Accepted Article
Article Type: Original Article
Bacillus amyloliquefaciens strain 32a as a source of lipopeptides for biocontrol of Agrobacterium tumefaciens strains
Running title: Lipopeptides for control of crown gall disease
D. Ben Abdallah, O. Frikha-Gargouri and S. Tounsi Biopesticides Team (LPAP), Centre of Biotechnology of Sfax, University of Sfax, P.O. Box “1177” 3018, Sfax, Tunisia
Corresponding author *Corresponding author: Slim Tounsi, Biopesticides Team [L.P.I.P.], Center of Biotechnology of Sfax, University of Sfax, P.O. Box 1177, 3018 Sfax, Tunisia Tel. /Fax: +216 (74) 872091 E-mail address: [email protected]
Abstract Aims: A Bacillus amyloliquefaciens strain, designated 32a, was used to identify new compounds active against Agrobacterium tumefaciens and to evaluate their efficiency to control crown gall on carrot discs. Methods and Results: Based on PCR-assays, four gene clusters were shown to direct the synthesis of the cyclic lipopeptides surfactin, iturin A, bacillomycin D and fengycin. Mass spectrometry analysis of culture supernatant led to the identification of these secondary This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an 'Accepted Article', doi: 10.1111/jam.12797 This article is protected by copyright. All rights reserved.
Accepted Article
metabolites, except bacillomycin, with heterogeneous mixture of homologues. Antimicrobial assays using lipopeptides-enriched extract showed a strong inhibitory activity against several bacterial and fungal strains, including A. tumefaciens. Biological control assays on carrot discs using both 32a spores and extract resulted in significant protection against crown gall disease, similar to that provided by the reference antagonistic strain Agrobacterium rhizogenes K1026. Conclusions: In contrast to all active compounds against A. tumefaciens that are of proteinaceous nature, this work enables for the first time to correlate the strong protective effect of B. amyloliquefaciens strain 32a towards crown gall disease with the production of a mixture of lipopeptides. Significance and Impact of the Study: The findings could be useful for growers and nursery men who are particularly interested in the biocontrol of the crown gall disease.
Keywords: Bacillus amyloliquefaciens, lipopeptides, biological control, Agrobacterium tumefaciens, crown gall disease.
Introduction Agrobacterium tumefaciens is a soil-borne Gram-negative bacterium. It causes crown gall tumors on a wide range of plants, including economically important fruit and nut crops, grapes, ornamental and landscape plants. Losses in production yields associated with this disease have often been reported in temperate areas, and especially in Mediterranean countries. The disease has been described as a form of ‘genetic colonization’ in which the transfer and expression of a suite of Agrobacterium genes in a plant cell causes uncontrolled cell proliferation and the synthesis of nutritive compounds that can be metabolized specifically by the infecting bacteria (Escobar and Dandekar 2003). In Tunisia, crown gall is
This article is protected by copyright. All rights reserved.
Accepted Article
currently a major handicap for the production of plants, in particular stone fruit trees (Zouba and Hammami 1988, Rhouma et al. 2001, Yangui et al. 2008). To limit its spread, the Tunisian Ministry of Agriculture authorizes trade of nursery productions only if they bear less than 1% visible galls (Rhouma et al. 2008). A strict sanitary control of imported propagating material for the presence of crown gall has been enforced in the country. In spite of the preventive measures, that are being taken, crown gall continues to cause important damage in nurseries and in the field. Although the biocontrol agents of Agrobacterium rhizogenes strains K84 and K1026 are commercially available for the control of A. tumefaciens, new strains are required. This is partly because of the facts that K84 can transfer resistance of genes that control agrocine K84 (pAgK84) production to the crown gall pathogens and that it’s genetically modified derivative K1026 is not registered for use in Tunisia as well as in other countries for its genetically modified status. Thus, there is a need for the screening of new micro-organisms that can be used to control the crown gall disease. Pertinent to this gap in research is the fact that Bacillus species have often been reported to be among the most beneficial bacteria that can be exploited as biopesticides in plant health care (Pérez-Garcia et al. 2011). The features contributing to their success are the production of a vast array of biologically active molecules potentially inhibitory of phytopathogen growth and the formation of spores that ensures permanence in diverse habitats under hostile environmental conditions and also ease of the formulation of feasible long-term commercial products (Broggini et al. 2005).
Lipopeptides probably represent the most common class of compounds produced by Bacillus spp. (Zeriouh et al. 2011). These amphiphilic compounds share a common structure consisting of a lipid tail linked to a short cyclic oligopeptide. Bacillus lipopeptides are synthesized non-ribosomally via large multi-enzymes. These biosynthetic systems lead to a
This article is protected by copyright. All rights reserved.
Accepted Article
fengycins A (C16 and C17) and B (C16) are also synthesized, 32a could be added to the limited number of B. amyloliquefaciens strains reported to co-produce the three families of lipopeptides (Koumoutsi et al. 2004; Arguelles-Arias et al. 2009).
In our study, it was possible to associate the presence of lipopeptides in the culture supernatant of B. amyloliquefaciens strain 32a with their biosynthetic genes. However, although that the peptide synthetase gene involved in the production of bacillomycin was detected by PCR, the latter was not found in the culture supernatant of strain 32a. It has been reported that the presence of a particular gene is not necessarily associated with its involvement in the biocontrol capacity (Joshi and McSpadden Gardener 2006). In fact, their expression depends on many factors, such as growth conditions, the presence of target microorganisms or the possibility of mutations in biosynthetic genes which can cause their inactivation. Antibacterial activity was detected at the transition between exponential and stationary phase of growth, increasing progressively during the latter and reaching the highest activity level after 2 days of growth, when bacterial populations are composed mainly by spores. It has been reported that the production of lipopeptides with antibacterial activity, such as surfactin, is advanced (transition between exponential and stationary growth) as compared with iturin or fengycin (late stationary-phase growth) (Stein 2005). Surfactin and iturin molecules exhibit antibacterial properties in vitro and could be involved in biocontrol functions in the rhizosphere. In fact, Bais et al (2004) showed that surfactin produced by B. subtilis 6051 is necessary for the reduction of the infection caused by Pseudomonas syringae on Arabidopsis plants. Furthermore, a contribution of closely related iturin A and bacillomycin was recently shown in the antagonism of B. subtilis toward bacterial diseases of cucurbits (Zeriouh et al. 2011).
This article is protected by copyright. All rights reserved.
Accepted Article
lipopeptides produced by a newly-isolated local strain of B. amyloliquefaciens named 32a, to characterize the antibacterial activity of these compounds in in vitro bioassays and to evaluate their biocontrol capacity in vivo against two strains of A. tumefaciens (C58 and B6) recognized as the major causal agents of crown gall disease.
Materials and methods Antagonistic bacteria The strain 32a used in the present study was originally isolated from a Tunisian soil sample. It was selected among hundreds of other isolates available at our local laboratory collection due to its broad spectrum of antagonist activity towards bacterial and fungal pathogens. Cells were grown at 30°C in an optimized medium (OM) for bioactive compounds production (Mezghanni et al. 2012) for 24 h with shaking at 200 rpm.
Pathogenic strains and culture conditions Four plant pathogenic bacteria were used in this study: strains C58 and B6 of Agrobacterium tumefaciens, Pseudomonas savastanoi and Erwinia amylovora. These strains were kindly provided by the Olive Institute of Sfax, Tunisia. The bacterial strains were maintained for long-term storage at -80°C using glycerol 15%. Fresh bacterial cultures were obtained from frozen stocks prior to experimentation and were cultured at 30°C on LuriaBertani (LB) agar.
Antifungal activity was determined against seven phytopathogenic fungi which are Alternaria alternata, Aspergillus niger, Fusarium culmorum, Fusarium graminearum, Fusarium oxysporum, Rhizopus nigricans and Botrytis cineria. The fungi were provided by the strain collection of the Centre of Biotechnology of Sfax, Tunisia. Stock culture of each
This article is protected by copyright. All rights reserved.
Accepted Article
pathogen was maintained on potato dextrose agar (PDA) at 4°C. Working culture was established by transferring a stock agar plug containing mycelium onto PDA in Petri plates and incubating for 7 days in the darkness at 25°C.
Taxonomical studies Strain 32a was tested for various phenotypic properties including morphology, physiology and biochemical characteristics, as described in the Bergey’s Manual of Systematic Bacteriology (Holt et al. 1994). The molecular approach was carried out by 16S rDNA sequencing. Amplification was carried out by PCR with the universal primers Fd1 (5’AGAGTTTGATCCTGGCTCAG-3’)
and
Rd1
(5’-AAGGAGGTGATCCAGCC-3’),
designed from the conserved zones within the rRNA operon of E. coli (Gurtler and Stanisich 1996). The genomic DNA of the strain 32a, extracted by standard protocols (Sambrook and Russell 2001), was used as a template for PCR amplification. Thermal cycler conditions consisted of an initial denaturation at 94°C for 2 min followed by 30 cycles; each one composed of denaturation at 94°C for 30s, annealing at 53°C for 1 min, and extension at 72°C for 2 min. The amplified ∼1.5 kbp product was purified from agarose gel followed by sequencing in an automatic sequencer (Avant Genetic analyzer, 3100 model). Homology search was performed using Blast algorithm. Accession number obtained from GenBank for deposited partial 16S rRNA nucleotide sequence was KP334099. Phylogenetic analyzes were performed using the PHYLIP package programs (Felsenstein 2004) and the phylogenetic tree was constructed by the neighbor-joining (NJ) algorithm using Kimura ten-parameter distance. The branching pattern was checked by 1,000 bootstrap replicates. To confirm identification, PCR amplification of 16S rRNA gene was followed by restriction fragment length polymorphism analysis (Jeyaram et al. 2011).
This article is protected by copyright. All rights reserved.
Accepted Article
Isolation and identification of lipopeptides using LC-MS analysis Lipopeptides isolation was performed by the acid precipitation according to Zhang et al. (2008). Briefly, the crude cell-free culture was adjusted to pH 2 with 6 mol l-1 HCl and was stored overnight at 4°C. After centrifugation, the precipitate was extracted twice with five times volume of methanol. The solution was dried with a rotary vacuum evaporator and the remaining dry residue was dissolved in 50 mmol l-1 Tris-HCl, pH 7.5 buffer and then filtered through 0.22 µm filter.
Putative lipopeptides were identified as described by Malfanova et al. (2012) using LC-MS analysis. Briefly, the crude methanolic extract, prepared as describe above, was analyzed by reverse-phase high-pressure liquid chromatography using an Agilent 1100 LC system. The chromatographic separation was performed using a Zorbax 300Å Extend-C-18 Column (4.6 × 250 mm). The column outlet was coupled to an Agilent MSD Ion Trap XCT mass spectrometer equipped with an ESI ion source. Surfactins were eluted in the isochratic mode (78% acetonitrile in water acidified with 0.1% formic acid). Iturins and fengycins were selectively desorbed by using acetonitrile gradients from 35% to 65% in 35 min and from 40% to 60% in 40 min, respectively. All elution programs used a flow rate of 0.5 ml/min at 214 nm and detection occurred using the negative ion mode at m/z ranging from 400 to 2000. The identity of each metabolite was obtained on the basis of the mass of molecular ions detected in the SQD by setting electrospray ionisation conditions in the MS.
PCR detection of lipopeptide biosynthesis genes Primers used in the PCR amplifications of lipopeptide biosynthesis genes are listed in Table 1. PCR amplifications were conducted in a 50 µl reaction mixture containing 10 μl of 5× PCR buffer, 4 μl of 25 mmol l-1 MgCl2, 5 μl of dNTP-mix (0.2 mmol l-1), 5 μl of each
This article is protected by copyright. All rights reserved.
Accepted Article
forward and reverse primer (10 mmol l-1), 2 U of Taq DNA polymerase (GoTaq), and 50 ng of template DNA. Thermal cycler conditions consisted of an initial denaturation step at 95°C for 5 min followed by 30 cycles of denaturation at 95°C for 1 min, 50 to 58°C primer annealing for 1 min and 72°C extension for 1.5 min followed by a final extension step at 72°C for 7 min. Amplified PCR product was purified from agarose gel and sequenced by an automatic sequencer (Avant Genetic analyzer, 3100 model). PCR sequences were identified using the basic local alignment search tool and GenBank nucleotide data bank from the National
Center
for
Biotechnology
Information,
Bethesda,
MD,
USA
(http://www.ncbi.nlm.nih. gov/). Accession numbers obtained from GenBank for deposited partial nucleotide sequences of bmyB ituC, ituD, sfP and fenD are KP453869, KP453870, KP453871, KP453872 and KP453873, respectively.
Antimicrobial activity determination Antimicrobial activities of the lipopeptides-enriched extract were detected by the disc diffusion assay according to Mahesh and Satish (2008). Cell suspensions of each indicator strain were prepared and 100 µl were inoculated onto the surface of agar plates. Filter paper discs (5 mm in diameter), impregnated with different concentrations of the extract, were placed on test organism-seeded plates. Blank disc impregnated with Tris-HCl (50 mmol l-1; pH 7.5) was used as negative control. The antimicrobial activity was evaluated by measuring inhibition zones against the tested microorganisms.
Biochemical characterization of antagonistic supernatant The antibacterial activity of cell-free filtrate was subjected to stability tests (resistance to extreme pH and thermal conditions, enzymatic degradation, solubility in organic solvents) and estimation of molecular size using a Centricon centrifugal filter device (5 kDa)
This article is protected by copyright. All rights reserved.
Accepted Article
(Millipore Corporation) (Romero et al. 2007). After the different treatments, antibacterial activity against A. tumefaciens strains was evaluated by the well diffusion method (Tagg and McGiven. 1971).
Antibacterial compounds production during growth of B. amyloliquefaciens To determine the relationship between growth and production of antibacterial compounds, the strain 32a was grown in 250 ml Erlenmeyer flasks containing 50 ml of OM. Incubation was carried out in an orbital shaker for three days at 30ºC and 200 rpm. Culture samples were taken at different times and were used to determinate the number of viable cells (colony forming units, CFU) as described previously by Motta and Brandelli (2002). The number of spores was determined after a heat treatment at 80°C for ten minutes. To test the antibacterial activity, precipitated lipopeptides were dissolved in 50 mmol l-1 Tris-HCl, pH 7.5 and tested as described above.
Effect of the lipopeptides-enriched extract on Agrobacterium cells growth In order to assess the mode of action of the lipopeptides-enriched extract, isolated lipopeptides; obtained by acid precipitation; at 200 AU ml-1 were applied on actively growing cells of each pathogen (5 × 108 (CFU ml-1)) and incubated at 30°C. The survival of the indicator strains was monitored (expressed as CFU ml-1) and the optical density (OD) was measured at 600 nm at different time intervals. The number of viable cells was counted after overnight incubation at 30°C in LB agar medium. Biocontrol tests A carrot discs bioassay was used to determine the ability of antagonist bacterium to suppress the incidence and severity of bacterial crown gall of A. tumefaciens. Carrot samples (Daucas carota L.) were sterilized with commercial bleach, rinsed twice with sterile distilled
This article is protected by copyright. All rights reserved.
Accepted Article
water, cut into equal slices and placed into Petri dishes. Four treatments were performed: 32a spores suspension, 32a lipopeptide-enriched extract, K1026 cells suspension and water. Cell suspensions of the bacterial pathogen and the biocontrol agents were inoculated at the same concentration on the carrot slices. Each treatment included thirty discs. Petri dish was sealed by parafilm and incubated in growth chamber (controlled environment; 28°C). After three weeks, the disks were checked for young galls developing from the meristematic tissue around the central vascular system.
Statistical analysis The data were subjected to analysis of variance using the Statistical Package for the Social Sciences (SPSS V.11; SPSS Inc., Chicago, IL, USA). The mean values among the treatments were compared using the Duncan’s multiple range test at the 5% level of significance (p = 0.05).
Results Identification of strain 32a Among several antimicrobial activity-producing bacteria isolated from soil, one antagonist strain called 32a was selected for its broad spectrum activity against various phytopathogenic bacteria and fungi. Classical taxonomic findings showed that the newly isolated bacterium 32a is Gram-positive, catalase-positive, oxydase-positive, aerobic, motile, rod shaped and spore forming bacterium. In a molecular approach, the genomic DNA of this strain was used as a template to amplify a 1450 bp PCR-fragment coding for the 16S rRNA. The DNA fragment was purified and sequenced. DNA similarity searches against bacterial databases revealed that the 16S rRNA sequence of 32a was more than 99% identical to both Bacillus subtilis (JQ308548.1) and B. amyloliquefaciens (HQ844503.1). Furthermore, the
This article is protected by copyright. All rights reserved.
Accepted Article
neighbor joining phylogenetic tree constructed with 16S rRNA gene sequences of other members of the genus Bacillus, Brevibacillus and Paenibacillus, showed that strain 32a has the highest similarity with B. subtilis 6633 (GQ911555.1), but it formed a clade with B. amyloliquefaciens FZB42 (NR075005.1) with high bootstrap value (data not shown).
To accurately characterize this strain taxonomically, we further performed RFLP analysis of the rRNA operons using RsaI restriction endonuclease (Promega). In fact, this enzyme allows discrimination between B. subtilis and B. amyloliquefaciens (Jeyaram et al. 2011) due to the presence of an additional RsaI site on the 16S rRNA of B. subtilis. The strains of B. subtilis V26 (Kilani-Feki et al. 2012) and B. amyloliquefaciens AG1 (Dihazi et al. 2012) were used as controls. The comparison of the digested profile confirmed that strain 32a belonged to the B. amyloliquefaciens species (Figure 1).
LC-MS determination of lipopeptides pattern produced by B. amyloliquefaciens strain 32a in vitro In order to characterize the lipopeptides pattern of the B. amyloliquefaciens strain 32a cultivated under laboratory conditions, the fraction from acid precipitation of cell-free culture was analyzed using specific LC-MS methods. As shown in table 2, the strain efficiently secretes various forms of surfactins, iturins and fengycins. Within each group, a set of mass peaks with an intervals of 14 were often observed with different numbers of methylene groups (–CH2–) in fatty acyl chains (Sun et al. 2006). The surfactin-specific program revealed the presence of five known surfactins with an acyl chain from, C12 to C16 and the amino acid leucine at the seventh position of the peptide ring. Among these isoforms, C13 was the most abundant homologue and C16 was the least. Using the iturin-specific program, three members of iturin A having fatty acyl chain lengths from C14 to C16 were found. By
This article is protected by copyright. All rights reserved.
Accepted Article
contrast, no peaks corresponding to the masses of the various bacillomycin D homologues could be detected under these conditions. The fengycin-specific program revealed the presence of four fengycins A and three fengycins B. Fengycins A consist of the saturated C14 to C17 homologues. Fengycins B comprise C15 to C17 homologues with a saturated acyl chain.
PCR detection of nonribosomal lipopeptide synthetases To determine whether the B. amyloliquefaciens strain 32a has the potential to produce different types of antimicrobial lipopeptides, the PCR method for detection of biosynthetic genes using appropriate primers was employed (Table 1). In most cases, primer pairs were specific for genes involved in biosynthesis of an individual antibiotic. However, the ITUDF1/R1 primer pair was used to simultaneously screen for bamD, ituD and fenF, which are conserved genes that encode for malonyl-CoA transacylases involved in biosynthesis of the lipopeptides bacillomycin D, iturin, and mycosubtilin, respectively (Stein 2005). Amplicons of the expected sizes were obtained with all genetic markers used in this study (data not shown). Their DNA sequences confirmed the identity of these genes. Analysis of 629 bp sequence from PCR reaction with the SFP-F1/R1 primer pair showed 99% identity with the surfactin biosynthesis gene cluster. Analysis of 468 bp from partial sequence of the 482 bp PCR product from reactions with the ITUD-F1/R1 primer pair showed 99% identity with the iturin biosynthesis gene cluster. Analysis of 591 and 371 bp of DNA sequence from 594 and 371 bp PCR products from reactions with the ITUC-F1/R1 and BMYB-F/R primer pairs, respectively, showed 99% identity to ituC and 98% identity to bmyB. Finally, analysis of 271 bp from partial sequence of the 269 bp PCR product using the FEND-F/R primer pair showed 99% identity with of the fenD, a gene involved in the biosynthesis of FenD1 and FenD2 modules of fengycin synthetase.
This article is protected by copyright. All rights reserved.
Accepted Article
Effect of B. amyloliquefaciens 32a lipopeptides on phytopathogenic bacteria and fungi The filter paper disc method was used to determine the impact of lipopeptides produced in OM broth on bacterial and fungal inhibition. Lipopeptides-enriched extract exhibited interesting antibacterial and antifungal activities against all strains tested. In general, an increase in inhibition was observed when a higher concentration of lipopeptides was used (Figure 2), displaying among bacterial phytopathogens, A. tumefaciens strains as the most sensitive.
Biochemical characterization of antagonistic supernatant The antibacterial activity of cell-free filtrate was subjected to different stability treatments in order to gain insight into the chemical nature of the responsible compounds against the Agrobacterium strains (Table 3). The antibacterial activity of the supernatant showed a clear resistance to high temperatures (50 to 100ºC) and degradation by proteinase K. Compared with untreated control, the treatment with extremely acidic pH (pH 2) leads to a large precipitation with a complete loss of the antibacterial activity in the soluble phase. Furthermore, antibacterial activity was efficiently extracted with n-butanol, suggesting the presence of an hydrophobic moiety in the responsible compounds. The ultrafiltration test using a 5-kDa molecular weight cut-off filter showed that the antibacterial activity was fully retained in the retentate. Taken together, these findings suggested that lipopeptides could be responsible for the antibacterial activity exhibited by the B. amyloliquefaciens strain 32a against the Agrobacterium strains.
This article is protected by copyright. All rights reserved.
Accepted Article
Relationship between cell growth, antibacterial activity and biosurfactant activity The dynamics of lipopeptides production and cells growth were monitored during the aerobic growth in OM broth. At different time intervals, samples were taken, and lipopeptides were precipitated and tested for their activity against A. tumefaciens strains. Changes in cell or spore numbers were recorded, as well as the size of zones of inhibition on indicator strains (Figure 3). The strain grew relatively quickly. It reached stationary phase after only 12 h of growth, and it was almost no lag phase. Appearance of first spores was detected after 10 h of incubation and their number increased exponentially until the 38th hour, reaching then a plateau. As shown in Figure 4, the antibacterial activity against both indicator strains started at the beginning of exponential growth phase (after 6 h), regardless of appearance of spores. Maximum of activity was slowly reached at the beginning of stationary growth phase (after 17 h of incubation). The strongest antibacterial inhibition was observed at 24 h of incubation and was maintained at that level until the end of the experiment.
Effect of the lipopeptides-enriched extract on Agrobacterium cells growth The effects of lipopeptides under investigation on the growth of A. tumefaciens C58 and B6 are shown in Figure 4. The addition of the lipopeptides-enriched extract to cell suspensions of each pathogen at the exponential growth phase leads to a divergence in viable cell counts when compared to the controls. The inhibition of A. tumefaciens C58 growth was immediate (from 5× 108 CFU ml-1 to less than 10 CFU ml-1) and resulted in a decrease in optical density during the incubation, suggesting that cell lysis occurred. Concerning A. tumefaciens B6, a slow but strong decrease in the number of viable cells (from 5× 108 CFU ml-1 to 102 CFU ml-1) was observed over a period of 6 h. The optical density of lipopeptidestreated A. tumefaciens B6 suspension remained nearly constant during this period, but decreased after several hours of incubation (data not shown). These findings demonstrate that
This article is protected by copyright. All rights reserved.
Accepted Article
the lipopeptides fraction clearly exhibits a bactericidal and bacteriolytic effect against both A. tumefaciens C58 and B6.
Biological control assays To confirm the contribution of the strain 32a in the biocontrol of A. tumefaciens strains, the carrot disc bioassay was used. Prior to this bioassay, the numbers of Agrobacterium cells able to induce 90% of galls to the inoculated discs were determined for both A. tumefaciens C58 and B6 (data not shown). These were 1 × 106 and 6 × 105 CFU, respectively. At these doses, young galls developing from the meristematic tissue around the central vascular system could be observed on the discs inoculated with these bacterial pathogens. Once the suitable bacterial doses were established, the antitumor activity was tested using both spore suspension (tested at the same concentration as the bacterial pathogen) and lipopeptide-enriched extract (200 AU ml-1) (Figure 5). As previously observed in the in vitro assays, both the 32a spores and the extract significantly reduced the disease severities (53.2 to 75.3% of disease reduction) compared with the untreated controls. In all cases, disease symptoms, obtained after treatment with the strain 32a, were significantly lower than those observed for untreated controls and statistically comparable with those of the reference antagonistic strain A. rhizogenes K1026.
Discussion Closely related species of B. subtilis group are of great agriculture importance, mostly exploited as biopesticides (Fravel 2005). More than one identification method have been frequently used to distinguish between B. subtilis and B. amyloliquefaciens (Thorsen et al. 2011). Phenotypic grouping of these closely related species based on morphology, physiology, fatty acid composition and carbohydrate fermentation is often misleading (Logan
This article is protected by copyright. All rights reserved.
Accepted Article
and Berkeley 1984; Wunschel et al. 1995). Therefore, genotypic identification using RFLP analysis of rRNA operons was used (Jeyaram et al. 2011). The digested profile clearly demonstrates that strain 32a could be assigned to B. amyloliquefaciens.
The genome of plant-associated B. amyloliquefaciens has been reported to harbor an array of giant gene clusters involved in the synthesis of antimicrobial material (Chen et al. 2009; Porwal et al. 2009). The vast majority of these antibiotics are non-ribosomally synthesized peptide derivatives, mainly cyclic lipopeptides. The antimicrobial activity of these lipopeptides has been generally described against fungi, with only a few reports addressing their effects on bacteria (Sharga and Lyon 1998; Wulff et al. 2002; Bais et al. 2004; Massomo et al. 2004; Etchegaray et al. 2008; Zeriouh et al. 2011). Therefore, the aim of this study was to characterize in depth the potential of a novel B. amyloliquefaciens strain, named 32a, to produce lipopeptides and to evaluate their ability to suppress crown gall caused by pathogenic strains of A. tumefaciens. The inhibition assays performed in vitro against different bacteria and fungi pathogens of plants proved the wide range antagonistic capacity of B. amyloliquefaciens strain 32a through the release of protease-resistant and thermo-stable compounds into the culture medium. The use of genetic markers such as lipopeptide synthetase genes, associated with biological control activities, has been proposed as a tool for the identification of novel biocontrol agents from environmental samples (Joshi and McSpadden Gardener 2006; Athukorala et al. 2009; Tapi et al. 2010). In our study, the presence of non ribosomal peptide synthetase genes involved in the synthesis of cyclic lipopeptides was detected in B. amyloliquefaciens strain 32a by PCR-based assays. Further analysis of culture broth extract by HPLC coupled to mass spectrometry revealed that strain 32a produces a wide variety of lipopeptides. According to the mass spectra, isoforms of surfactins (C12 to C16) as well as iturins A (C14 to C16) were co-produced by strain 32a. As
This article is protected by copyright. All rights reserved.
Accepted Article
fengycins A (C16 and C17) and B (C16) are also synthesized, 32a could be added to the limited number of B. amyloliquefaciens strains reported to co-produce the three families of lipopeptides (Koumoutsi et al. 2004; Arguelles-Arias et al. 2009).
In our study, it was possible to associate the presence of lipopeptides in the culture supernatant of B. amyloliquefaciens strain 32a with their biosynthetic genes. However, although that the peptide synthetase gene involved in the production of bacillomycin was detected by PCR, the latter was not found in the culture supernatant of strain 32a. It has been reported that the presence of a particular gene is not necessarily associated with its involvement in the biocontrol capacity (Joshi and McSpadden Gardener 2006). In fact, their expression depends on many factors, such as growth conditions, the presence of target microorganisms or the possibility of mutations in biosynthetic genes which can cause their inactivation. Antibacterial activity was detected at the transition between exponential and stationary phase of growth, increasing progressively during the latter and reaching the highest activity level after 2 days of growth, when bacterial populations are composed mainly by spores. It has been reported that the production of lipopeptides with antibacterial activity, such as surfactin, is advanced (transition between exponential and stationary growth) as compared with iturin or fengycin (late stationary-phase growth) (Stein 2005). Surfactin and iturin molecules exhibit antibacterial properties in vitro and could be involved in biocontrol functions in the rhizosphere. In fact, Bais et al (2004) showed that surfactin produced by B. subtilis 6051 is necessary for the reduction of the infection caused by Pseudomonas syringae on Arabidopsis plants. Furthermore, a contribution of closely related iturin A and bacillomycin was recently shown in the antagonism of B. subtilis toward bacterial diseases of cucurbits (Zeriouh et al. 2011).
This article is protected by copyright. All rights reserved.
Accepted Article
In this study, a possible role of lipopeptides in the biocontrol activity of the strain 32a against A. tumefaciens was demonstrated. In fact, treatment with the lipopeptide-enriched extract of 32a culture supernatant reduced dramatically the disease incidence, as revealed by significantly lower percentages of galled carrot discs compared to those of the control discs inoculated only with the bacterial pathogens. Treatment with 32a spores also provided a strong protective effect that was similar to that observed with the extract. The protective effect displayed by the lipopeptide-enriched extract could be explained by the highly stable and bacteriolytic anti-Agrobacterium metabolites in the extract, whereas the protective effect displayed by the B. amyloliquefaciens 32a spores suggests that 32a can efficiently proliferate and produce the same quantity or quality of metabolites on the surface and/or inner tissues of the carrot discs as it could in vitro.
As a bacterial disease, crown gall is very difficult to control using classical methods due to the lack of effective chemical treatments. Like other pathogenic microorganisms, virulent Agrobacterium strains have found ways to circumvent, or even manipulate the plants defence system for their own benefit (Pacurar et al. 2011). Several promising disease control strategies have been adopted. The best documented biological control agent targeted for the management of crown gall disease are avirulent Agrobacterium strains. Only few attempts were made to explore the antagonism of Bacillus strains towards pathogenic Agrobacterium strains (Rhouma et al. 2008; Hammami et al. 2009). The effectiveness of these treatments relies on the Agrobacterium growth-inhibiting effect of the chemical compounds released by the antagonist. In all these studies, the antibacterial compounds were identified as bacteriocins (Rhouma et al. 2008; Hammami et al. 2009). To our knowledge, this is the first report of antibiosis through lipopeptides producing B. amyloliquefaciens strain for the biocontrol of crown gall disease.
This article is protected by copyright. All rights reserved.
Accepted Article
B. amyloliquefaciens strain 32a identified in our study, with it’s broad range antagonistic activities, might be considered as a potential source of new bioactive metabolites as well as promising candidate to develop new biocontrol agents for controlling crown gall disease. Further research is needed to verify the production of lipopeptides by B. amyloliquefaciens during interaction with the plant and to identify the lipopeptide contributing to the biocontrol activity of 32a. Acknowledgements This work was supported by grants from the Tunisian Ministry of Higher Education, Scientific Research and Technology. We are grateful to Ms. Lobna Jlail for HPLC analysis. Conflict of interest No conflict of interest declared. References Arguelles-Arias, A., Ongena, M., Halimi, B., Lara, Y., Brans, A., Joris, B. and Fickers, P. (2009) Bacillus amyloliquefaciens GA1 as a source of potent antibiotics and other secondary metabolites for biocontrol of plant pathogens. Microb Cell Fact 63, 1-12. Athukorala, S.N., Fernando, W.G. and Rashid, K.Y. (2009) Identification of antifungal antibiotics of Bacillus species isolated from different microhabitats using polymerase chain reaction and MALDI-TOF mass spectrometry. Can J Microbiol 55, 1021-1032. Bais, H.P., Fall, R. and Vivanco, J.M. (2004) Biocontrol of Bacillus subtilis against infection of Arabidopsis roots by Pseudomonas syringae is facilitated by biofilm formation and surfactin production. Plant Physiol 134, 307-319. Broggini, G.A.L., Duffy, B., Holliger, E., Schärer, H.J., Gessler, C. and Patocchi, A. (2005) Detection of the fire blight biocontrol agent Bacillus subtilis BD170 (Biopro®) in a Swiss apple orchard. Eur J Plant Pathol 111, 93-100. Chen, X.H., Koumoutsi, A., Scholz, R., Schneider, K., Vater, J., Süssmuth, R., Piel, J. and
This article is protected by copyright. All rights reserved.
Accepted Article
Borrissa, R. (2009) Genome analysis of Bacillus amyloliquefaciens FZB42 reveals its potential for biocontrol of plant pathogens. J Biotechnol 140, 27-37. Chung, S., Kong, H., Buyer, J.S., Lakshman D.K., Lydon, J., Kim, S.D. and Roberts, D.P. (2008) Isolation and partial characterization of Bacillus subtilis ME488 for suppression of soil borne pathogens of cucumber and pepper. Appl Microbiol Biotechnol 80, 115-123. Dihazi, A., Jaiti, F., Taktak, W., Kilani-Feki, O., Jaoua, S., Driouich, A., Baaziz, M., Daayf, F. and Serghini, M.A. (2012) Use of two bacteria for biological control of bayoud disease caused by Fusarium oxysporum in date palm (Phoenix dactylifera L) seedlings. Plant Physiol Biochem 55, 7-15. Escobar, M.A. and Dandekar, A.M. (2003) Agrobacterium tumefaciens as an agent of disease. Trends in plant sci 8, 380-386. Etchegaray, A., de Castro Bueno, C., de Melo, I.S., Tsai, S.M., de Fátima Fiore, M.F., Silva-Stenico, M.E., de Moraes. L.A.B. and Teschke, O. (2008) Effect of a highly concentrated lipopeptide extract of Bacillus subtilis on fungal and bacterial cells. Arch Microbiol 190, 611-622. Felsenstein, J. (2004) PHYLIP (Phylogeny Inference Package) version3.6. Distributed by the author Department of Genome Sciences, University of Washington, Seattle. Fravel, D.R. (2005) Commercialization and implementation of biocontrol. Annu Rev Phytopathol 43, 337-359. Gurtler, V. and Stanisich, V.A. (1996) New approches to typing and identification of bacteria using the 16S-23S rDNA spacer region. Microbiology 142, 3-16. Hagelin, G., Indrevoll, B. and Hoeg-Jensen, T. (2007) Use of synthetic analogues in confirmation of structure of the peptide antibiotics maltacines. Int J Mass Spectrom 268, 254264. Hammami, I., Rhouma, A., Jaouadi, B., Rebai, A. and Nesme, X. (2009) Optimization and
This article is protected by copyright. All rights reserved.
Accepted Article
biochemical characterization of a bacteriocin from a newly isolated Bacillus subtilis strain 14B for biocontrol of Agrobacterium spp. strains. Lett Appl Microbiol 48, 253-260. Holt, J.G., Krieg, R.N., Sneath, P.H.A., Staley, J.T. and William, S.T. (1994) Bergey's manual of determinative bacteriology (9th ed.). Philadelphia: Lippincott William & Wilkins. Jeyaram, K., Romi, W., Singh, T.A., Adewumi, G.A., Basanti, K. and Oguntoyinbo, F.A. (2011) Distinct differentiation of closely related species of Bacillus subtilis group with industrial importance. J Microbiol Methods 87, 161-164. Joshi, R. and McSpadden Gardener, B.B. (2006) Identification and characterization of novel genetic markers associated with biological control activities in Bacillus subtilis. Phytopathology 96, 145-154. Kilani-Feki, O., Frikha, F., Zouari, I. and Jaoua, S. (2013) Heterologous expression and secretion of an antifungal Bacillus subtilis chitosanase (CSNV26) in Escherichia coli. Biopro biosys eng 36, 985-992. Koumoutsi, A., Chen, X.H., Henne, A., Liesegang, H., Hitzeroth, G., Franke, P., Vater, J. and Borriss, R. (2004) Structural and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic lipopeptides in Bacillus amyloliquefaciens strain FZB42. J Bacteriol 186, 1084-1096. Lee, S.C., Kim, S.H., Park, I.H., Chung, S.Y. and Choi, Y.L. (2007) Isolation and structural analysis of bamylocin A, novel lipopeptide from Bacillus amyloliquefaciens LP03 having antagonistic and crude oil-emulsifying activity. Arch Microbiol 188, 307-312. Logan, N.A. and Berkeley, R.C.W. (1984) Identification of Bacillus strains using the API system. J Gen Microbiol 130, 1871-1882. Mahesh, B. and Satish, S. (2008) Antimicrobial activity of some important medicinal plant against plant and human pathogens. World J AgricSci 4, 839-843. Malfanova, N., Franzil, L., Lugtenberg, B., Chebotar, V. and Ongena, M. (2012) Cyclic
This article is protected by copyright. All rights reserved.
Accepted Article
lipopeptide profile of the plant-beneficial endophytic bacterium Bacillus subtilis HC8. Arch microbial 194, 893-899. Massomo, S.M.S., Mortensen, C.N., Mabagala, R.B., Newman, M.A. and Hockenhull, J. (2004) Biological control of black rot (Xanthomonas campestris pv. campestris) of cabbage in Tanzania with Bacillus strains. J Phytopathol 152, 98-105. Mezghanni, H., Khedher, S.B., Tounsi, S. and Zouari, N. (2012) Medium optimization of antifungal activity production by Bacillus amyloliquefaciens using statistical experimental design. Prep Biochem Biotechnol 42, 267-278. Mora, I., Cabrefiga, J. and Montesinos, E. (2012) Antimicrobial peptide genes in Bacillus strains from plant environments. Int Microbiol 14, 213-223. Motta, A.S. and Brandelli, A. (2002) Characterisation of an antimicrobial peptide produced by Brevibacterium linens. J Appl Microbiol 92, 63-70. Ongena, M. and Jacques, P. (2008) Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends Microbiol 16, 115-125. Pacurar, D.I., Thordal-Christensen, H., Pacurar, M.L., Pamfil, D., Botez, C. and Bellini, C. (2011).
Agrobacterium
tumefaciens:
from
crown
gall
tumors
to
genetic
transformation. Physiol Mol Plant Pathol 76, 76-81. Pérez-Garcia, A., Romero, D. and de Vicente, A. (2011) Plant protection and growth stimulation by microorganisms: biotechnological applications of Bacilli in agriculture. Curr Opin Biotechnol 22, 187-193. Peypoux, F., Bonmatin, J.M. and Wallach, J. (1999) Recent trends in the biochemistry of surfactin. Appl Microbiol Biotechnol 51, 553-563. Porwal, S., Lal, S., Cheema, S. and Kalia, V.C. (2009) Phylogeny in aid of the present and novel microbial lineages: diversity in Bacillus. PLoS One 4(2):e4438. Rhouma, A., Borui, M., Boubaker, A. and Nesme, X. (2008) Potential effect of
This article is protected by copyright. All rights reserved.
Accepted Article
rhizobacteria in the management of crown gall disease caused by Agrobacterium tumefaciens biovar 1. J Plant Pathol 90, 517-526. Rhouma, A., Boubaker, A., Bseis, N. and Hafsa, M. (2001) Caractérisation et lutte biologique par K84 des isolats d’Agrobacterium tumefaciens agent causal de la galle du collet des rosacées fruitières en Tunisie. Revue de l’Institut National Agronomique de Tunisie 2, 716. Romero, D., de Vicente, A., Rakotoalay, R.H., Dufour, S.E., Veening, J.W., Arrebola, A., Cazorla, F.M., Kuipers, O.P., Paquot, M. and Pérez-Garcia, A. (2007) The iturin and fengycin families of lipopeptides are key factors in antagonism of Bacillus subtilis toward Podosphaerafusca. Mol Plant-Microbe Interact 20, 430-440. Sambrook, J. and Russell, D.W. (2001) Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor New York. Sharga, B.M. and Lyon, G.D. (1998) Bacillus subtilis BS 107 as an antagonistic of potato blackleg and soft rot bacteria. Can J Microbiol 44, 777-783. Stein, T. (2005) Bacillus subtilis antibiotics: structure, syntheses and specific functions. Mol Microbiol 56, 845-857. Sun, L., Lu, Z., Bie, X., Lu, F. and Yang, S. (2006) Isolation and characterization of a coproducer of fengycins and surfactins, endophytic Bacillus amyloliquefaciens ES-2, from Scutellaria baicalensis Georgi. World J Microbiol Biotechnol 22, 1259-1266. Tagg, J.R. and McGiven, A.R. (1971) Assay system for bacteriocins. Appl Microbiol 21, 943. Tapi, A., Chollet-Imbert, M., Scherens, B. and Jacques, P. (2010) New approach for the detection of non-ribosomal peptide synthetase genes in Bacillus strains by polymerase chain reaction. Appl Microbiol Biotechnol 85, 1521-1531. Tendulkar, S.R., Saikumari, Y.K., Patel, V., Raghotama, S., Munshi, T.K., Balaram, P.
This article is protected by copyright. All rights reserved.
Accepted Article
and Chattoo, B.B. (2007) Isolation, purification and characterization of an antifungal molecule produced by Bacillus licheniformis BC98, and its effect on phytopathogen Magnaporthe grisea. J Appl Microbiol 103, 2331-2339. Thimon, L., Peypoux, F., Wallach, J. and Michel, G. (1995) Effect of the lipopeptide antibiotic, iturin A, on morphology and membrane ultrastructure of yeast cells. Microbiol Lett 128, 101-106. Thorsen, L., Abdelgadir, W.S., Rønsbo, M.H., Abban, S., Hamad, S.H., Nielsen, D.S. and Jakobsen, M. (2011) Identification and safety evaluation of Bacillus species occurring in high numbers during spontaneous fermentations to produce Gergoush, a traditional Sudanese bread snack. Int J Food Microbiol 146, 244-252. Vanittanakom, N., Loeffler, W., Koch, U., Jung, G. (1986) Fengycin a novel antifungal lipopeptide antibiotic produced by Bacillus subtilis F-29-3. J Antibiot 39, 888-901. Wulff, E.G., Mguni, C.M., Mansfeld-Giese, K., Fels, J., Lübeck, M. and Hockenhull, J. (2002) Biochemical and molecular characterization of Bacillus amyloliquefaciens, B. subtilis and B. pumilus isolates with distinct antagonistic potential against Xanthomonas campestris pv. campestris. Plant Pathol 51, 574-584. Wunschel, D., Fox, K.F., Black, G.E. and Fox, A. (1995) Discrimination among the B. cereus group, in comparison to B. subtilis, by structural carbohydrate profiles and ribosomal RNA spacer region PCR. Syst Appl Microbiol 17, 625-635. Yangui, T., Rhouma, A., Gargouri, K., Triki, M.A. and Bouzid, J. (2008) Efficacy of olive mill waste water and its derivatives in the suppression of crown gall disease of bitter almond. Eur J Plant Pathol 122, 495-504. Zeriouh, H., Romero, D., Garcia-Gutierrez, L., Cazorla, F.M., de Vicente, A. and PerezGarcia, A. (2011) The iturin-like lipopeptides are essential components in the biological control arsenal of Bacillus subtilis against bacterial diseases of cucurbits. Mol Plant Microbe
This article is protected by copyright. All rights reserved.
Accepted Article
Interact 24, 1540-1552. Zhang, T., Shi, Q.Z., Hu, L.B., Cheng, L.G. and Wang, F. (2008) Antifungal compounds from Bacillus subtilis B-FS06 inhibiting the growth of Aspergillus flavus. World J Microbiol Biotechnol 24, 783-788. Zouba, A. and Hammami, K. (1988) La galle du collet des arbres fruitiers: biotypes et essais de lutte biologique. Revue de l’Institut National Agronomique de Tunisie 1,141-150.
Tables Table 1 Primers for PCR detection of lipopeptides biosynthesis genes in B. amyloliquefaciens 32a. Gene(s)
Primers
Sequences
PCR product
Reference
size (bp)
Bacillomycin
bam D
ITUD-F1
5’-TTGAAYGTCAGYGCSCCTTT
ITUD-R1
5’-TGCGMAAATAATGGSGTCGT
482
(Chung et al. 2008) bmyB
Fengycin
fenD
BMYB-F
5’-GAATCCCGTTGTTCTCCAAA
BMYB-R
5’-GCGGGTATTGAATGCTTGTT
FEND-F
5’-GGCCCGTTCTCTAAATCCAT
FEND-R
5’-GTCATGCTGACGAGAGCAAA
ITUD-F1
5’-TTGAAYGTCAGYGCSCCTTT
ITUD-R1
5’-TGCGMAAATAATGGSGTCGT
370
269 (Mora et al. 2012)
Iturin
ituD
482
(Chung et al. 2008) ituC
Surfactin
sfP
ITUC-F1
5’-CCCCCTCGGTCAAGTGAATA
ITUC-R1
5’- TTGGTTAAGCCCTGATGCTC
SFP-F1
5’-ATGAAGATTTACGGAATTTA
SFP-R1
5’-TTATAAAAGCTCTTCGTACG
594
675 (Chung et al. 2008)
This article is protected by copyright. All rights reserved.
Accepted Article
Table 2 Lipopeptides production by B. amyloliquefaciens 32a as detected by LC–MS.
Lipopeptide family
Molecular mass [M-H]-
Homologue
Surfactin
992.2
C-12
1006.0
C-13
1020.0
C-14
1033.9
C-15
1047.9
C-16
1040.9
C-14
1054.7
C-15
1068.8
C-16
1433.7
C-14
1446.6
C-15
1460.9
C-16
1474.8
C-17
1474.8
C-15
1489.8
C-16
1502.8
C-17
Iturin A/ Mycosubtilin
Fengycin A
Fengycin B
This article is protected by copyright. All rights reserved.
Accepted Article
Table 3 Biochemical characterization of the antibacterial activity of B. amyloliquefaciens 32a supernatant.
Culture filtrate
Antibacterial activity (%) A. tumefaciens C58
A. tumefaciens B6
Untreated
100 ± 0.0
100 ± 0.0
50ºC, 15 min
100 ± 0.0
100 ± 0.0
75°C, 15 min
100 ± 0.0
100 ± 0.0
100°C, 15 min
100 ± 0.0
100 ± 0.0
Untreated
100 ± 0.0
100 ± 0.0
Acid, pH = 2
100 ± 0.0
100 ± 0.0
Basic, pH = 12
68.8 ± 0.3
67.4 ± 0.8
Untreated
100 ± 0.0
100 ± 0.0
Proteinase K
100 ± 0.0
100 ± 0.0
Catalase
100 ± 0.0
100 ± 0.0
Untreated
100 ± 0.0
100 ± 0.0
n-Butanol
100 ± 0.0
100 ± 0.0
Methanol
100 ± 0.0
100 ± 0.0
Untreated
100 ± 0.0
100 ± 0.0
>5-kDa fraction
96.8 ± 0.2
96.5 ± 0.5
Article Type: Original Article
Bacillus amyloliquefaciens strain 32a as a source of lipopeptides for biocontrol of Agrobacterium tumefaciens strains
Running title: Lipopeptides for control of crown gall disease
D. Ben Abdallah, O. Frikha-Gargouri and S. Tounsi Biopesticides Team (LPAP), Centre of Biotechnology of Sfax, University of Sfax, P.O. Box “1177” 3018, Sfax, Tunisia
Corresponding author *Corresponding author: Slim Tounsi, Biopesticides Team [L.P.I.P.], Center of Biotechnology of Sfax, University of Sfax, P.O. Box 1177, 3018 Sfax, Tunisia Tel. /Fax: +216 (74) 872091 E-mail address: [email protected]
Abstract Aims: A Bacillus amyloliquefaciens strain, designated 32a, was used to identify new compounds active against Agrobacterium tumefaciens and to evaluate their efficiency to control crown gall on carrot discs. Methods and Results: Based on PCR-assays, four gene clusters were shown to direct the synthesis of the cyclic lipopeptides surfactin, iturin A, bacillomycin D and fengycin. Mass spectrometry analysis of culture supernatant led to the identification of these secondary This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an 'Accepted Article', doi: 10.1111/jam.12797 This article is protected by copyright. All rights reserved.
Accepted Article
metabolites, except bacillomycin, with heterogeneous mixture of homologues. Antimicrobial assays using lipopeptides-enriched extract showed a strong inhibitory activity against several bacterial and fungal strains, including A. tumefaciens. Biological control assays on carrot discs using both 32a spores and extract resulted in significant protection against crown gall disease, similar to that provided by the reference antagonistic strain Agrobacterium rhizogenes K1026. Conclusions: In contrast to all active compounds against A. tumefaciens that are of proteinaceous nature, this work enables for the first time to correlate the strong protective effect of B. amyloliquefaciens strain 32a towards crown gall disease with the production of a mixture of lipopeptides. Significance and Impact of the Study: The findings could be useful for growers and nursery men who are particularly interested in the biocontrol of the crown gall disease.
Keywords: Bacillus amyloliquefaciens, lipopeptides, biological control, Agrobacterium tumefaciens, crown gall disease.
Introduction Agrobacterium tumefaciens is a soil-borne Gram-negative bacterium. It causes crown gall tumors on a wide range of plants, including economically important fruit and nut crops, grapes, ornamental and landscape plants. Losses in production yields associated with this disease have often been reported in temperate areas, and especially in Mediterranean countries. The disease has been described as a form of ‘genetic colonization’ in which the transfer and expression of a suite of Agrobacterium genes in a plant cell causes uncontrolled cell proliferation and the synthesis of nutritive compounds that can be metabolized specifically by the infecting bacteria (Escobar and Dandekar 2003). In Tunisia, crown gall is
This article is protected by copyright. All rights reserved.
Accepted Article
currently a major handicap for the production of plants, in particular stone fruit trees (Zouba and Hammami 1988, Rhouma et al. 2001, Yangui et al. 2008). To limit its spread, the Tunisian Ministry of Agriculture authorizes trade of nursery productions only if they bear less than 1% visible galls (Rhouma et al. 2008). A strict sanitary control of imported propagating material for the presence of crown gall has been enforced in the country. In spite of the preventive measures, that are being taken, crown gall continues to cause important damage in nurseries and in the field. Although the biocontrol agents of Agrobacterium rhizogenes strains K84 and K1026 are commercially available for the control of A. tumefaciens, new strains are required. This is partly because of the facts that K84 can transfer resistance of genes that control agrocine K84 (pAgK84) production to the crown gall pathogens and that it’s genetically modified derivative K1026 is not registered for use in Tunisia as well as in other countries for its genetically modified status. Thus, there is a need for the screening of new micro-organisms that can be used to control the crown gall disease. Pertinent to this gap in research is the fact that Bacillus species have often been reported to be among the most beneficial bacteria that can be exploited as biopesticides in plant health care (Pérez-Garcia et al. 2011). The features contributing to their success are the production of a vast array of biologically active molecules potentially inhibitory of phytopathogen growth and the formation of spores that ensures permanence in diverse habitats under hostile environmental conditions and also ease of the formulation of feasible long-term commercial products (Broggini et al. 2005).
Lipopeptides probably represent the most common class of compounds produced by Bacillus spp. (Zeriouh et al. 2011). These amphiphilic compounds share a common structure consisting of a lipid tail linked to a short cyclic oligopeptide. Bacillus lipopeptides are synthesized non-ribosomally via large multi-enzymes. These biosynthetic systems lead to a
This article is protected by copyright. All rights reserved.
Accepted Article
fengycins A (C16 and C17) and B (C16) are also synthesized, 32a could be added to the limited number of B. amyloliquefaciens strains reported to co-produce the three families of lipopeptides (Koumoutsi et al. 2004; Arguelles-Arias et al. 2009).
In our study, it was possible to associate the presence of lipopeptides in the culture supernatant of B. amyloliquefaciens strain 32a with their biosynthetic genes. However, although that the peptide synthetase gene involved in the production of bacillomycin was detected by PCR, the latter was not found in the culture supernatant of strain 32a. It has been reported that the presence of a particular gene is not necessarily associated with its involvement in the biocontrol capacity (Joshi and McSpadden Gardener 2006). In fact, their expression depends on many factors, such as growth conditions, the presence of target microorganisms or the possibility of mutations in biosynthetic genes which can cause their inactivation. Antibacterial activity was detected at the transition between exponential and stationary phase of growth, increasing progressively during the latter and reaching the highest activity level after 2 days of growth, when bacterial populations are composed mainly by spores. It has been reported that the production of lipopeptides with antibacterial activity, such as surfactin, is advanced (transition between exponential and stationary growth) as compared with iturin or fengycin (late stationary-phase growth) (Stein 2005). Surfactin and iturin molecules exhibit antibacterial properties in vitro and could be involved in biocontrol functions in the rhizosphere. In fact, Bais et al (2004) showed that surfactin produced by B. subtilis 6051 is necessary for the reduction of the infection caused by Pseudomonas syringae on Arabidopsis plants. Furthermore, a contribution of closely related iturin A and bacillomycin was recently shown in the antagonism of B. subtilis toward bacterial diseases of cucurbits (Zeriouh et al. 2011).
This article is protected by copyright. All rights reserved.
Accepted Article
lipopeptides produced by a newly-isolated local strain of B. amyloliquefaciens named 32a, to characterize the antibacterial activity of these compounds in in vitro bioassays and to evaluate their biocontrol capacity in vivo against two strains of A. tumefaciens (C58 and B6) recognized as the major causal agents of crown gall disease.
Materials and methods Antagonistic bacteria The strain 32a used in the present study was originally isolated from a Tunisian soil sample. It was selected among hundreds of other isolates available at our local laboratory collection due to its broad spectrum of antagonist activity towards bacterial and fungal pathogens. Cells were grown at 30°C in an optimized medium (OM) for bioactive compounds production (Mezghanni et al. 2012) for 24 h with shaking at 200 rpm.
Pathogenic strains and culture conditions Four plant pathogenic bacteria were used in this study: strains C58 and B6 of Agrobacterium tumefaciens, Pseudomonas savastanoi and Erwinia amylovora. These strains were kindly provided by the Olive Institute of Sfax, Tunisia. The bacterial strains were maintained for long-term storage at -80°C using glycerol 15%. Fresh bacterial cultures were obtained from frozen stocks prior to experimentation and were cultured at 30°C on LuriaBertani (LB) agar.
Antifungal activity was determined against seven phytopathogenic fungi which are Alternaria alternata, Aspergillus niger, Fusarium culmorum, Fusarium graminearum, Fusarium oxysporum, Rhizopus nigricans and Botrytis cineria. The fungi were provided by the strain collection of the Centre of Biotechnology of Sfax, Tunisia. Stock culture of each
This article is protected by copyright. All rights reserved.
Accepted Article
pathogen was maintained on potato dextrose agar (PDA) at 4°C. Working culture was established by transferring a stock agar plug containing mycelium onto PDA in Petri plates and incubating for 7 days in the darkness at 25°C.
Taxonomical studies Strain 32a was tested for various phenotypic properties including morphology, physiology and biochemical characteristics, as described in the Bergey’s Manual of Systematic Bacteriology (Holt et al. 1994). The molecular approach was carried out by 16S rDNA sequencing. Amplification was carried out by PCR with the universal primers Fd1 (5’AGAGTTTGATCCTGGCTCAG-3’)
and
Rd1
(5’-AAGGAGGTGATCCAGCC-3’),
designed from the conserved zones within the rRNA operon of E. coli (Gurtler and Stanisich 1996). The genomic DNA of the strain 32a, extracted by standard protocols (Sambrook and Russell 2001), was used as a template for PCR amplification. Thermal cycler conditions consisted of an initial denaturation at 94°C for 2 min followed by 30 cycles; each one composed of denaturation at 94°C for 30s, annealing at 53°C for 1 min, and extension at 72°C for 2 min. The amplified ∼1.5 kbp product was purified from agarose gel followed by sequencing in an automatic sequencer (Avant Genetic analyzer, 3100 model). Homology search was performed using Blast algorithm. Accession number obtained from GenBank for deposited partial 16S rRNA nucleotide sequence was KP334099. Phylogenetic analyzes were performed using the PHYLIP package programs (Felsenstein 2004) and the phylogenetic tree was constructed by the neighbor-joining (NJ) algorithm using Kimura ten-parameter distance. The branching pattern was checked by 1,000 bootstrap replicates. To confirm identification, PCR amplification of 16S rRNA gene was followed by restriction fragment length polymorphism analysis (Jeyaram et al. 2011).
This article is protected by copyright. All rights reserved.
Accepted Article
Isolation and identification of lipopeptides using LC-MS analysis Lipopeptides isolation was performed by the acid precipitation according to Zhang et al. (2008). Briefly, the crude cell-free culture was adjusted to pH 2 with 6 mol l-1 HCl and was stored overnight at 4°C. After centrifugation, the precipitate was extracted twice with five times volume of methanol. The solution was dried with a rotary vacuum evaporator and the remaining dry residue was dissolved in 50 mmol l-1 Tris-HCl, pH 7.5 buffer and then filtered through 0.22 µm filter.
Putative lipopeptides were identified as described by Malfanova et al. (2012) using LC-MS analysis. Briefly, the crude methanolic extract, prepared as describe above, was analyzed by reverse-phase high-pressure liquid chromatography using an Agilent 1100 LC system. The chromatographic separation was performed using a Zorbax 300Å Extend-C-18 Column (4.6 × 250 mm). The column outlet was coupled to an Agilent MSD Ion Trap XCT mass spectrometer equipped with an ESI ion source. Surfactins were eluted in the isochratic mode (78% acetonitrile in water acidified with 0.1% formic acid). Iturins and fengycins were selectively desorbed by using acetonitrile gradients from 35% to 65% in 35 min and from 40% to 60% in 40 min, respectively. All elution programs used a flow rate of 0.5 ml/min at 214 nm and detection occurred using the negative ion mode at m/z ranging from 400 to 2000. The identity of each metabolite was obtained on the basis of the mass of molecular ions detected in the SQD by setting electrospray ionisation conditions in the MS.
PCR detection of lipopeptide biosynthesis genes Primers used in the PCR amplifications of lipopeptide biosynthesis genes are listed in Table 1. PCR amplifications were conducted in a 50 µl reaction mixture containing 10 μl of 5× PCR buffer, 4 μl of 25 mmol l-1 MgCl2, 5 μl of dNTP-mix (0.2 mmol l-1), 5 μl of each
This article is protected by copyright. All rights reserved.
Accepted Article
forward and reverse primer (10 mmol l-1), 2 U of Taq DNA polymerase (GoTaq), and 50 ng of template DNA. Thermal cycler conditions consisted of an initial denaturation step at 95°C for 5 min followed by 30 cycles of denaturation at 95°C for 1 min, 50 to 58°C primer annealing for 1 min and 72°C extension for 1.5 min followed by a final extension step at 72°C for 7 min. Amplified PCR product was purified from agarose gel and sequenced by an automatic sequencer (Avant Genetic analyzer, 3100 model). PCR sequences were identified using the basic local alignment search tool and GenBank nucleotide data bank from the National
Center
for
Biotechnology
Information,
Bethesda,
MD,
USA
(http://www.ncbi.nlm.nih. gov/). Accession numbers obtained from GenBank for deposited partial nucleotide sequences of bmyB ituC, ituD, sfP and fenD are KP453869, KP453870, KP453871, KP453872 and KP453873, respectively.
Antimicrobial activity determination Antimicrobial activities of the lipopeptides-enriched extract were detected by the disc diffusion assay according to Mahesh and Satish (2008). Cell suspensions of each indicator strain were prepared and 100 µl were inoculated onto the surface of agar plates. Filter paper discs (5 mm in diameter), impregnated with different concentrations of the extract, were placed on test organism-seeded plates. Blank disc impregnated with Tris-HCl (50 mmol l-1; pH 7.5) was used as negative control. The antimicrobial activity was evaluated by measuring inhibition zones against the tested microorganisms.
Biochemical characterization of antagonistic supernatant The antibacterial activity of cell-free filtrate was subjected to stability tests (resistance to extreme pH and thermal conditions, enzymatic degradation, solubility in organic solvents) and estimation of molecular size using a Centricon centrifugal filter device (5 kDa)
This article is protected by copyright. All rights reserved.
Accepted Article
(Millipore Corporation) (Romero et al. 2007). After the different treatments, antibacterial activity against A. tumefaciens strains was evaluated by the well diffusion method (Tagg and McGiven. 1971).
Antibacterial compounds production during growth of B. amyloliquefaciens To determine the relationship between growth and production of antibacterial compounds, the strain 32a was grown in 250 ml Erlenmeyer flasks containing 50 ml of OM. Incubation was carried out in an orbital shaker for three days at 30ºC and 200 rpm. Culture samples were taken at different times and were used to determinate the number of viable cells (colony forming units, CFU) as described previously by Motta and Brandelli (2002). The number of spores was determined after a heat treatment at 80°C for ten minutes. To test the antibacterial activity, precipitated lipopeptides were dissolved in 50 mmol l-1 Tris-HCl, pH 7.5 and tested as described above.
Effect of the lipopeptides-enriched extract on Agrobacterium cells growth In order to assess the mode of action of the lipopeptides-enriched extract, isolated lipopeptides; obtained by acid precipitation; at 200 AU ml-1 were applied on actively growing cells of each pathogen (5 × 108 (CFU ml-1)) and incubated at 30°C. The survival of the indicator strains was monitored (expressed as CFU ml-1) and the optical density (OD) was measured at 600 nm at different time intervals. The number of viable cells was counted after overnight incubation at 30°C in LB agar medium. Biocontrol tests A carrot discs bioassay was used to determine the ability of antagonist bacterium to suppress the incidence and severity of bacterial crown gall of A. tumefaciens. Carrot samples (Daucas carota L.) were sterilized with commercial bleach, rinsed twice with sterile distilled
This article is protected by copyright. All rights reserved.
Accepted Article
water, cut into equal slices and placed into Petri dishes. Four treatments were performed: 32a spores suspension, 32a lipopeptide-enriched extract, K1026 cells suspension and water. Cell suspensions of the bacterial pathogen and the biocontrol agents were inoculated at the same concentration on the carrot slices. Each treatment included thirty discs. Petri dish was sealed by parafilm and incubated in growth chamber (controlled environment; 28°C). After three weeks, the disks were checked for young galls developing from the meristematic tissue around the central vascular system.
Statistical analysis The data were subjected to analysis of variance using the Statistical Package for the Social Sciences (SPSS V.11; SPSS Inc., Chicago, IL, USA). The mean values among the treatments were compared using the Duncan’s multiple range test at the 5% level of significance (p = 0.05).
Results Identification of strain 32a Among several antimicrobial activity-producing bacteria isolated from soil, one antagonist strain called 32a was selected for its broad spectrum activity against various phytopathogenic bacteria and fungi. Classical taxonomic findings showed that the newly isolated bacterium 32a is Gram-positive, catalase-positive, oxydase-positive, aerobic, motile, rod shaped and spore forming bacterium. In a molecular approach, the genomic DNA of this strain was used as a template to amplify a 1450 bp PCR-fragment coding for the 16S rRNA. The DNA fragment was purified and sequenced. DNA similarity searches against bacterial databases revealed that the 16S rRNA sequence of 32a was more than 99% identical to both Bacillus subtilis (JQ308548.1) and B. amyloliquefaciens (HQ844503.1). Furthermore, the
This article is protected by copyright. All rights reserved.
Accepted Article
neighbor joining phylogenetic tree constructed with 16S rRNA gene sequences of other members of the genus Bacillus, Brevibacillus and Paenibacillus, showed that strain 32a has the highest similarity with B. subtilis 6633 (GQ911555.1), but it formed a clade with B. amyloliquefaciens FZB42 (NR075005.1) with high bootstrap value (data not shown).
To accurately characterize this strain taxonomically, we further performed RFLP analysis of the rRNA operons using RsaI restriction endonuclease (Promega). In fact, this enzyme allows discrimination between B. subtilis and B. amyloliquefaciens (Jeyaram et al. 2011) due to the presence of an additional RsaI site on the 16S rRNA of B. subtilis. The strains of B. subtilis V26 (Kilani-Feki et al. 2012) and B. amyloliquefaciens AG1 (Dihazi et al. 2012) were used as controls. The comparison of the digested profile confirmed that strain 32a belonged to the B. amyloliquefaciens species (Figure 1).
LC-MS determination of lipopeptides pattern produced by B. amyloliquefaciens strain 32a in vitro In order to characterize the lipopeptides pattern of the B. amyloliquefaciens strain 32a cultivated under laboratory conditions, the fraction from acid precipitation of cell-free culture was analyzed using specific LC-MS methods. As shown in table 2, the strain efficiently secretes various forms of surfactins, iturins and fengycins. Within each group, a set of mass peaks with an intervals of 14 were often observed with different numbers of methylene groups (–CH2–) in fatty acyl chains (Sun et al. 2006). The surfactin-specific program revealed the presence of five known surfactins with an acyl chain from, C12 to C16 and the amino acid leucine at the seventh position of the peptide ring. Among these isoforms, C13 was the most abundant homologue and C16 was the least. Using the iturin-specific program, three members of iturin A having fatty acyl chain lengths from C14 to C16 were found. By
This article is protected by copyright. All rights reserved.
Accepted Article
contrast, no peaks corresponding to the masses of the various bacillomycin D homologues could be detected under these conditions. The fengycin-specific program revealed the presence of four fengycins A and three fengycins B. Fengycins A consist of the saturated C14 to C17 homologues. Fengycins B comprise C15 to C17 homologues with a saturated acyl chain.
PCR detection of nonribosomal lipopeptide synthetases To determine whether the B. amyloliquefaciens strain 32a has the potential to produce different types of antimicrobial lipopeptides, the PCR method for detection of biosynthetic genes using appropriate primers was employed (Table 1). In most cases, primer pairs were specific for genes involved in biosynthesis of an individual antibiotic. However, the ITUDF1/R1 primer pair was used to simultaneously screen for bamD, ituD and fenF, which are conserved genes that encode for malonyl-CoA transacylases involved in biosynthesis of the lipopeptides bacillomycin D, iturin, and mycosubtilin, respectively (Stein 2005). Amplicons of the expected sizes were obtained with all genetic markers used in this study (data not shown). Their DNA sequences confirmed the identity of these genes. Analysis of 629 bp sequence from PCR reaction with the SFP-F1/R1 primer pair showed 99% identity with the surfactin biosynthesis gene cluster. Analysis of 468 bp from partial sequence of the 482 bp PCR product from reactions with the ITUD-F1/R1 primer pair showed 99% identity with the iturin biosynthesis gene cluster. Analysis of 591 and 371 bp of DNA sequence from 594 and 371 bp PCR products from reactions with the ITUC-F1/R1 and BMYB-F/R primer pairs, respectively, showed 99% identity to ituC and 98% identity to bmyB. Finally, analysis of 271 bp from partial sequence of the 269 bp PCR product using the FEND-F/R primer pair showed 99% identity with of the fenD, a gene involved in the biosynthesis of FenD1 and FenD2 modules of fengycin synthetase.
This article is protected by copyright. All rights reserved.
Accepted Article
Effect of B. amyloliquefaciens 32a lipopeptides on phytopathogenic bacteria and fungi The filter paper disc method was used to determine the impact of lipopeptides produced in OM broth on bacterial and fungal inhibition. Lipopeptides-enriched extract exhibited interesting antibacterial and antifungal activities against all strains tested. In general, an increase in inhibition was observed when a higher concentration of lipopeptides was used (Figure 2), displaying among bacterial phytopathogens, A. tumefaciens strains as the most sensitive.
Biochemical characterization of antagonistic supernatant The antibacterial activity of cell-free filtrate was subjected to different stability treatments in order to gain insight into the chemical nature of the responsible compounds against the Agrobacterium strains (Table 3). The antibacterial activity of the supernatant showed a clear resistance to high temperatures (50 to 100ºC) and degradation by proteinase K. Compared with untreated control, the treatment with extremely acidic pH (pH 2) leads to a large precipitation with a complete loss of the antibacterial activity in the soluble phase. Furthermore, antibacterial activity was efficiently extracted with n-butanol, suggesting the presence of an hydrophobic moiety in the responsible compounds. The ultrafiltration test using a 5-kDa molecular weight cut-off filter showed that the antibacterial activity was fully retained in the retentate. Taken together, these findings suggested that lipopeptides could be responsible for the antibacterial activity exhibited by the B. amyloliquefaciens strain 32a against the Agrobacterium strains.
This article is protected by copyright. All rights reserved.
Accepted Article
Relationship between cell growth, antibacterial activity and biosurfactant activity The dynamics of lipopeptides production and cells growth were monitored during the aerobic growth in OM broth. At different time intervals, samples were taken, and lipopeptides were precipitated and tested for their activity against A. tumefaciens strains. Changes in cell or spore numbers were recorded, as well as the size of zones of inhibition on indicator strains (Figure 3). The strain grew relatively quickly. It reached stationary phase after only 12 h of growth, and it was almost no lag phase. Appearance of first spores was detected after 10 h of incubation and their number increased exponentially until the 38th hour, reaching then a plateau. As shown in Figure 4, the antibacterial activity against both indicator strains started at the beginning of exponential growth phase (after 6 h), regardless of appearance of spores. Maximum of activity was slowly reached at the beginning of stationary growth phase (after 17 h of incubation). The strongest antibacterial inhibition was observed at 24 h of incubation and was maintained at that level until the end of the experiment.
Effect of the lipopeptides-enriched extract on Agrobacterium cells growth The effects of lipopeptides under investigation on the growth of A. tumefaciens C58 and B6 are shown in Figure 4. The addition of the lipopeptides-enriched extract to cell suspensions of each pathogen at the exponential growth phase leads to a divergence in viable cell counts when compared to the controls. The inhibition of A. tumefaciens C58 growth was immediate (from 5× 108 CFU ml-1 to less than 10 CFU ml-1) and resulted in a decrease in optical density during the incubation, suggesting that cell lysis occurred. Concerning A. tumefaciens B6, a slow but strong decrease in the number of viable cells (from 5× 108 CFU ml-1 to 102 CFU ml-1) was observed over a period of 6 h. The optical density of lipopeptidestreated A. tumefaciens B6 suspension remained nearly constant during this period, but decreased after several hours of incubation (data not shown). These findings demonstrate that
This article is protected by copyright. All rights reserved.
Accepted Article
the lipopeptides fraction clearly exhibits a bactericidal and bacteriolytic effect against both A. tumefaciens C58 and B6.
Biological control assays To confirm the contribution of the strain 32a in the biocontrol of A. tumefaciens strains, the carrot disc bioassay was used. Prior to this bioassay, the numbers of Agrobacterium cells able to induce 90% of galls to the inoculated discs were determined for both A. tumefaciens C58 and B6 (data not shown). These were 1 × 106 and 6 × 105 CFU, respectively. At these doses, young galls developing from the meristematic tissue around the central vascular system could be observed on the discs inoculated with these bacterial pathogens. Once the suitable bacterial doses were established, the antitumor activity was tested using both spore suspension (tested at the same concentration as the bacterial pathogen) and lipopeptide-enriched extract (200 AU ml-1) (Figure 5). As previously observed in the in vitro assays, both the 32a spores and the extract significantly reduced the disease severities (53.2 to 75.3% of disease reduction) compared with the untreated controls. In all cases, disease symptoms, obtained after treatment with the strain 32a, were significantly lower than those observed for untreated controls and statistically comparable with those of the reference antagonistic strain A. rhizogenes K1026.
Discussion Closely related species of B. subtilis group are of great agriculture importance, mostly exploited as biopesticides (Fravel 2005). More than one identification method have been frequently used to distinguish between B. subtilis and B. amyloliquefaciens (Thorsen et al. 2011). Phenotypic grouping of these closely related species based on morphology, physiology, fatty acid composition and carbohydrate fermentation is often misleading (Logan
This article is protected by copyright. All rights reserved.
Accepted Article
and Berkeley 1984; Wunschel et al. 1995). Therefore, genotypic identification using RFLP analysis of rRNA operons was used (Jeyaram et al. 2011). The digested profile clearly demonstrates that strain 32a could be assigned to B. amyloliquefaciens.
The genome of plant-associated B. amyloliquefaciens has been reported to harbor an array of giant gene clusters involved in the synthesis of antimicrobial material (Chen et al. 2009; Porwal et al. 2009). The vast majority of these antibiotics are non-ribosomally synthesized peptide derivatives, mainly cyclic lipopeptides. The antimicrobial activity of these lipopeptides has been generally described against fungi, with only a few reports addressing their effects on bacteria (Sharga and Lyon 1998; Wulff et al. 2002; Bais et al. 2004; Massomo et al. 2004; Etchegaray et al. 2008; Zeriouh et al. 2011). Therefore, the aim of this study was to characterize in depth the potential of a novel B. amyloliquefaciens strain, named 32a, to produce lipopeptides and to evaluate their ability to suppress crown gall caused by pathogenic strains of A. tumefaciens. The inhibition assays performed in vitro against different bacteria and fungi pathogens of plants proved the wide range antagonistic capacity of B. amyloliquefaciens strain 32a through the release of protease-resistant and thermo-stable compounds into the culture medium. The use of genetic markers such as lipopeptide synthetase genes, associated with biological control activities, has been proposed as a tool for the identification of novel biocontrol agents from environmental samples (Joshi and McSpadden Gardener 2006; Athukorala et al. 2009; Tapi et al. 2010). In our study, the presence of non ribosomal peptide synthetase genes involved in the synthesis of cyclic lipopeptides was detected in B. amyloliquefaciens strain 32a by PCR-based assays. Further analysis of culture broth extract by HPLC coupled to mass spectrometry revealed that strain 32a produces a wide variety of lipopeptides. According to the mass spectra, isoforms of surfactins (C12 to C16) as well as iturins A (C14 to C16) were co-produced by strain 32a. As
This article is protected by copyright. All rights reserved.
Accepted Article
fengycins A (C16 and C17) and B (C16) are also synthesized, 32a could be added to the limited number of B. amyloliquefaciens strains reported to co-produce the three families of lipopeptides (Koumoutsi et al. 2004; Arguelles-Arias et al. 2009).
In our study, it was possible to associate the presence of lipopeptides in the culture supernatant of B. amyloliquefaciens strain 32a with their biosynthetic genes. However, although that the peptide synthetase gene involved in the production of bacillomycin was detected by PCR, the latter was not found in the culture supernatant of strain 32a. It has been reported that the presence of a particular gene is not necessarily associated with its involvement in the biocontrol capacity (Joshi and McSpadden Gardener 2006). In fact, their expression depends on many factors, such as growth conditions, the presence of target microorganisms or the possibility of mutations in biosynthetic genes which can cause their inactivation. Antibacterial activity was detected at the transition between exponential and stationary phase of growth, increasing progressively during the latter and reaching the highest activity level after 2 days of growth, when bacterial populations are composed mainly by spores. It has been reported that the production of lipopeptides with antibacterial activity, such as surfactin, is advanced (transition between exponential and stationary growth) as compared with iturin or fengycin (late stationary-phase growth) (Stein 2005). Surfactin and iturin molecules exhibit antibacterial properties in vitro and could be involved in biocontrol functions in the rhizosphere. In fact, Bais et al (2004) showed that surfactin produced by B. subtilis 6051 is necessary for the reduction of the infection caused by Pseudomonas syringae on Arabidopsis plants. Furthermore, a contribution of closely related iturin A and bacillomycin was recently shown in the antagonism of B. subtilis toward bacterial diseases of cucurbits (Zeriouh et al. 2011).
This article is protected by copyright. All rights reserved.
Accepted Article
In this study, a possible role of lipopeptides in the biocontrol activity of the strain 32a against A. tumefaciens was demonstrated. In fact, treatment with the lipopeptide-enriched extract of 32a culture supernatant reduced dramatically the disease incidence, as revealed by significantly lower percentages of galled carrot discs compared to those of the control discs inoculated only with the bacterial pathogens. Treatment with 32a spores also provided a strong protective effect that was similar to that observed with the extract. The protective effect displayed by the lipopeptide-enriched extract could be explained by the highly stable and bacteriolytic anti-Agrobacterium metabolites in the extract, whereas the protective effect displayed by the B. amyloliquefaciens 32a spores suggests that 32a can efficiently proliferate and produce the same quantity or quality of metabolites on the surface and/or inner tissues of the carrot discs as it could in vitro.
As a bacterial disease, crown gall is very difficult to control using classical methods due to the lack of effective chemical treatments. Like other pathogenic microorganisms, virulent Agrobacterium strains have found ways to circumvent, or even manipulate the plants defence system for their own benefit (Pacurar et al. 2011). Several promising disease control strategies have been adopted. The best documented biological control agent targeted for the management of crown gall disease are avirulent Agrobacterium strains. Only few attempts were made to explore the antagonism of Bacillus strains towards pathogenic Agrobacterium strains (Rhouma et al. 2008; Hammami et al. 2009). The effectiveness of these treatments relies on the Agrobacterium growth-inhibiting effect of the chemical compounds released by the antagonist. In all these studies, the antibacterial compounds were identified as bacteriocins (Rhouma et al. 2008; Hammami et al. 2009). To our knowledge, this is the first report of antibiosis through lipopeptides producing B. amyloliquefaciens strain for the biocontrol of crown gall disease.
This article is protected by copyright. All rights reserved.
Accepted Article
B. amyloliquefaciens strain 32a identified in our study, with it’s broad range antagonistic activities, might be considered as a potential source of new bioactive metabolites as well as promising candidate to develop new biocontrol agents for controlling crown gall disease. Further research is needed to verify the production of lipopeptides by B. amyloliquefaciens during interaction with the plant and to identify the lipopeptide contributing to the biocontrol activity of 32a. Acknowledgements This work was supported by grants from the Tunisian Ministry of Higher Education, Scientific Research and Technology. We are grateful to Ms. Lobna Jlail for HPLC analysis. Conflict of interest No conflict of interest declared. References Arguelles-Arias, A., Ongena, M., Halimi, B., Lara, Y., Brans, A., Joris, B. and Fickers, P. (2009) Bacillus amyloliquefaciens GA1 as a source of potent antibiotics and other secondary metabolites for biocontrol of plant pathogens. Microb Cell Fact 63, 1-12. Athukorala, S.N., Fernando, W.G. and Rashid, K.Y. (2009) Identification of antifungal antibiotics of Bacillus species isolated from different microhabitats using polymerase chain reaction and MALDI-TOF mass spectrometry. Can J Microbiol 55, 1021-1032. Bais, H.P., Fall, R. and Vivanco, J.M. (2004) Biocontrol of Bacillus subtilis against infection of Arabidopsis roots by Pseudomonas syringae is facilitated by biofilm formation and surfactin production. Plant Physiol 134, 307-319. Broggini, G.A.L., Duffy, B., Holliger, E., Schärer, H.J., Gessler, C. and Patocchi, A. (2005) Detection of the fire blight biocontrol agent Bacillus subtilis BD170 (Biopro®) in a Swiss apple orchard. Eur J Plant Pathol 111, 93-100. Chen, X.H., Koumoutsi, A., Scholz, R., Schneider, K., Vater, J., Süssmuth, R., Piel, J. and
This article is protected by copyright. All rights reserved.
Accepted Article
Borrissa, R. (2009) Genome analysis of Bacillus amyloliquefaciens FZB42 reveals its potential for biocontrol of plant pathogens. J Biotechnol 140, 27-37. Chung, S., Kong, H., Buyer, J.S., Lakshman D.K., Lydon, J., Kim, S.D. and Roberts, D.P. (2008) Isolation and partial characterization of Bacillus subtilis ME488 for suppression of soil borne pathogens of cucumber and pepper. Appl Microbiol Biotechnol 80, 115-123. Dihazi, A., Jaiti, F., Taktak, W., Kilani-Feki, O., Jaoua, S., Driouich, A., Baaziz, M., Daayf, F. and Serghini, M.A. (2012) Use of two bacteria for biological control of bayoud disease caused by Fusarium oxysporum in date palm (Phoenix dactylifera L) seedlings. Plant Physiol Biochem 55, 7-15. Escobar, M.A. and Dandekar, A.M. (2003) Agrobacterium tumefaciens as an agent of disease. Trends in plant sci 8, 380-386. Etchegaray, A., de Castro Bueno, C., de Melo, I.S., Tsai, S.M., de Fátima Fiore, M.F., Silva-Stenico, M.E., de Moraes. L.A.B. and Teschke, O. (2008) Effect of a highly concentrated lipopeptide extract of Bacillus subtilis on fungal and bacterial cells. Arch Microbiol 190, 611-622. Felsenstein, J. (2004) PHYLIP (Phylogeny Inference Package) version3.6. Distributed by the author Department of Genome Sciences, University of Washington, Seattle. Fravel, D.R. (2005) Commercialization and implementation of biocontrol. Annu Rev Phytopathol 43, 337-359. Gurtler, V. and Stanisich, V.A. (1996) New approches to typing and identification of bacteria using the 16S-23S rDNA spacer region. Microbiology 142, 3-16. Hagelin, G., Indrevoll, B. and Hoeg-Jensen, T. (2007) Use of synthetic analogues in confirmation of structure of the peptide antibiotics maltacines. Int J Mass Spectrom 268, 254264. Hammami, I., Rhouma, A., Jaouadi, B., Rebai, A. and Nesme, X. (2009) Optimization and
This article is protected by copyright. All rights reserved.
Accepted Article
biochemical characterization of a bacteriocin from a newly isolated Bacillus subtilis strain 14B for biocontrol of Agrobacterium spp. strains. Lett Appl Microbiol 48, 253-260. Holt, J.G., Krieg, R.N., Sneath, P.H.A., Staley, J.T. and William, S.T. (1994) Bergey's manual of determinative bacteriology (9th ed.). Philadelphia: Lippincott William & Wilkins. Jeyaram, K., Romi, W., Singh, T.A., Adewumi, G.A., Basanti, K. and Oguntoyinbo, F.A. (2011) Distinct differentiation of closely related species of Bacillus subtilis group with industrial importance. J Microbiol Methods 87, 161-164. Joshi, R. and McSpadden Gardener, B.B. (2006) Identification and characterization of novel genetic markers associated with biological control activities in Bacillus subtilis. Phytopathology 96, 145-154. Kilani-Feki, O., Frikha, F., Zouari, I. and Jaoua, S. (2013) Heterologous expression and secretion of an antifungal Bacillus subtilis chitosanase (CSNV26) in Escherichia coli. Biopro biosys eng 36, 985-992. Koumoutsi, A., Chen, X.H., Henne, A., Liesegang, H., Hitzeroth, G., Franke, P., Vater, J. and Borriss, R. (2004) Structural and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic lipopeptides in Bacillus amyloliquefaciens strain FZB42. J Bacteriol 186, 1084-1096. Lee, S.C., Kim, S.H., Park, I.H., Chung, S.Y. and Choi, Y.L. (2007) Isolation and structural analysis of bamylocin A, novel lipopeptide from Bacillus amyloliquefaciens LP03 having antagonistic and crude oil-emulsifying activity. Arch Microbiol 188, 307-312. Logan, N.A. and Berkeley, R.C.W. (1984) Identification of Bacillus strains using the API system. J Gen Microbiol 130, 1871-1882. Mahesh, B. and Satish, S. (2008) Antimicrobial activity of some important medicinal plant against plant and human pathogens. World J AgricSci 4, 839-843. Malfanova, N., Franzil, L., Lugtenberg, B., Chebotar, V. and Ongena, M. (2012) Cyclic
This article is protected by copyright. All rights reserved.
Accepted Article
lipopeptide profile of the plant-beneficial endophytic bacterium Bacillus subtilis HC8. Arch microbial 194, 893-899. Massomo, S.M.S., Mortensen, C.N., Mabagala, R.B., Newman, M.A. and Hockenhull, J. (2004) Biological control of black rot (Xanthomonas campestris pv. campestris) of cabbage in Tanzania with Bacillus strains. J Phytopathol 152, 98-105. Mezghanni, H., Khedher, S.B., Tounsi, S. and Zouari, N. (2012) Medium optimization of antifungal activity production by Bacillus amyloliquefaciens using statistical experimental design. Prep Biochem Biotechnol 42, 267-278. Mora, I., Cabrefiga, J. and Montesinos, E. (2012) Antimicrobial peptide genes in Bacillus strains from plant environments. Int Microbiol 14, 213-223. Motta, A.S. and Brandelli, A. (2002) Characterisation of an antimicrobial peptide produced by Brevibacterium linens. J Appl Microbiol 92, 63-70. Ongena, M. and Jacques, P. (2008) Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends Microbiol 16, 115-125. Pacurar, D.I., Thordal-Christensen, H., Pacurar, M.L., Pamfil, D., Botez, C. and Bellini, C. (2011).
Agrobacterium
tumefaciens:
from
crown
gall
tumors
to
genetic
transformation. Physiol Mol Plant Pathol 76, 76-81. Pérez-Garcia, A., Romero, D. and de Vicente, A. (2011) Plant protection and growth stimulation by microorganisms: biotechnological applications of Bacilli in agriculture. Curr Opin Biotechnol 22, 187-193. Peypoux, F., Bonmatin, J.M. and Wallach, J. (1999) Recent trends in the biochemistry of surfactin. Appl Microbiol Biotechnol 51, 553-563. Porwal, S., Lal, S., Cheema, S. and Kalia, V.C. (2009) Phylogeny in aid of the present and novel microbial lineages: diversity in Bacillus. PLoS One 4(2):e4438. Rhouma, A., Borui, M., Boubaker, A. and Nesme, X. (2008) Potential effect of
This article is protected by copyright. All rights reserved.
Accepted Article
rhizobacteria in the management of crown gall disease caused by Agrobacterium tumefaciens biovar 1. J Plant Pathol 90, 517-526. Rhouma, A., Boubaker, A., Bseis, N. and Hafsa, M. (2001) Caractérisation et lutte biologique par K84 des isolats d’Agrobacterium tumefaciens agent causal de la galle du collet des rosacées fruitières en Tunisie. Revue de l’Institut National Agronomique de Tunisie 2, 716. Romero, D., de Vicente, A., Rakotoalay, R.H., Dufour, S.E., Veening, J.W., Arrebola, A., Cazorla, F.M., Kuipers, O.P., Paquot, M. and Pérez-Garcia, A. (2007) The iturin and fengycin families of lipopeptides are key factors in antagonism of Bacillus subtilis toward Podosphaerafusca. Mol Plant-Microbe Interact 20, 430-440. Sambrook, J. and Russell, D.W. (2001) Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor New York. Sharga, B.M. and Lyon, G.D. (1998) Bacillus subtilis BS 107 as an antagonistic of potato blackleg and soft rot bacteria. Can J Microbiol 44, 777-783. Stein, T. (2005) Bacillus subtilis antibiotics: structure, syntheses and specific functions. Mol Microbiol 56, 845-857. Sun, L., Lu, Z., Bie, X., Lu, F. and Yang, S. (2006) Isolation and characterization of a coproducer of fengycins and surfactins, endophytic Bacillus amyloliquefaciens ES-2, from Scutellaria baicalensis Georgi. World J Microbiol Biotechnol 22, 1259-1266. Tagg, J.R. and McGiven, A.R. (1971) Assay system for bacteriocins. Appl Microbiol 21, 943. Tapi, A., Chollet-Imbert, M., Scherens, B. and Jacques, P. (2010) New approach for the detection of non-ribosomal peptide synthetase genes in Bacillus strains by polymerase chain reaction. Appl Microbiol Biotechnol 85, 1521-1531. Tendulkar, S.R., Saikumari, Y.K., Patel, V., Raghotama, S., Munshi, T.K., Balaram, P.
This article is protected by copyright. All rights reserved.
Accepted Article
and Chattoo, B.B. (2007) Isolation, purification and characterization of an antifungal molecule produced by Bacillus licheniformis BC98, and its effect on phytopathogen Magnaporthe grisea. J Appl Microbiol 103, 2331-2339. Thimon, L., Peypoux, F., Wallach, J. and Michel, G. (1995) Effect of the lipopeptide antibiotic, iturin A, on morphology and membrane ultrastructure of yeast cells. Microbiol Lett 128, 101-106. Thorsen, L., Abdelgadir, W.S., Rønsbo, M.H., Abban, S., Hamad, S.H., Nielsen, D.S. and Jakobsen, M. (2011) Identification and safety evaluation of Bacillus species occurring in high numbers during spontaneous fermentations to produce Gergoush, a traditional Sudanese bread snack. Int J Food Microbiol 146, 244-252. Vanittanakom, N., Loeffler, W., Koch, U., Jung, G. (1986) Fengycin a novel antifungal lipopeptide antibiotic produced by Bacillus subtilis F-29-3. J Antibiot 39, 888-901. Wulff, E.G., Mguni, C.M., Mansfeld-Giese, K., Fels, J., Lübeck, M. and Hockenhull, J. (2002) Biochemical and molecular characterization of Bacillus amyloliquefaciens, B. subtilis and B. pumilus isolates with distinct antagonistic potential against Xanthomonas campestris pv. campestris. Plant Pathol 51, 574-584. Wunschel, D., Fox, K.F., Black, G.E. and Fox, A. (1995) Discrimination among the B. cereus group, in comparison to B. subtilis, by structural carbohydrate profiles and ribosomal RNA spacer region PCR. Syst Appl Microbiol 17, 625-635. Yangui, T., Rhouma, A., Gargouri, K., Triki, M.A. and Bouzid, J. (2008) Efficacy of olive mill waste water and its derivatives in the suppression of crown gall disease of bitter almond. Eur J Plant Pathol 122, 495-504. Zeriouh, H., Romero, D., Garcia-Gutierrez, L., Cazorla, F.M., de Vicente, A. and PerezGarcia, A. (2011) The iturin-like lipopeptides are essential components in the biological control arsenal of Bacillus subtilis against bacterial diseases of cucurbits. Mol Plant Microbe
This article is protected by copyright. All rights reserved.
Accepted Article
Interact 24, 1540-1552. Zhang, T., Shi, Q.Z., Hu, L.B., Cheng, L.G. and Wang, F. (2008) Antifungal compounds from Bacillus subtilis B-FS06 inhibiting the growth of Aspergillus flavus. World J Microbiol Biotechnol 24, 783-788. Zouba, A. and Hammami, K. (1988) La galle du collet des arbres fruitiers: biotypes et essais de lutte biologique. Revue de l’Institut National Agronomique de Tunisie 1,141-150.
Tables Table 1 Primers for PCR detection of lipopeptides biosynthesis genes in B. amyloliquefaciens 32a. Gene(s)
Primers
Sequences
PCR product
Reference
size (bp)
Bacillomycin
bam D
ITUD-F1
5’-TTGAAYGTCAGYGCSCCTTT
ITUD-R1
5’-TGCGMAAATAATGGSGTCGT
482
(Chung et al. 2008) bmyB
Fengycin
fenD
BMYB-F
5’-GAATCCCGTTGTTCTCCAAA
BMYB-R
5’-GCGGGTATTGAATGCTTGTT
FEND-F
5’-GGCCCGTTCTCTAAATCCAT
FEND-R
5’-GTCATGCTGACGAGAGCAAA
ITUD-F1
5’-TTGAAYGTCAGYGCSCCTTT
ITUD-R1
5’-TGCGMAAATAATGGSGTCGT
370
269 (Mora et al. 2012)
Iturin
ituD
482
(Chung et al. 2008) ituC
Surfactin
sfP
ITUC-F1
5’-CCCCCTCGGTCAAGTGAATA
ITUC-R1
5’- TTGGTTAAGCCCTGATGCTC
SFP-F1
5’-ATGAAGATTTACGGAATTTA
SFP-R1
5’-TTATAAAAGCTCTTCGTACG
594
675 (Chung et al. 2008)
This article is protected by copyright. All rights reserved.
Accepted Article
Table 2 Lipopeptides production by B. amyloliquefaciens 32a as detected by LC–MS.
Lipopeptide family
Molecular mass [M-H]-
Homologue
Surfactin
992.2
C-12
1006.0
C-13
1020.0
C-14
1033.9
C-15
1047.9
C-16
1040.9
C-14
1054.7
C-15
1068.8
C-16
1433.7
C-14
1446.6
C-15
1460.9
C-16
1474.8
C-17
1474.8
C-15
1489.8
C-16
1502.8
C-17
Iturin A/ Mycosubtilin
Fengycin A
Fengycin B
This article is protected by copyright. All rights reserved.
Accepted Article
Table 3 Biochemical characterization of the antibacterial activity of B. amyloliquefaciens 32a supernatant.
Culture filtrate
Antibacterial activity (%) A. tumefaciens C58
A. tumefaciens B6
Untreated
100 ± 0.0
100 ± 0.0
50ºC, 15 min
100 ± 0.0
100 ± 0.0
75°C, 15 min
100 ± 0.0
100 ± 0.0
100°C, 15 min
100 ± 0.0
100 ± 0.0
Untreated
100 ± 0.0
100 ± 0.0
Acid, pH = 2
100 ± 0.0
100 ± 0.0
Basic, pH = 12
68.8 ± 0.3
67.4 ± 0.8
Untreated
100 ± 0.0
100 ± 0.0
Proteinase K
100 ± 0.0
100 ± 0.0
Catalase
100 ± 0.0
100 ± 0.0
Untreated
100 ± 0.0
100 ± 0.0
n-Butanol
100 ± 0.0
100 ± 0.0
Methanol
100 ± 0.0
100 ± 0.0
Untreated
100 ± 0.0
100 ± 0.0
>5-kDa fraction
96.8 ± 0.2
96.5 ± 0.5
