. Gemt. 162, 59-67.

plasGen.

3. Rapoport, G., Klier, A., Billault, A., Fargette, F., and Dedonder, R. (1979) Construction of a colony hank of E. coli containing hybrid plasmids representative of the Bacillus subtilis 168 genome. Expression of functions harbored by the recombinant plasmids in B. subtilis. Mol. Gen. Genet. 176, 239-245. 4. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 5. Messing, J. (1983) New Ml3 vectors for cloning, in “Methods in Enzymology” (Wu, R., Grossman, L., and Moldave, K., Eds.), Vol. 101, pp. 20-78, Academic Press, San Diego. 6. Davison, B. L., Leighton, T., and Rabinowitz, J. C. (1979) Purification of Bacillus subtilis RNA polymerase with heparin-agarose: In vitro transcription of $29 DNA. J. Biol. Chem. 254,9220-9226. 7. Shorenstein, R. G., and Losick, R. (1973) Purification and properties of the sigma subunit of ribonucleic acid polymerase from vegetative Bacillus subtilis. J. Biol. Chem. 248, 6163-6169. C. L., and Rabinowitz, J. C. (1981) RNA polymerase 8. Murray, from Clostridium acidiurici. J. Biol. Chem. 256, 5153-5161. C., and Pero, J. (1980) Nucleotide sequences 9. Lee, G., Talkington, of a promoter recognized by Bacillus subtilis RNA polymerase. Mol. Gen. Genet. 180, 57-65. 10. Lodish, J. F. (1970) Specificity Role of initiation factors and 705-707. 11. Stallcup, synthesis translation

ET

in bacterial protein synthesis: ribosomal subunits. Nature 226,

M. R., and Rabinowitz, J. C. (1973) in vitro by a Clostridial system. of natural messenger ribonucleic

Initiation of protein I. Specificity in the acids. J. Biol. Chem.

165-170. 22.

Lederberg, Salmonella Bacterial.

23.

Boylan, R. J., Mendelson, N. H., Brooks, (1972) Regulation of the bacterial cell wall: of Bacillus subtilis defective in biosynthesis Bacterial. 110, 281-290.

14. Stallcup, M. R., Sharrock, W. J., and Rabinowitz, J. C. (1976) Specificity of bacterial ribosomes and messenger ribonucleic acids in protein synthesis reactions in vitro. J. Biol. Chem. 251, 2499-2510. 15. Leffler, S., and Szer, W. (1974) Polypeptide chain initiation in Caulobacter crescentus without initiation factor IF-l. J. Biol. Chem. 249, 1465-1468.

of J.

D., and Young, F. E. Analysis of a mutant of teichoic acid. J.

Miller, J. H. (1972) “Experiments in Molecular Genetics,” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 25. Casadaban, M. J., Martinez-Arias, A., Shapira, S. K., and Chou, J. (1983) P-Galactosidase gene fusions for analyzing gene expression in E. coli and yeast, in “Methods in Enzymology” (Wu, R., Grossman, L., and Moldave, K., Eds.), Vol. 100, pp. 293-308, Academic Press, San Diego. T. J., Contente, S., and Dubnau, D. (1978) Characteriza26. Gryczan, tion of Staphylococcus aureus plasmids introduced by transformation into Bacillus subtilis. J. Bacterial. 134, 318-329. 27. Tanaka, T., and Sueoka, N. (1983) Site-specific in vitro binding of plasmid pUBll0 to Bacillus subtilis membrane fraction. J. Bacteriol. 154,1184-1194. 24.

28.

Doi, R. H. (1982) Multiple transcriptional specificity Biophys. 214, 772-781.

RNA polymerase holoenzymes exert in Bacillus subtilis. Arch. Biochem.

29. Johnson, W. C., Moran, C. P., and Losick, R. (1983) Two RNA polymerase sigma factors from Bacillus subtilis discriminate between overlapping promoters for a developmentally regulated gene. Nature 302,800-804. 30. Gitt, M. A., Wang, L-F., and Doi, R. H. (1985) A strong sequence homology exists between the major RNA polymerase and factors of Bacillus subtilis and Escherichia coli. J. Biol. Chem. 260, 7178-

248,3209-3215.

12. Stallcup, M. R., and Rabinowitz, J. C. (1973) Initiation of protein synthesis in vitro by a Clostridial system. II. The roles of initiation factors and salt-washed ribosomes in determining specificity in the translation of natural messenger ribonucleic acids. J. Biol. Chem. 248,3216-3219. 13. Stallcup, M. R., Sharrock, W. J., and Rahinowitz, J. C. (1974) Ribosome and messenger specificity in protein synthesis by bacteria. Biochem. Biophys. Res. Commun. 56, 92-98.

E. M., and Cohen, S. N. (1974) Transformation typhimurium by plasmid deoxyribonucleic acid. 119, 1072-1074.

7185.

Doi, R. H., Halling, S. M., Williamson, V. M., and Burtis, K. C. (1980) Sigma factor is not released during transcription in Bacillus subtilis, in “Genetics and Evolution of RNA Polymerase, tRNA and Rihosomes” (Osawa, S., Oseki, H., Hchida, H., Yura, T., Eds.), pp. 117-136, Univ. of Tokyo Press, Tokyo. 32. Ehrlich, S. D. (1978) DNA cloning in Bacillus subtilis. Proc. Natt. Acad. Sci. USA 75,1433-1436. 33. Ogasawara, N., Moriya, S., and Yoshikawa, H. (1983) Structure and organization of rRNA operons in the region of the replication origin of the Bacillus subtilis chromosome. Nucleic Acids Res. 11, 31.

6301-6318. 34.

Moran, C. P., Lang, N., LeGrice, S. F. J., Lee, G., Stephans, M., Sonenshein, A. L., Pero, J., and Losick, R. (1982) Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis. Mol. Gen. Genet. 186, 339-346.

EXPRESSION R., and Pero,

J. (1981)

Cascade

SHUTTLE of sigma

factors.

VECTOR

WITH

Cell 25,

40.

35.

Losick, 582-584.

36.

Murphy, N., McConnell, D. J., and Cantwell, B. A. (1984) The DNA sequence of the gene and the genetic control sites for the excreted B. subtilis enzyme cu-gluconase. Nucleic Acids Res. 12,

5355-5367.

SYNTHETIC

177

PROMOTER

Aoyama, T., Takanami, M., Outsuka, E., Taniyama, Y., Marumoto, R., Sato, H., and Ikehara, M. (1983) Essential structure of E. coli promoter: Effect of spacer length between the two consensus sequences on promoter function. Nucleic Acids Res. 11,5855-

5864. 41.

82,2679-2683. 38. Hawley, D. K., and McClure,

Murray, C. L., and Rabinowitz, J. C. (1982) Species specific translation: Characterization of B. subtills ribosome binding sites, in “Molecular Cloning and Gene Regulation in Bacilli” (Ganesan, A. T., Chang, S., and Hoch, J. A., Eds.), pp. 271-285, Academic Press, New York.

42.

Oka, A., Sugisake, H., and Takanami, quence of the kanamycin resistance Biol. 147,217-226.

M. (1981) transposon

39.

43.

Vieira, J., and M13mp7-derived ing with synthetic

The pUC plasmids, an mutagenesis and sequencGene 19, 259-268.

37. Cowing,

D. W., Bardwell, J. C. A., Craig, E. A., Woolford, C., Hendrix, R., and Gross, C. A. (1985) Consensus sequence for Escherichia coli heat shock gene promoters. Proc. Natl. Acad. Sci. USA

W. R. (1983) Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 11,2237-2254. Galas, D. J., Eggert, M., and Waterman, M. S. (1985) Rigorous pattern-recognition methods for DNA sequences. J. Mol. Biol. 186,117-128.

Messing, J. (1982) system for insertion universal primers.

Nucleotide seTn903. J. Mol.