B1.

Human Molecular Genetics, 2014, Vol. 23, No. 19 doi:10.1093/hmg/ddu216 Advance Access published on May 8, 2014

5036–5051

TDP-43 suppresses CGG repeat-induced neurotoxicity through interactions with HnRNP A2/B1 Fang He1, Amy Krans1, Brian D. Freibaum2, J. Paul Taylor2 and Peter K. Todd1,3,∗ 1

Department of Neurology, University of Michigan Medical School, 109 Zina Pitcher Pl, Ann Arbor, MI 48109, USA, Department of Developmental Neurobiology, St Jude Children’s Research Hospital, Memphis, TN 38105, USA and 3 VA Medical Center, Ann Arbor, MI 48105, USA 2

Nucleotide repeat expansions can elicit neurodegeneration as RNA by sequestering specific RNA-binding proteins, preventing them from performing their normal functions. Conversely, mutations in RNA-binding proteins can trigger neurodegeneration at least partly by altering RNA metabolism. In Fragile X-associated tremor/ataxia syndrome (FXTAS), a CGG repeat expansion in the 5′ UTR of the fragile X gene (FMR1) leads to progressive neurodegeneration in patients and CGG repeats in isolation elicit toxicity in Drosophila and other animal models. Here, we identify the amyotrophic lateral sclerosis (ALS)-associated RNA-binding protein TAR DNA-binding protein (TDP-43) as a suppressor of CGG repeat-induced toxicity in a Drosophila model of FXTAS. The rescue appears specific to TDP43, as co-expression of another ALS-associated RNA-binding protein, FUS, exacerbates the toxic effects of CGG repeats. Suppression of CGG RNA toxicity was abrogated by disease-associated mutations in TDP-43. TDP-43 does not co-localize with CGG RNA foci and its ability to bind RNA is not required for rescue. TDP-43-dependent rescue does, however, require fly hnRNP A2/B1 homologues Hrb87F and Hrb98DE. Deletions in the C-terminal domain of TDP-43 that preclude interactions with hnRNP A2/B1 abolish TDP-43-dependent rescue of CGG repeat toxicity. In contrast, suppression of CGG repeat toxicity by hnRNP A2/B1 is not affected by RNAi-mediated knockdown of the fly TDP-43 orthologue, TBPH. Lastly, TDP-43 suppresses CGG repeat-triggered mis-splicing of an hnRNP A2/B1-targeted transcript. These data support a model in which TDP-43 suppresses CGG-mediated toxicity through interactions with hnRNP A2/B1 and suggest a convergence of pathogenic cascades between repeat expansion disorders and RNA-binding proteins implicated in neurodegenerative disease.

INTRODUCTION Fragile X-associated tremor/ataxia syndrome (FXTAS) is an inherited neurodegenerative disorder characterized by late-onset, progressive gait difficulties, dementia and tremors which affects 1/3000 men over age 50 (1). FXTAS results from a modest expansion of a trinucleotide (CGG) repeat in the 5′ UTR of the fragile X mental retardation gene (FMR1) (2). Expansions to .200 CGG repeats silence FMR1 transcription and cause fragile X syndrome, a frequent cause of autism and intellectual disability (3,4). In contrast, ‘pre-mutation’ range expansions (55 – 200 CGG repeats) cause FXTAS, characterized by enhanced FMR1 transcription and the accumulation of CGG repeat-containing FMR1 mRNA in nuclear foci (5 – 7).

The mechanism by which CGG repeat expansion elicits neurodegeneration is unclear (8). Based on similarities to the molecular basis of myotonic dystrophy, it is suggested that expanded CGG RNA repeats bind to and sequester-specific RNA-binding proteins, leading to a perturbation of their normal functions (2,9,10). In myotonic dystrophy, expanded CUG repeats in the 3′ UTR of DMPK or expanded CCUG repeats in an intron of ZNF9 are each capable of binding to Muscleblind-like (MBNL) and CELF1 splicing factors, leading to altered RNA splicing and a convergence of clinical phenotypes despite disparate genomic locations and gene functions (11). In mouse models of DM1, certain aspects of the pleiotropic phenotypes are suppressed by co-expression of MBNL or recapitulated by knocking out MBNL proteins (12–14).

∗ To whom correspondence should be addressed at: 4005 BSRB, 109 Zina Pitcher Place, Ann Arbor, MI 48109-2200, USA. Tel: +1 7346155632; Fax: +1 7346479777. Email: [email protected]

# The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: [email protected]

Downloaded from http://hmg.oxfordjournals.org/ at University of California, San Francisco on December 16, 2014

Received February 6, 2014; Revised April 8, 2014; Accepted May 5, 2014

Human Molecular Genetics, 2014, Vol. 23, No. 19

RESULTS Overexpression of TDP-43 suppresses CGG repeat toxicity We utilized a previously described Drosophila model of CGG repeat toxicity where the FMR1 5′ UTR containing a 90 CGG repeat expansion was placed upstream of eGFP under the control of a UAS promoter (CGG90-GFP) (10). When transgene expression is targeted to the Drosophila eye using a GMR-Gal4

driver, these flies demonstrate substantial eye degeneration compared with flies expressing eGFP alone [(10), Fig. 1A]. Several RNA-binding proteins are known to associate specifically with CGG repeats in vitro and in cell culture-based systems (15–18) and a subset of these are capable of modulating CGG repeat toxicity when their expression is altered in Drosophila (15,16,18). We evaluated the impact of co-expressing human myc-TDP-43 or FUS in CGG90-GFP flies. As reported (33,34), expression in


In FXTAS, evidence for a primary RNA toxic gain-of-function mechanism is less complete. A number of different proteins have been identified that interact directly or indirectly with CGG repeats including Pura, CELF1, hnRNP A2/B1, Sam 68, hnRNP-G and the Drosha/DGCR8 miRNA biogenesis complex (15–18). One of these, hnRNPA2/B1, was independently identified as a component of pathological inclusions isolated in FXTAS patient brain tissue by unbiased mass spectroscopy (19). Overexpression of hnRNP A2/B1 suppresses degeneration in CGG repeat toxicity in Drosophila; moreover, the expression of CGG repeats in mammalian neurons and in Drosophila disturbs hnRNP A2/B1 functions, including dendritic mRNA transport and suppression of retrotransposon activity (20,21). In parallel, a growing number of neurodegenerative disorders have been linked to mutations and/or aggregation of RNA-binding proteins (9,22). Specifically, ubiquitinated, cytoplasmic inclusions of TAR DNA-binding protein (TDP-43) are characteristic of most sporadic and familial forms of amyotrophic lateral sclerosis (ALS) and some forms of frontotemporal dementia (FTD) (23). Additionally, mutations in TDP-43, TAF-15, and FUS (fused in sarcoma/translocated in liposarcoma) are known to cause ALS and/or FTD (24–28). More recently, mutations in hnRNP A2/B1 and hnRNPA1 were found to cause multisystem proteinopathy, a disorder that includes muscle, brain and peripheral nervous system involvement (29). Thus, the mis-localization and dysfunction of RNA-binding proteins is capable of eliciting neurodegeneration in multiple contexts. Recently, an intronic GGGGCC repeat expansion in C9ORF72 was identified as the most common known inherited cause of ALS and FTD (30,31). C9FTD/ALS patients exhibit both TDP-43-positive cytoplasmic aggregates and GGGGCC repeat nuclear RNA foci in both autopsy tissues and in iPS-derived patient neurons (30,32). These findings suggest a potential convergence of RNA-mediated and RNA-binding protein-mediated neurodegenerative pathogenic cascades. To explore the potential interaction between RNA repeat toxicity and RNA-binding proteins implicated in neurodegenerative disorders, we utilized a Drosophila model of CGG repeat toxicity (a model of FXTAS) to examine for genetic interactions with TDP-43 and FUS, two RNA-binding proteins implicated in neurodegenerative disease. We demonstrate that co-expression of the ALS-FTD-associated protein TDP-43 suppresses CGG repeat expansion-associated toxicity. TDP-43-mediated suppression of CGG repeat toxicity is post-transcriptional, occurs independent of TDP-43 RNAbinding capacity, and requires interaction with hnRNP A2/B1 homologues. These data suggest roles for TDP-43 and hnRNP A2/B1 in CGG RNA repeat toxicity and support a disease model in which complex interactions between RNA-binding proteins and toxic RNA modulate RNA homoeostasis and contribute to neurodegenerative disease.

5037

Figure 1. TDP-43 suppresses CGG repeat-associated toxicity. (A–F)Representative eye images of 0 –3-day-old flies with indicated genotypes. (A) CGG90-GFP expression causes a rough eye phenotype. (B) Control driver line GMR-Gal4 alone show normal morphology. (C) Human TDP-43 partially suppresses CGG repeat toxicity (compared to A). (D) Overexpression of TDP-43 alone has mild effects in eye morphology. (E) Overexpression of human FUS exacerbates CGG repeat toxicity. (F) Overexpression of human FUS alone only mild effects on eye pigmentation. (G) Quantification of Eye degeneration score from .100 flies of the indicated genotypes. Asterisk indicates P-value ,0.05 after a Bonferroni correction, Mann–Whitney U-test, NS indicates no significant difference. Genotypes are A-GMR-Gal4: UAS-CGG90-GFP/+; B-GMR-Gal4/+; C-GMR-Gal4: CGG90-GFP/UAS-myc-TDP-43; D-GMR-Gal4/UAS-myc-TDP-43; E-GMR-Gal4: CGG90-GFP/UAS-HA-FUS; F-GMR-Gal4/UAS-HA-FUS.

5038


the eye of wild-type TDP-43 alone elicited a very modest rough eye phenotype, and expression of wild-type FUS alone causes mild eye depigmentation with retention of normal eye structure (Fig. 1D and F). Unexpectedly, overexpression of TDP-43 in CGG90-GFP expressing flies ameliorated the rough eye phenotype (Fig. 1C). The suppression of expanded CGG repeat toxicity by TDP-43 was consistent and statistically significant over multiple crosses (Fig. 1G). In contrast, overexpression of WT FUS exacerbated CGG90-GFP-associated rough eye phenotypes and elicited significant depigmentation (Fig. 1E and G).

TDP-43 is a multifunctional protein, first identified as a DNAbinding protein capable of suppressing HIV-1 transcription (35). TDP-43 binds to both RNA and DNA to affect transcription, RNA stability and alternative splicing (36– 38). In the cytoplasm, it contributes to stress granule dynamics (39,40) and RNA transport (41). We, therefore, serially evaluated components of TDP-43 function to determine how its overexpression triggers CGG repeat toxicity suppression. Co-expression of HDAC6 reduces CGG90-GFP mRNA expression (42) and loss of TDP-43 leads to down-regulation of dHDAC6 mRNA (36,43). To determine whether TDP-43 suppression of CGG toxicity is a result of reduced transcription of CGG repeats either directly as a repressor or indirectly by stabilizing HDAC6 mRNA, we assessed CGG90-GFP mRNA expression in the presence or absence of TDP-43. Overexpression of myc-TDP-43 in CGG90-GFP flies, however, had no impact on HDAC6 mRNA by qRT – PCR (Fig. 2A). Expression of HDAC3 and HDAC11 mRNA was similarly unaltered by overexpression of TDP-43 (data not shown). Consistent with this, CGG90-GFP mRNA levels were unaffected by co-expression of TDP-43 (Fig. 2A). Thus, the effects of TDP-43 on CGG repeat toxicity appear to be post-transcriptional. CGG repeat-containing RNAs form foci in FXTAS patient tissues and in cellular and animal models of disease (7,17,44). One model of pathogenesis in FXTAS posits that the CGG repeat RNA binds to and sequesters specific RNA-binding proteins into proteinaceous inclusions. Consistent with this model, CGG repeat-binding proteins Pura, hnRNP A2/B1, Sam68 and DROSHA/DGCR8 co-localize with CGG RNA in FXTAS patients (15 – 18). In contrast, TDP-43 does not to interact with CGG RNA in vitro (17) and CGG90-GFP expression in isolation did not alter expression of the TDP-43 fly orthologue TBPH (Supplementary Material, Fig. S1). To examine whether expressed TDP-43 might indirectly associate with CGG RNA foci in vivo or alter RNA foci numbers, we combined in situ hybridization to CGG repeats with immunofluorescence detection of TDP-43 (Fig. 2B). Myc-TDP-43 expressed alone was present in both the nucleus and cytoplasm (33). CGG90-GFP expressing flies, but not flies expressing TDP-43 alone, exhibit nuclear and cytoplasmic CGG repeat RNA foci (Fig. 2B). Co-expression of TDP-43 protein with CGG90-GFP did not alter the distribution of TDP-43 or the distribution or number of CGG RNA foci (Fig. 2B and C). Moreover, there is little co-localization (,30% total co-staining) of TDP-43 to CGG RNA foci and no evidence for sequestration based on re-distribution of TDP-43 (Fig. 2B).

TDP-43 expression in FXTAS patient-derived samples We next examined whether the expression or distribution of TDP-43 was altered in FXTAS patient samples. We first performed immunohistochemical analysis of TDP-43 distribution in human autopsy samples. In both control and FXTAS brain autopsy samples, TDP-43 was diffusely localized within the nucleus without any cytoplasmic aggregation (as is typically seen in FTD) or accumulation into prominent nuclear inclusions (Fig. 3A). As we had limited access to autopsy tissue, we were not able to determine whether there were any significant differences in TDP-43 mRNA or protein expression in human patient brain samples. However, we did evaluate the expression of TDP-43 within fibroblast cell lines from control and premutation carriers (42,45). These studies demonstrated no significant differences in TDP-43 RNA or protein expression between premutation carriers, FXTAS patients and controls. Moreover, we found no correlation between CGG repeat size and either TDP-43 mRNA or protein levels (Fig. 3B and C). Functional requirements for TDP-43 to suppress CGG repeat toxicity TDP-43 protein possesses an N-terminal domain containing a nuclear localization signal (NLS), a central region containing two RNA recognition motifs (RRMs), and a C-terminus containing a prion-like, glycine-rich domain that is important for protein– protein interactions including functional oligomerization during RNA granule assembly (schematically represented in Fig. 4A) (46,47). The RRM domains allow RNA recognition and binding, while the prion-like domain is the site of most ALS and FTD disease-causing mutations (46,48). TDP-43 predominantly resides in the nucleus (49), but it actively shuttles between the nucleus and the cytoplasm where it associates with and regulates stress granule dynamics (39,40). To test whether the cellular localization of TDP-43 affects its ability to suppress CGG repeat


CGG repeat RNA levels and RAN translation are not altered by TDP-43

Recently, we demonstrated that CGG repeat expansions in the 5′ UTR of FMR1 are capable of eliciting Repeat Associated Non-AUG (RAN) translation to produce a polyglycinecontaining protein (FMRpolyG) (44). This unconventional form of translation is toxic in cell culture systems and contributes to neurodegeneration in Drosophila models of FXTAS (44). In CGG90-GFP expressing flies, RAN translation triggers formation of bright FMRpolyG-GFP insoluble aggregates in expressing tissues (44). To test whether overexpression of TDP-43 affects RAN translation, we examined the formation of FMRpolyG-GFP aggregates in flies expressing only CGG90-GFP alone or together with myc-TDP-43. Co-expression of TDP-43 did not alter the level of RAN translation product FMRpolyG-GFP as detected by western blot (Fig. 2D and E) or change the number or distribution of FMRpolyG-GFP aggregates (Fig. 2F and G). Moreover, we observed no significant co-localization of TDP-43 with GFP aggregates in CGG90-GFP expressing flies (data not shown). Together, these results suggest that TDP-43 modulates CGG repeat-associated RNA-mediated toxicity, rather than by altering CGG repeat transcription or through enhanced RAN translation of FMRpolyG. However, our current data cannot rule out a contribution to the observed phenotypes from CGG RAN translation in other reading frames.


5039

toxicity, we utilized UAS-TDP-43 DNLS (K82A/R83A/K84A) and UAS-TDP-43 DNES (L248A/I249A/I250A) mutant transgenic Drosophila lines (33). As previously reported (33), GMR-Gal4driven expression of TDP-43-DNES alone elicits no rough eye

phenotype, while expression of TDP-43-DNLS alone elicits a severe rough eye phenotype (Fig. 4G and 4I). When these two mutant lines were crossed to CGG repeat expressing flies, the TDP-43-DNES did not modulate CGG repeat toxicity


Figure 2. CGG repeat RNA levels and RAN translation are not altered by TDP-43. (A) RT –PCR quantitation of CGG repeat and HDAC6 mRNA from flies expressing CGG90-GFP alone or with TDP-43. (B) Confocal microscopic images of transverse sections through heads of 0– 3-day-old flies expressing either TDP43 alone (top row) CGG90-GFP alone (middle row) or TDP-43 and CGG90-GFP together (bottom row). Left column shows in situ hybridization using a Cy5-(CCG)6 RNA probe against CGG repeat RNA (red). Middle column shows immunofluorescent images of myc-TDP-43 (green). Right column shows merged images with nuclear DAPI staining (blue). Inserts in the left corner of merged images showed that colocalization of TDP-43 and CGG RNA foci was rare. (C) Retina RNA foci number/mm2 (left) and nuclear-associated RNA foci percentage (right) in fly eyes of the specified genotypes. (D) Representative Western blot detection of RAN translation product, FMRpolyG-GFP, from fly heads expressing CGG90-GFP alone or with TDP-43. FMRpolyG-GFP expression was not detectable in flies expressing GFP only. (E) FMRpolyG-GFP expression in fly eyes with the specified genotypes from at least three independent experiments. FMRpolyG-GFP levels were normalized to tubulin as a loading control. (F) Representative confocal micrograph of transverse sections through 3-day-old flies expressing CGG90-GFP alone or with TDP-43 shows no differences in number or distribution of FMRPolyG-GFP (RAN translation product) insoluble aggregates (green). DAPI staining is in blue. (G) GFP aggregate number/mm2 in fly retina of specific genotype. NS indicates no statistical difference. Genotypes of flies: GFP is GMR-Gal4/GFP; CGG90-GFP is GMR-Gal4: CGG90-GFP/+, and CGG90-GFP; TDP-43 is GMR-Gal4: CGG90-GFP/+; TDP-43/+.

5040


(Fig. 4B and F), whereas co-expression of TDP-43-DNLS with CGG90-eGFP proved to be lethal even when transgene expression was largely limited to the eye (Fig. 4H).

TDP-43 suppression of CGG repeat toxicity is dependent on hnRNP A2/B1 homologues TDP-43 predominantly interacts with two types of proteins: nuclear splicing factors and cytoplasmic RNA-binding proteins involved in protein translation (53). One particularly


Figure 3. TDP-43 expression and distribution is unaltered in FXTAS patient samples. (A) Representative immunohistochemical images from brain samples from control and FXTAS cases stained with TDP-43. Both showed similar diffuse, predominantly nuclear TDP-43 localization without cytoplasmic aggregates. Scale bar: 40 mm. TDP-43 mRNA levels as measured by qRT-PCR from control and CGG expanded fibroblast cell lines, plotted as XY scatter between repeat size and relative TDP-43 expression level normalized to b-actin, no correlation was found between different repeat sizes. (C) TDP-43 protein quantitation from control and CGG expanded fibroblast cell lines, plotted as XY scatter between repeat size and relative TDP-43 expression level normalized to actin. No correlation was found between different repeat sizes.

To test whether RNA-binding properties or protein – protein interaction, domains are required for TDP-43 to suppress CGG repeat-associated toxicity, we generated new fly lines carrying p-element insertions under a UAS promoter of HA-tagged wildtype TDP-43, HA-TDP-43 containing mutations that prevent RNA binding [FFLL, see (50)], or HA-TDP-43 containing a deletion of a critical region (D321– 366) for interactions with other RNA-binding proteins—most notable of which is hnRNP A2/B1 (46). These lines were first crossed to flies expressing GMR-Gal4 alone. Expression of either WT HA-TDP-43 or TDP-43-FFLL by themselves elicited very little toxicity (Fig. 4E and K), consistent with published reports (33), whereas the expression of TDP-43-D321 – 366 exhibited a mild rough eye phenotype (Fig. 4M), despite similar transcript levels by qRT – PCR for all three TDP-43 variants (Fig. 4O). To assess the impact of these mutations on TDP-43’s ability to suppress CGG repeat toxicity, we evaluated the impact of these same lines crossed to flies expressing both GMR-Gal4 and UAS-CGG90-GFP. Expression of WT HA-TDP-43, similar to the myc-TDP-43 line used in previous experiments, showed partial suppression of CGG repeat toxicity (Fig. 4D). Expression of TDP-43-FFLL-HA, which lacks RNA-binding capacity, also suppressed CGG repeat toxicity, though to a lesser extent then the WT protein (Fig. 4J). In contrast, C-terminal mutant TDP-43 (TDP-43-D321 – 366-HA) did not suppress the CGG repeat toxicity and instead slightly enhanced the rough eye phenotype (Fig. 4L and O). We also assessed the ability of three ALS disease-causing mutations in TDP-43 to suppress CGG repeat toxicity. Two of these mutations, TDP-43 M337V and TDP-43 Q331K, reside within the 321– 366 protein – protein interaction domain (24). The third mutation,G294A, lies outside of this region and is both less aggregate prone and less toxic in yeast than the other two mutations (24,51). Like TDP-43-D321– 366, TDP-43 M337V expression in isolation elicits a mild rough eye phenotype (Fig. 5F and H, 33). However, when either of two TDP-43 M337V lines was crossed to CGG90-GFP expressing flies, there was a decrease in viable progeny from flies carrying both CGG and TDP-43 mutant transgenes. In viable progeny, rough eye phenotypes were significantly enhanced (Fig. 5E, G and Q). Results for TDP-43 G294A were very similar to M337, with only very mild phenotypes in isolation but a decrease in viable progeny and enhanced rough eye phenotypes in flies expressing both CGG repeats and the mutant TDP-43 transgene (Fig. 5M –Q). Multiple fly lines expressing TDP-43 Q331K mutations exhibited minimal toxicity on their own but were unable to suppress CGG repeat-associated toxicity (Fig. 5I – L and Q). These differential effects were not easily explained by differences in TDP-43 transgene expression [Supplementary Material, Fig. S2, (52)]. Taken together, these findings implicate the C-terminal domain of TDP-43 as critical for suppression of CGG repeat-associated phenotypes and suggest that mutations in TDP-43 preclude suppression of CGG RNA toxicity.


5041


Figure 4. The protein interaction domain of TDP-43 is required for suppression of CGG repeat toxicity. A: Schematic of TDP-43 protein with nuclear localization and export signals (NLS and NES, green blocks), two RNA recognition motifs (RRMs, red blocks), and critical protein interaction region (yellow block). The mutated amino acids in NLS (K82A/R83A/K84A) and in NES (L248A/I249A/I250A) are shown in red letters, and the mutation locations for RNA binding defective mutants (F147L/F149L) and ALS-causing mutations G294A, Q331K and M337V are along the bottom. B-M: Representative eye images from 0-3 day old flies of the indicated genotypes. B: CGG90-GFP expression causes a rough eye phenotype. C: Control driver line GMR-Gal4 alone shows normal morphology. D: Expression of WT-TDP-43 partially suppresses CGG repeat toxicity. E: Expression of WT-TDP-43 alone in fly eyes has modest effects on eye morphology. F: Co-expression of TDP-43-DNES does not suppress CGG repeat toxicity. G: Expression of TDP-43-DNES alone has normal eye morphology. H: TDP-43-DNLS is lethal in CGG90-GFP expressing flies. I: Expression of TDP-43-DNLS alone causes severe eye deformation. J: Expression of TDP-43-FFLL partially suppresses CGG repeat toxicity, K: Expression of TDP-43-FFLL alone has normal eye morphology. L: Expression of TDP-43-D321-366 exacerbates CGG repeat-associated rough eye phenotype. M: Expression of TDP-43D321-366 alone exhibited a mild rough eye phenotype. N: Mean eye degeneration scores from more than 100 flies of the indicated genotypes. Asterisk indicates P value ,0.05 after Bonferroni correction, Mann-Whitney U test. O: RT-PCR quantitation of TDP-43 from heads of different TDP-43 genotypes crossed to GMR-Gal4 driver line. Genotypes of the fly eyes are: B: GMR-Gal4: UAS-CGG90-GFP/+; C: GMR-Gal4/+; D: CGG90-GFP/UAS-TDP-43-HA; F: GMR-Gal4: CGG90-GFP/UAS-hTDP-43-DNES; G: GMR-Gal4/UAS-hTDP-43-DNES; H: GMR-Gal4: CGG90-GFP/UAS-hTDP-43-DNLS; I: GMR-Gal4 /UAS-hTDP-43-DNLS; J: GMR-Gal4: CGG90-GFP/UAS-TDP-43-FFLL; K: GMR-Gal4/UAS-TDP-43-FFLL; L: GMR-Gal4: CGG90-GFP/UAS-TDP-43D321-366; M: GMR-Gal4: CGG90-GFP/UAS-TDP-43-D321-366.

5042


well-studied interactor is the RNA-binding protein hnRNP A2/ B1 (54). HnRNP A2/B1 interacts directly with TDP-43 through the C-terminal domain and this interaction is critical to many aspects of TDP-43 function, including its roles in splicing (46). Recently, mutations in hnRNPA2/B1 and the closely related paralogue hnRNPA1 were found to cause multisystem proteinopathy and ALS (29). Interestingly, hnRNP A2/B1 is a component of ubiquitin-positive inclusion in FXTAS patients (19), and it directly binds to CGG repeat RNA in vitro (15,16).

Both human hnRNP A2/B1 and the fly homologues Hrb87F and Hrb98DE are able to suppress CGG repeat toxicity in Drosophila (16). To test whether Drosophila hnRNP A2/B1 homologues were important for TDP-43-mediated suppression of CGG repeat toxicity, we utilized RNAi fly lines targeting Hrb87F (Hrp36) and Hrb98DE (Hrp38) (Fig. 6A and B). Of note, CGG90-GFP flies exhibit normal expression of both hnRNP A2/B1 homologues (Supplementary Material, Fig. S3). Expression of these RNAi lines in isolation or in the presence of


Figure 5. TDP-43 disease-causing mutants exacerbate CGG repeat toxicity. (A –P) Representative eye images of 0 –3-day-old flies of the indicated genotypes. (A) CGG90-GFP expression causes a rough eye phenotype. (B) Control driver line GMR-Gal4 alone show normal morphology. (C) Co-expression of WT-TDP-43 partially suppresses CGG repeat toxicity. (D) Co-expression of TDP-43 alone has modest effects on eye morphology. (E and G) Two lines expressing mutant TDP-43 M337V show exacerbated eye degeneration in CGG90-GFP expressing flies. (F and H) expression of the TDP-43 M337V alone showed varied level of eye degeneration. (I and K) Two lines expressing mutant TDP-43 Q331K shows modest (line 1) or no suppression (line 2) on eye degeneration in CGG90-GFP expression flies. (J and L) expression of TDP-43 Q331K alone showed no effects on eye morphology. (M and O) Expression of TDP-43 G294A mutants enhanced CGG90-GFP toxicity. (N and P) expression of TDP-43 G294A alone showed no effects on eye morphology. (Q) Eye degeneration score of for the indicated genotypes. Asterisk indicates P value , 0.05 after Bonferroni correction, Mann-Whitney U-test. C indicates decrease in viable progeny from indicated crosses. Genotypes of fly eyes are (A) GMR-Gal4: UAS-CGG90-GFP/+, (B) GMR-Gal4/+; (C) GMR-Gal4: UAS-CGG90-GFP/UAS-myc-TDP-43; (D) GMR-Gal4/UAS-myc-TDP-43; (E) GMR-Gal4: UAS-CGG90-GFP/UAS-myc-TDP-43 M337V line1; (F) GMR-Gal4 /UAS-myc-TDP-43 M337V line1; (G) GMR-Gal4: UAS-CGG90-GFP/ UAS-myc-TDP-43 M337V line2; (H) GMR-Gal4 /UAS-myc-TDP-43 M337V line2; (I) GMR-Gal4: UAS-CGG90-GFP/UAS-myc-TDP-43 Q331K line1; (J) GMR-Gal4 /UAS-myc-TDP-43 Q331K line1; (K) GMR-Gal4: UAS-CGG90-GFP/UAS-myc-TDP-43 Q331K line2; (L) GMR-Gal4 /UAS-myc-TDP-43 Q331K line2; (M) GMR-Gal4: UAS-CGG90-GFP/UAS-myc-TDP-43 G294A line1; (N) GMR-Gal4 /UAS-myc-TDP-43 G294A line 1; (O) GMR-Gal4: UAS-CGG90-GFP/UAS-myc-TDP-43 G294A line 2; (P) GMR-Gal4/UAS-myc-TDP-43 G294A line 2.


5043


Figure 6. (A and B) Quantitative RT –PCR results in control driver line (GMR-Gal4/+) or flies expressing Hrb87F RNAi (A, GMR-Gal4/Hrb87F RNAi) or Hrb98DE RNAi (B, GMR-Gal4/Hrb98DE RNAi), respectively, demonstrating knockdown of target mRNAexpression. (A and B) Quantitative RT– PCR results in control flies or flies expressing Hrb87F RNAi (A) or Hrb98DE RNAi (B), respectively, demonstrating knockdown of target mRNA expression. (C– N) Representative eye images of 0 –3-day-old flies of the indicated genotypes. (C) Control driver line GMR-Gal4 alone shows normal morphology. (D) expression of human TDP-43 has a mild rough eye phenotype. RNAi knockdown of Hrb87F (E) or Hrb98DE (G) in isolation has no effects on eye morphology. (F and H) RNAi knockdown of Hrb87F or

5044


myc-TDP-43 had no apparent effect on eye morphology (Fig. 6D – H). Consistent with their known roles in CGG repeat toxicity (16), knockdown of Hrb87F or Hrb98DE slightly exacerbated CGG90-GFP rough eye phenotypes (Fig. 6K, M and O). When either Hrb87F or Hb98DE expression was reduced, the ability of TDP-43 to suppress CGG repeat toxicity was completely blocked, suggesting that hnRNP A2/B1 homologues are critical for TDP-43 to suppress CGG repeat toxicity (Fig. 6L, N and O).

Normal TBPH expression is not required for hnRNP A2/B1 suppression of CGG toxicity To test whether hnRNP A2/B1 and TDP-43 act interdependently to suppress CGG repeat toxicity, we examined whether the normal expression of the TDP-43 orthologue TBPH is required for hnRNP A2/B1-mediated suppression of CGG toxicity. Neither RNAi directed against TBPH (Fig. 7A) or a heterozygous loss of function TPBH alleles had obvious adverse effects on eye

Hrb98DE in TDP-43 expressing fly eyes does not affect the eye phenotype. (I) CGG90-GFP expression causes a rough eye phenotype. (J) Co-expression of human TDP-43 partially suppresses CGG repeat toxicity. (K and M) RNAi knockdown of Hrb87F (K) or Hrb98DE (M) modestly exacerbates phenotype in CGG90-GFP expressing flies. (L and N) Depletion of Hrb87F (L) or Hrb98DE (N) abolishes TDP-43-mediated suppression of CGG repeat toxicity. (O) Eye degeneration scores from .100 flies from each of the indicated genotypes. Asterisk indicates P value , 0.05 after a Bonferroni correction, by the unpaired t-test in (A) and (B), or by the Mann–Whitney U-test in (O). NS indicates no significant statistical difference. Genotypes of fly eyes are (C) GMR-Gal4/+; (D) GMR-Gal4/ UAS-myc-TDP-43; (E) GMR-Gal4/UAS-Hrb87FRNAi; (F) GMR-Gal4/+; UAS-myc-TDP-43/UAS-Hrb87FRNAi; (G) GMR-Gal4/UAS-Hrb98DERNAi; (H) GMR-Gal4/+; UAS-myc-TDP-43/UAS-Hrb98DERNAi; (I) GMR-Gal4: UAS-CGG90-GFP/+; (J) GMR-Gal4: CGG90-GFP/UAS-myc-hTDP-43; (K) GMR-Gal4: CGG90-GFP/UAS-Hrb87FRNAi; (L) GMR-Gal4: CGG90-GFP/+; UAS-myc-TDP-43/UAS-Hrb87FRNAi; (M) GMR-Gal4: CGG90-GFP/ UAS-Hrb98DERNAi; (N) GMR-Gal4: CGG90-GFP/+; UAS-Myc-TDP-43/UAS-Hrb87FRNAi.


Figure 7. Quantitative RT –PCR of TBPH mRNA in control driver line (GMR-Gal4/+) or TBPH RNAi expressing flies (GMR-Gal4/TBPH RNAi) demonstrates efficient suppression of TBPH expression. (A) Quantitative RT –PCR of TBPH mRNA in control or TBPH RNAi expressing flies demonstrates efficient suppression of TBPH expression. (B– I) Representative eye images of 0– 3-day-old flies of the indicated genotypes. (B) CGG90-GFP expression causes a rough eye phenotype. (C) Control driver line GMR-Gal4 alone shows normal morphology. (D) RNAi knockdown of TBPH has no effect on CGG repeat toxicity. (E) RNAi knockdown of TBPH alone has no apparent effects on eye morphology. (F) Co-expression of human hnRNP A2 suppresses CGG repeat toxicity and partially reverses the rough eye phenotype. (G) Expression of hnRNP A2 alone leads to partial depigmentation but does not alter the eye structure. (H) TBPH RNAi does not prevent hnRNP A2-mediated suppression of CGG repeat toxicity. (I) TBPH RNAi has no effects on hnRNP A2 overexpressing fly eyes in isolation. (J) Eye degeneration scores from .100 flies of the indicated genotypes. ∗ P-value , 0.05 after a Bonferroni correction by the Mann-Whitney U-test, NS indicates no significant differences. Genotypes of fly eyes are (B) GMR-Gal4: UAS-CGG90-GFP/+; (C) GMR-Gal4/+; (D) GMR-Gal4: UAS-CGG90-GFP/UAS-TBPH RNAi; (E) GMR-Gal4/TBPH RNAi; (F) GMR-Gal4: UAS-CGG90-GFP/UAS-hnRNPA2; (G) GMR-Gal4/UAS-hnRNPA2; (H) GMR-Gal4, UAS-CGG90-GFP/+; UAS-TBPH RNAi/UAS-hnRNPA2; (I) GMR-Gal4/+; UAS-TBPH RNAi/UAS-hnRNPA2.


morphology, either in isolation or in the context of CGG90-GFP co-expression [Fig. 7D and E; Supplementary Material, Fig. S4, (16)]. Consistent with published reports (16), overexpression of hnRNP A2 suppressed CGG repeat toxicity (Fig. 7F and J). However, unlike the corollary experiment where hnRNP A2/B1 is required for TDP-43’s effects on CGG repeats, RNAi knockdown of TBPH did not prevent hnRNP A2/B1-mediated suppression of CGG RNA repeat toxicity (Fig. 7H and J). These results suggest that normal amounts of TBPH are not required for hnRNP A2/B1-mediated suppression of CGG repeat-associated toxicity. However, because of lethality associated with loss of TBPH, the effects of the complete absence of TBPH are less clear.

HnRNP A2/B1 binds to its target RNAs and modulates alternative RNA splicing of these targets (55). In Drosophila, the Hrb87F and Hrb98DE splicing targets have been systematically investigated (56). One target shared by both Hrb87F and

Hrb98DE is EPH, which encodes a protein tyrosine kinase receptor important for nervous system development and function (57,58). Exon 8b of the EPH gene is either included or excluded to produce EPH isoforms with or without this exon (Fig. 8A). Both isoforms were present in fly eyes as shown by qualitative RT – PCR using primers common to both isoforms (Fig. 8B), or specific primers for individual isoforms (Fig. 8C). Previously, it was reported that RNAi knockdown of Hrb87F and Hrb98DE in S2 cells can modulate the ratios of such isoforms (56). Using a quantitative RT – PCR-based approach, we determined the relative ratios of this particular splicing event involving inclusion or exclusion of exon 8b. Hrb87F and Hrb98DE act to favour the inclusion of exon 8b from the transcript (Fig. 8A). Consistent with this, RNAi-based knockdown of either Hrb87F or Hrb98DE leads to decreased inclusion of exon 8b compared with control lines (Fig. 8D), similar to published studies in Drosophila S2 cells (56). In contrast, ectopic expression of TDP-43 in isolation had no effect on EPH splicing (Fig. 8D). To test whether CGG repeat expression alone might sequester Hrb87F and Hrb98DE to a significant enough degree to impact their normal

Figure 8. Perturbed alternative splicing of EPH, a Hrb87F- and Hrb98DE-regulated transcript, by CGG repeat expression is reversed by TDP-43. (A) Schematic of EPH gene structure and primers used to detect alternative splice isoforms. (B) Qualitative RT –PCR demonstrates expression of both splicing products in the indicated genotypes indicated by primer set 1 at 28 PCR cycles. (C) Qualitative RT–PCR demonstrates specificity of primer sets 2 and 3 targeting isoforms that include or exclude exon 8b, respectively. (D) Quantitative RT –PCR of EPH splice isoforms using primers 2 and 3, expressed as the ratio of exon 8b inclusion/exclusion for the indicated genotypes. (E) qRT– PCR of EPH splice isoforms demonstrates that TDP-43 corrects the de-regulated EPH alternative splicing in CGG90-GFP expressing flies. (D and E) were significantly different by one-way ANOVA. ∗ P-value , 0.05 by the t-test.


TDP-43 restores alternative splicing of EPH, which is perturbed by CGG repeat expression

5045

5046


function, we assessed EPH splicing in CGG90-GFP expressing flies. CGG90-GFP expression resulted in even greater suppression of Exon 8b inclusion than seen with knockdown of either Hrb87F or Hrb98DE alone, consistent with a significant functional impairment of both proteins (Fig. 8D). If TDP-43 imparts its phenotypic rescue on CGG repeat toxicity through its interactions with hnRNP A2/B1 homologues, then we reasoned its overexpression might correct these splicing phenotypes. Consistent with this reasoning, TDP-43 co-expression leads to a restoration of EPH exon 8b splicing in CGG90-eGFP flies (Fig. 8B and E).

Our data define a novel role for TDP-43 in CGG repeat toxicity in Drosophila. The ability of TDP-43 to suppress CGG RNA-associated phenotypes is dependent on its ability to interact with two Drosophila homologues of hnRNP A2/B1, a protein that itself can directly bind CGG repeat RNA and modulate CGG repeat-associated phenotypes. We further demonstrate that an hnRNP A2/B1 alternative splicing target is dysregulated in CGG expressing flies and that co-expression of TDP-43 corrects this mis-splicing event. Taken together, these findings are consistent with a model, where TDP-43 acts to prevent functional sequestration of hnRNP A2/B1 by CGG repeats and thus alleviate toxicity. Moreover, the two RNA-binding proteins studied here, TDP-43 and hnRNP A2/B1, are both implicated in a wide range of neurodegenerative disorders, including ALS, FTD, and multisystem proteinopathy (22,29,47). This work implicates the normal functions and interactions of these two proteins in RNA repeat disorders, suggesting a convergence of pathogenic cascades in these two classes of neurodegenerative disease. TDP-43 is essential in development in mammals, and homozygous knockouts are lethal in both mice and Drosophila (59,60). RNAi knockdown of TDP-43 in cultured tumour cells and in differentiated neurons causes cell death (61,62), while global knockdown of TBPH is lethal in adult flies, suggesting critical roles for the protein after development (63,64). Indeed, postnatal loss of neuronal TDP-43 function causes neurodegeneration in mice (65,66). In contrast, overexpression of human TDP-43 can itself elicit neurodegeneration, with greater toxicity observed with disease causing mutations in mice (67,68), rats (69,70) and in flies (33,63). In addition, cytoplasmic inclusions of TDP-43 are widely observed in various neurodegenerative disorders including many subtypes of ALS, FTD and other dementias (as reviewed in 22,47). Thus, the finding that TDP-43 overexpression suppresses CGG repeat toxicity is surprising, and suggests that some native functions of TDP-43 in RNA homoeostasis may impinge on critical pathways in FXTAS pathogenesis. Our data do not support a model where CGG repeats directly sequester TDP-43. TDP-43 is not an abundant component of ubiquitin-positive inclusions in FXTAS patient tissue (19), and TDP-43 does not bind to CGG repeat RNA in silico, in vitro or in cell culture (17). Furthermore, when TDP-43 and CGG repeat RNAs are co-expressed in flies, they do not co-localize (Fig. 2). Lastly, neither RNAi-based knockdown of TBPH nor TPBH heterozygous null mutations exacerbate CGG repeatassociated toxicity [Fig. 6 and (16)]. Thus, the suppressive


DISCUSSION

effects of TDP-43 on CGG repeat toxicity appear to reflect a protective gain-of-function rather than a loss of TDP-43 function as is proposed for some other RNA-binding proteins such as hnRNP A2/B1 and Drosha/DGCR8 (16,18). Similarly, the suppressive effects of TDP-43 do not appear to be mediated transcriptionally. Knockdown of TBPH or TDP-43 leads to decreased HDAC6 mRNA levels in human cells and Drosophila (43). We thus initially hypothesized that the effects of TDP-43 on CGG repeat toxicity might be mediated by an enhancement of HDAC6 expression, as HDAC6 suppresses transcription of CGG repeat-containing mRNAs (42). However, in our experimental system, overexpression of TDP-43 did not impact either CGG90-EGFP mRNA levels or HDAC6 mRNA levels in flies expressing CGG repeats. The lack of effect on HDAC6 mRNA levels with TDP-43 overexpression may reflect differences in an experimental design with previous studies, which utilized TBPH knockdown or heterozygous null fly lines. Alternatively, the presence of the CGG repeat mRNA in these flies might interfere with this process. HnRNP A2/B1 is a member of a larger group of heterogeneous nuclear RNA-binding proteins that modulate RNA transcription, splicing and transport (71). It interacts with both normal length (30 repeat) and pathogenic length (90 repeat) CGG repeat RNA (16). Given that knocking down expression of either hnRNP A2/B1 homologue prevents TDP-43-mediated suppression of CGG repeat toxicity, it appears likely that hnRNP A2/B1 acts as a mediator for TDP-43’s protective roles. This is reminiscent of findings related to another RNA-binding protein, CUGBP1/CELF1. CELF1 does not bind CGG repeat RNA directly, yet it suppresses CGG repeat-mediated toxicity in Drosophila. (16). As with TDP-43, CELF1 suppression of CGG repeat toxicity requires adequate expression of Drosophila hnRNP A2/B1 homologues (16). Taken together, we propose that co-expression of RNA-binding proteins such as CELF1 and TDP-43 with CGG repeats alters the composition, behaviour and distribution of multimeric RNAbinding protein complexes within cells. These alterations somehow prevent sequestration of hnRNP A2/B1 by CGG repeats, allowing it to perform its normal functions. Consistent with this model, TDP-43 expression corrects a CGG repeattriggered hnRNP A2-mediated mis-splicing event. In this context, the finding that co-expression of ALS mutant forms of TDP-43 either exacerbate or fail to rescue CGG repeat toxicity (Fig. 5) is particularly interesting. These TDP-43 mutants can still bind to hnRNP A2 in vitro (46), but their dynamics in RNA protein complexes may be altered based on studies of stress granule dynamics in transfected cells (40). TDP-43 and hnRNP A2/B1’s roles in CGG toxicity raise interesting questions related to the relevance of these findings to other repeat disorders, most notably the intronic GGGGCC repeat implicated in FTD and ALS. The primary sequences of CGG and CCGGGG repeats are highly similar, with shared predicted secondary structures and a mutual tendency to form G-quadruplexes (72,73). HnRNP A2/B1 and its paralogue hnRNP A1 are capable of interacting with GGGGCC repeats (74,75). Given the TDP-43-positive cytoplasmic inclusions observed in C9 FTD/ALS, it will be important to evaluate whether similar genetic interactions in these proteins might alter GGGGCC repeat toxicity in model systems.


MATERIALS AND METHODS Drosophila stocks and genetics

Human fibroblast cell lines Nine fibroblast cell lines were obtained from Dr Paul Hagerman and colleagues (University of California at Davis). The clinical state of these patients has been described previously (45). All cell lines were from male subjects. Nomenclature used follows that used in the publication where these lines were first published (45). Briefly, there are three control lines: C1 (CGG31), C4 (CGG22) and C5 (CGG30), Six cell lines from CGG expanded lines :P3 (CGG81), P4 (CGG70), P5 (CGG67), F1 (CGG122), F2 (CGG105) and F3 (CGG97). Fibroblasts were cultured and maintained as previously described (45) and repeat size was confirmed by PCR for all lines using C and F primers (42). Eye phenotype examination and scoring Eye morphology of 1 – 3 day post-eclosion flies was quantitatively scored as previously described (77). Briefly, over 100 eyes from each genotype were scored based on the following criteria: supernumerary inter-ommatidial bristles, abnormal bristle orientation, ommatidium fusion, ommatidium pitting, disorganization of ommatidial array, retinal collapse. The presence of

each feature is given 1 point, and additional 2 points were given if .5% of the eyes were affected, or 4 points if .50% of eyes were affected. Higher score means the eyes are more degenerated. The scores were calculated and presented as means + SEM and non-parametric analysis (Mann –Whitney U-test) was applied to determine the statistical differences between groups. The representative fly eye images were taken by Leica M125 stereomicroscope and photographed with a Leica DFC425 digital camera as previously described (44). RNA isolation and qRT – PCR Total RNA was extracted from 12– 15 fly heads of each genotype using Trizol (Life Technologies) and quantitated by nano-drop. Total RNA from fibroblast cells was extracted by lysis in Trizol buffer following manufacturer’s manual; 1 mg of total RNAs was then reverse-transcribed to cDNA by iScript cDNA synthesis kit (Bio-Rad). The primer sets used in the quantitative PCR step for the individual genes were as follows: GFP FORWARD: 5′ -TCTTCTTCAAGGACGACGGCAAC TAC-3′ GFP REVERSE: 5′ -GTACTCCAGCTTGTGCCCCAGGATGT-3′ HDAC6 FORWARD: 5′ -CTGACGGAGCGCTGCCTG-3′ HDAC6 REVERSE: 5′ -GCAGGGAGAGCTCGAATGTGG-3′ HRB87F FORWARD: 5′ -GGCCACCACCTCCGGTGTTG-3′ HRB87F REVERSE: 5′ -CCAGCAGAGCTACGGCGGC-3′ HRB98DE FORWARD: 5′ -CGGCAACCAGAATGGTGGC GG-3′ HRB98DE REVERSE: 5′ -CCACCACCGAAGCTGTTGTTG CC-3′ TBPH FORWARD: 5′ -GCAGCGCAGACGGGTCTCG-3′ TBPH REVERSE: 5′ -GTCCGGCTGGGGCGAGTAC-3′ EPH SET 1 FORWARD: 5′ - GCCATTACCACTTGACTAC GCCAGC-3′ EPH SET 1 REVERSE: 5′ - CTCGAGCGAATTCCCTTATAG CTTGATTAGG-3′ EPH SET 2 FORWARD: 5′ -AGCAACGAAGTTAATTCTA TGGATACTACTCC-3′ EPH SET 3 FORWARD: 5′ -AGCAACGAAGTGACGAC GCC-3′ EPH SET 2 and 3 REVERSE: 5′ -CACATCAATGTCCTGTA CAAAGTTTGGGGG-3′ RPL32 FORWARD: 5′ -GTTGTGCACCAGGAACTTCTTGA ATCCG-3′ RPL32 REVERSE: 5′ -CTTCCAGCTTCAAGATGACCATCC GC-3′ TDP-43 FORWARD: 5′ -TGTCTTCATCCCCAAGCCATT CAGG-3′ TDP-43 REVERSE: 5′ -CCAAATCCACCCTGATTCCCAA AGC-3′ b-ACTIN FORWARD: 5′ -GGCATCCTCACCCTGAAGTA-3′ b-ACTIN REVERSE: 5′ -AGAGGCGTACAGGGATAGCA-3′ PCR analysis was performed using the iQ SYBR Green Supermix in a myIQ Single Color RTPCR system (Bio-Rad). All runs included a standard dilution curve representing 10× to 0.01× of the RNA concentration utilized for all primer sets to insure linearity. Equivalent efficiency of individual primer sets was confirmed prior to data analysis. The levels of individual mRNAs were normalized to those of RPL32 mRNA for each sample


All flies were maintained with standard food and culture conditions at 258C unless otherwise stated. Fly lines from the Bloomington Stock Center are: GMR-Gal4 (#8605), TBPHKG08578 insertion mutation line (#14737), RNAi lines against TBPH (#29517), against Hrb87F (#31244) and Hrb98DE (#31303), UAS-GFP (multiple lines). GMR-Gal4: UAS-(CGG)90-eGFP (CGG90GFP) recombinant line was a kind gift from Peng Jin (10). UAS-myc-TDP-43-WT, UAS-TDP-43-DNES, UAS-TDP-DNLS, UAS-Myc-M337V were described (33), UAS-myc-hnRNP A2 was made as in Kim et al. (29). UAS-FUS fly line was a kind gift from Udai Pandey (34). N-terminally myc-tagged TDP-43 G294A was cloned into the pUAST vector (the starting methionine of TDP-43 was removed to avoid dual start site activity) and injected commercially (Bestgene, Chino Hills, CA, USA). The UAS-TDP-43-WT-HA, UAS-TDP-43-FFLL-HA, UASTDP-43-D321 – 366-HA, UAS-TDP-43-Q331K-HA transgenic flies were made as follows: the initial plasmids pFLAG-TDP43-WT, pFLAG-TDP-43-D321 – 366 and pFLAG-TDP-43Q331K were from Buratti and Baralle (46), and TDP-43-FFLL from Voigt (50). TDP-43 cDNA fragments from these vectors were PCR amplified out (TDP-43 forward 5′ -CACCATGTCT GAATATATTCGGGTAACCGAAG-3′ , and TDP-43 reverse 5′ -CATTCCCCAGCCAGAAGACTTAG-3′ ) and then were cloned to pEntry-TOPO vector (Life Technologies). Individual pEntr-TDP-43 vectors were recombined with Gateway Plasmid pTWH (Drosophila Genomic Resource Center). The resulting plasmids were used to generate transgenic flies by standard P-element insertion with the exception of TDP-43 Q331K, which was recombined to plasmid pUASg-HA-AttB (76) and injected into AttP line 9723 (Bestgene, Chino Hills, CA, USA). Transgenic lines were crossed to GMR-Gal4 to test TDP-43 mRNA expression level. Those lines with TDP-43 mRNA levels that were closest to UAS-myc-TDP-43 were selected for further crosses.

5047

5048


run and expressed as a ratio of levels of GMR-Gal4 driver lines (fold control expression) unless otherwise stated. For human fibroblast lines, TDP-43 level was normalized to b-actin mRNA. All samples were run in triplicate and all data represent at least three independent experiments. Western blotting

In situ hybridization, immunofluorescence and confocal microscopy About 30 1 – 3 day post-eclosion fly heads from each genotype were isolated, immediately frozen in OCT media, and then cryosectioned to 10 mm. Transverse sections were then fixed with 4% paraformaldehyde in 1× PBS for 15 min, washed 3× in PBS, and permeabilized with 0.1% triton × 100 in PBS for 5 min. In situ hybridization was performed as in Mankodi et al. (78) with minor modifications. Sections were pre-hybridized with 30% formamide in 2× SSC diluted with PBS for 30 min at room temperature and then hybridized with 500 ml probe solution in a light proof box for 2 h in 378C. The probe solution is as follows: 1 ng/ml Cy5 labelled 2′ -O-Me-(CCG)6 probe, 0.02% BSA, 66 mg/ml yeast RNA (Sigma), 2 ml RNAse inhibitor (Sigma), 30% formamide in PBS-diluted 2× SSC. After hybridization, slides was washed with 1× SSC for 30 min and incubated with mouse-anti-myc primary antibody 9E10 (Sigma) diluted in 5% normal goat serum (Vector labs) in 1× PBS at 48C overnight. Slides were then washed with PBS and

Human sample immunohistochemistry Clinical autopsy tissue from FXTAS and control patients was from previously described cases (44,79). Paraffin embedded sections through regions with known significant ubiquitin inclusion burden and matching regions in control brains were processed in parallel without antigen retrieval. Rabbit polyclonal TDP-43 (ProteinTech Group, 1 : 1000) was used as the primary antibody. Statistics Eye phenotypes were scored on an integer (i.e. non-continuous) scale. Therefore, non-parametric statistical tests were used for all comparisons of eye phenotype. When multiple comparisons were performed, a Kruskal – Wallis one-way ANOVA was first used, followed by the Mann – Whitney U-test comparisons with a Bonferroni correction. For other statistics, standard parametric measures were used, with Student’s t-test for single comparisons or a one-way ANOVA with post hoc Student’s t-test for multiple comparisons. All error bars are standard error of the mean.

SUPPLEMENTARY MATERIAL Supplementary Material is available at HMG online.

ACKNOWLEDGEMENTS The authors thank Peng Jin for providing (CGG)90-GFP fly lines, Udai Pandey for providing FUS fly lines. TDP-43 wt and TDP-43-D321 – 366 TDP-43 constructs were a kind gift from Francisco Baralle and Emanuele Buratti. TDP-43-FFLL constructs were a kind gift from Aaron Voigt and Jorg B. Schulz. UASg-HA-AttB plasmid was a gift from Johannes Bischof and


Western blotting for GFP and tubulin were performed as previously described (44). Twenty-five fly heads with each genotype from 0 to 3 day post-eclosion flies were cut, isolated and then homogenized in RIPA buffer with protease inhibitors (Roche), and passed three times through a 27-gauge needle to shear DNA. Homogenates were then centrifuged at 13 000g for 15 min. Supernatant was collected as protein lysate and quantitated with the BCA assay (Bio-Rad); 25 mg of protein lysate for each genotype was resolved with 12% SDS –PAGE, transferred to PVDF membrane, and incubated with the following antibodies: monoclonal mouse-anti-tubulin (DHSB E7, 1:5000), monoclonal mouse-anti-GFP (Roche 7.1 and 13.1, 1 : 1000). Blots then were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch) and then detected by the standard film. At least three independent experiments were performed. FMRpolyG-GFP and GFP proteins were quantitated by the ImageJ software and were normalized to tubulin level in the same sample. Western blotting of TDP-43 and b-actin were performed as follows: 1 × 107 fibroblast cells at confluency were directly lysed in Laemmli buffer containing 2% 2-mercaptoethanol, and equal amount of cell lysate from each cell line were boiled for 5 min at 958C and resolved with 12% SDS – PAGE, transferred to PVDF membrane and incubated with the following antibodies: rabbit polyclonal anti-TDP-43 (Proteintech Group, Chicago, IL, USA; 1 : 1500), mouse monoclonal anti-b-actin (Sigma, 1 : 10 000). Blots then were incubated with HRP-conjugated secondary antibodies (Jackson ImmunoResearch) and then detected by the standard film. At least three independent experiments were done and quantitation of TDP-43 was performed by the ImageJ software and normalized to level of b-actin from the same sample.

incubated with Alexa 568 goat anti-mouse secondary antibody (in 5% normal goat serum in PBS) for 30 min at room temperature. After further washes, samples were dried for 5 min, incubated with 100 ml prolong gold with DAPI for 1 h, and examined on an Olympus FV1000 confocal microscope with identical laser settings for each slide. Images were overlaid in the ImageJ software. RNA foci were quantified as follows: a 50 × 50 mm regions of interest (ROI) within fly retina were randomly selected from slides, .20 ROI were counted for each genotype, and total numbers of RNA foci were counted and quantitated as foci number per mm2. RNA foci overlapping with 30% of a DAPI-stained nucleus were considered as nuclear-associated RNA foci, and the percentile of nuclear-associated foci over total foci were calculated from the same ROI as for the total RNA foci counting. For flies expressing both CGG90-GFP and TDP-43, RNA foci overlapped with TDP-43 staining were also quantitated as to the percentile of total RNA foci. GFP aggregates from the sample prepared above were examined directly using an Olympus FV1000 confocal microscope. No GFP antibody was utilized. 50 × 50 mm ROI within fly retina were selected on each slide, and the number of GFP aggregates was counted. A total of 20 ROI for each genotype were counted and quantitated as GFP aggregates per mm2.


Konrad Basler. Human FXTAS tissue was a kind gift from Elan Louis and control tissue was obtained from the University of Michigan Brain Bank. Fibroblast cell lines were obtained as a kind gift from Dr Paul Hagerman and colleagues (University of California at Davis). We thank Michelle Frazer for technical assistance and Henry Paulson for feedback on the manuscript.

16.

17.

Conflict of Interest statement. None declared. 18.

FUNDING 19.

REFERENCES

21.

1. Jacquemont, S., Hagerman, R.J., Leehey, M.A., Hall, D.A., Levine, R.A., Brunberg, J.A., Zhang, L., Jardini, T., Gane, L.W., Harris, S.W. et al. (2004) Penetrance of the fragile X-associated tremor/ataxia syndrome in a premutation carrier population. JAMA, 291, 460– 469. 2. Hagerman, R.J., Leehey, M., Heinrichs, W., Tassone, F., Wilson, R., Hills, J., Grigsby, J., Gage, B. and Hagerman, P.J. (2001) Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X. Neurology, 57, 127 –130. 3. Pieretti, M., Zhang, F.P., Fu, Y.H., Warren, S.T., Oostra, B.A., Caskey, C.T. and Nelson, D.L. (1991) Absence of expression of the FMR-1 gene in fragile X syndrome. Cell, 66, 817– 822. 4. Verkerk, A.J., Pieretti, M., Sutcliffe, J.S., Fu, Y.H., Kuhl, D.P., Pizzuti, A., Reiner, O., Richards, S., Victoria, M.F., Zhang, F.P. et al. (1991) Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell, 65, 905 –914. 5. Tassone, F., Hagerman, R.J., Taylor, A.K., Gane, L.W., Godfrey, T.E. and Hagerman, P.J. (2000) Elevated levels of FMR1 mRNA in carrier males: a new mechanism of involvement in the fragile-X syndrome. Am. J. Hum. Genet., 66, 6– 15. 6. Kenneson, A., Zhang, F., Hagedorn, C.H. and Warren, S.T. (2001) Reduced FMRP and increased FMR1 transcription is proportionally associated with CGG repeat number in intermediate-length and premutation carriers. Hum. Mol. Genet., 10, 1449–1454. 7. Tassone, F., Iwahashi, C. and Hagerman, P.J. (2004) FMR1 RNA within the intranuclear inclusions of fragile X-associated tremor/ataxia syndrome (FXTAS). RNA Biol., 1, 103–105. 8. Hagerman, P. (2013) Fragile X-associated tremor/ataxia syndrome (FXTAS): pathology and mechanisms. Acta Neuropathol., 126, 1–19. 9. Renoux, A.J. and Todd, P.K. (2012) Neurodegeneration the RNA way. Prog. Neurobiol., 97, 173– 189. 10. Jin, P., Zarnescu, D.C., Zhang, F., Pearson, C.E., Lucchesi, J.C., Moses, K. and Warren, S.T. (2003) RNA-mediated neurodegeneration caused by the fragile X premutation rCGG repeats in Drosophila. Neuron, 39, 739–747. 11. Lee, J.E. and Cooper, T.A. (2009) Pathogenic mechanisms of myotonic dystrophy. Biochem. Soc. Trans., 37, 1281–1286. 12. Kanadia, R.N., Johnstone, K.A., Mankodi, A., Lungu, C., Thornton, C.A., Esson, D., Timmers, A.M., Hauswirth, W.W. and Swanson, M.S. (2003) A muscleblind knockout model for myotonic dystrophy. Science, 302, 1978– 1980. 13. Kanadia, R.N., Shin, J., Yuan, Y., Beattie, S.G., Wheeler, T.M., Thornton, C.A. and Swanson, M.S. (2006) Reversal of RNA missplicing and myotonia after muscleblind overexpression in a mouse poly(CUG) model for myotonic dystrophy. Proc. Natl Acad. Sci. USA, 103, 11748– 11753. 14. Charizanis, K., Lee, K.Y., Batra, R., Goodwin, M., Zhang, C., Yuan, Y., Shiue, L., Cline, M., Scotti, M.M., Xia, G. et al. (2012) Muscleblind-like 2-mediated alternative splicing in the developing brain and dysregulation in myotonic dystrophy. Neuron, 75, 437–450. 15. Jin, P., Duan, R., Qurashi, A., Qin, Y., Tian, D., Rosser, T.C., Liu, H., Feng, Y. and Warren, S.T. (2007) Pur alpha binds to rCGG repeats and modulates

20.

22. 23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

repeat-mediated neurodegeneration in a Drosophila model of fragile X tremor/ataxia syndrome. Neuron, 55, 556– 564. Sofola, O.A., Jin, P., Qin, Y., Duan, R., Liu, H., de Haro, M., Nelson, D.L. and Botas, J. (2007) RNA-binding proteins hnRNP A2/B1 and CUGBP1 suppress fragile X CGG premutation repeat-induced neurodegeneration in a Drosophila model of FXTAS. Neuron, 55, 565–571. Sellier, C., Rau, F., Liu, Y., Tassone, F., Hukema, R.K., Gattoni, R., Schneider, A., Richard, S., Willemsen, R., Elliott, D.J. et al. (2010) Sam68 sequestration and partial loss of function are associated with splicing alterations in FXTAS patients. EMBO J., 29, 1248–1261. Sellier, C., Freyermuth, F., Tabet, R., Tran, T., He, F., Ruffenach, F., Alunni, V., Moine, H., Thibault, C., Page, A. et al. (2013) Sequestration of DROSHA and DGCR8 by expanded CGG RNA repeats alters microRNA processing in fragile X-associated tremor/ataxia syndrome. Cell Reports, 3, 869–880. Iwahashi, C.K., Yasui, D.H., An, H.J., Greco, C.M., Tassone, F., Nannen, K., Babineau, B., Lebrilla, C.B., Hagerman, R.J. and Hagerman, P.J. (2006) Protein composition of the intranuclear inclusions of FXTAS. Brain, 129, 256– 271. Muslimov, I.A., Patel, M.V., Rose, A. and Tiedge, H. (2011) Spatial code recognition in neuronal RNA targeting: role of RNA-hnRNP A2 interactions. J. Cell Biol., 194, 441–457. Tan, H., Qurashi, A., Poidevin, M., Nelson, D.L., Li, H. and Jin, P. (2012) Retrotransposon activation contributes to fragile X premutation rCGG-mediated neurodegeneration. Hum. Mol. Genet., 21, 57– 65. Ramaswami, M., Taylor, J.P. and Parker, R. (2013) Altered ribostasis: RNA-protein granules in degenerative disorders. Cell, 154, 727–736. Neumann, M., Sampathu, D.M., Kwong, L.K., Truax, A.C., Micsenyi, M.C., Chou, T.T., Bruce, J., Schuck, T., Grossman, M., Clark, C.M. et al. (2006) Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science, 314, 130–133. Sreedharan, J., Blair, I.P., Tripathi, V.B., Hu, X., Vance, C., Rogelj, B., Ackerley, S., Durnall, J.C., Williams, K.L., Buratti, E. et al. (2008) TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis. Science, 319, 1668– 1672. Vance, C., Rogelj, B., Hortobagyi, T., De Vos, K.J., Nishimura, A.L., Sreedharan, J., Hu, X., Smith, B., Ruddy, D., Wright, P. et al. (2009) Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6. Science, 323, 1208– 1211. Kabashi, E., Valdmanis, P.N., Dion, P., Spiegelman, D., McConkey, B.J., Vande Velde, C., Bouchard, J.P., Lacomblez, L., Pochigaeva, K., Salachas, F. et al. (2008) TARDBP mutations in individuals with sporadic and familial amyotrophic lateral sclerosis. Nat. Genet., 40, 572 –574. Kwiatkowski, T.J. Jr, Bosco, D.A., Leclerc, A.L., Tamrazian, E., Vanderburg, C.R., Russ, C., Davis, A., Gilchrist, J., Kasarskis, E.J., Munsat, T. et al. (2009) Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis. Science, 323, 1205– 1208. Couthouis, J., Hart, M.P., Shorter, J., DeJesus-Hernandez, M., Erion, R., Oristano, R., Liu, A.X., Ramos, D., Jethava, N., Hosangadi, D. et al. (2011) A yeast functional screen predicts new candidate ALS disease genes. Proc. Natl Acad. Sci. USA, 108, 20881– 20890. Kim, H.J., Kim, N.C., Wang, Y.D., Scarborough, E.A., Moore, J., Diaz, Z., MacLea, K.S., Freibaum, B., Li, S., Molliex, A. et al. (2013) Mutations in prion-like domains in hnRNPA2B1 and hnRNPA1 cause multisystem proteinopathy and ALS. Nature, 495, 467– 473. DeJesus-Hernandez, M., Mackenzie, I.R., Boeve, B.F., Boxer, A.L., Baker, M., Rutherford, N.J., Nicholson, A.M., Finch, N.A., Flynn, H., Adamson, J. et al. (2011) Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS. Neuron, 72, 245–256. Renton, A.E., Majounie, E., Waite, A., Simon-Sanchez, J., Rollinson, S., Gibbs, J.R., Schymick, J.C., Laaksovirta, H., van Swieten, J.C., Myllykangas, L. et al. (2011) A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron, 72, 257– 268. Almeida, S., Gascon, E., Tran, H., Chou, H.J., Gendron, T.F., Degroot, S., Tapper, A.R., Sellier, C., Charlet-Berguerand, N., Karydas, A. et al. (2013) Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons. Acta Neuropathol, 126, 385–399. Ritson, G.P., Custer, S.K., Freibaum, B.D., Guinto, J.B., Geffel, D., Moore, J., Tang, W., Winton, M.J., Neumann, M., Trojanowski, J.Q. et al. (2010) TDP-43 mediates degeneration in a novel Drosophila model of disease caused by mutations in VCP/p97. J. Neurosci., 30, 7729 – 7739.


This work was funded by the Veterans Administration (VAMC/ BLRD I21BX001841), the Nathan Shock Center (P30AG13283) and the NIH (R01NS086810 and K08NS069809) to P.K.T. F.H. was supported by a NAF postdoctoral fellowship.

5049

5050


53. Freibaum, B.D., Chitta, R.K., High, A.A. and Taylor, J.P. (2010) Global analysis of TDP-43 interacting proteins reveals strong association with RNA splicing and translation machinery. J. Proteome Res, 9, 1104–1120. 54. Buratti, E., Brindisi, A., Giombi, M., Tisminetzky, S., Ayala, Y.M. and Baralle, F.E. (2005) TDP-43 binds heterogeneous nuclear ribonucleoprotein A/B through its C-terminal tail: an important region for the inhibition of cystic fibrosis transmembrane conductance regulator exon 9 splicing. J. Biol. Chem., 280, 37572– 37584. 55. Huelga, S.C., Vu, A.Q., Arnold, J.D., Liang, T.Y., Liu, P.P., Yan, B.Y., Donohue, J.P., Shiue, L., Hoon, S., Brenner, S. et al. (2012) Integrative genome-wide analysis reveals cooperative regulation of alternative splicing by hnRNP proteins. Cell Reports, 1, 167– 178. 56. Blanchette, M., Green, R.E., MacArthur, S., Brooks, A.N., Brenner, S.E., Eisen, M.B. and Rio, D.C. (2009) Genome-wide analysis of alternative pre-mRNA splicing and RNA-binding specificities of the Drosophila hnRNP A/B family members. Mol. Cell, 33, 438– 449. 57. Boyle, M., Nighorn, A. and Thomas, J.B. (2006) Drosophila Eph receptor guides specific axon branches of mushroom body neurons. Development, 133, 1845–1854. 58. Scully, A.L., McKeown, M. and Thomas, J.B. (1999) Isolation and characterization of Dek, a Drosophila eph receptor protein tyrosine kinase. Mol. Cel. Neurosci., 13, 337–347. 59. Wu, L.S., Cheng, W.C., Hou, S.C., Yan, Y.T., Jiang, S.T. and Shen, C.K. (2010) TDP-43, a neuro-pathosignature factor, is essential for early mouse embryogenesis. Genesis, 48, 56–62. 60. Sephton, C.F., Good, S.K., Atkin, S., Dewey, C.M., Mayer, P. III, Herz, J. and Yu, G. (2010) TDP-43 is a developmentally regulated protein essential for early embryonic development. J. Biol. Chem., 285, 6826– 6834. 61. Ayala, Y.M., Misteli, T. and Baralle, F.E. (2008) TDP-43 regulates retinoblastoma protein phosphorylation through the repression of cyclin-dependent kinase 6 expression. Proc. Natl Acad. Sci. USA, 105, 3785– 3789. 62. Iguchi, Y., Katsuno, M., Niwa, J., Yamada, S., Sone, J., Waza, M., Adachi, H., Tanaka, F., Nagata, K., Arimura, N. et al. (2009) TDP-43 depletion induces neuronal cell damage through dysregulation of Rho family GTPases. J. Biol. Chem., 284, 22059– 22066. 63. Lu, Y., Ferris, J. and Gao, F.B. (2009) Frontotemporal dementia and amyotrophic lateral sclerosis-associated disease protein TDP-43 promotes dendritic branching. Mol. Brain, 2, 30. 64. Estes, P.S., Boehringer, A., Zwick, R., Tang, J.E., Grigsby, B. and Zarnescu, D.C. (2011) Wild-type and A315 T mutant TDP-43 exert differential neurotoxicity in a Drosophila model of ALS. Hum. Mol. Genet., 20, 2308– 2321. 65. Vanden Broeck, L., Naval-Sanchez, M., Adachi, Y., Diaper, D., Dourlen, P., Chapuis, J., Kleinberger, G., Gistelinck, M., Van Broeckhoven, C., Lambert, J.C. et al. (2013) TDP-43 loss-of-function causes neuronal loss due to defective steroid receptor-mediated gene program switching in Drosophila. Cell Reports, 3, 160–172. 66. Iguchi, Y., Katsuno, M., Niwa, J., Takagi, S., Ishigaki, S., Ikenaka, K., Kawai, K., Watanabe, H., Yamanaka, K., Takahashi, R. et al. (2013) Loss of TDP-43 causes age-dependent progressive motor neuron degeneration. Brain, 136, 1371– 1382. 67. Li, Y., Ray, P., Rao, E.J., Shi, C., Guo, W., Chen, X., Woodruff, E.A. 3rd, Fushimi, K. and Wu, J.Y. (2010) A Drosophila model for TDP-43 proteinopathy. Proc. Natl Acad. Sci. USA, 107, 3169– 3174. 68. Hanson, K.A., Kim, S.H., Wassarman, D.A. and Tibbetts, R.S. (2010) Ubiquilin modifies TDP-43 toxicity in a Drosophila model of amyotrophic lateral sclerosis (ALS). J. Biol. Chem., 285, 11068– 11072. 69. Tatom, J.B., Wang, D.B., Dayton, R.D., Skalli, O., Hutton, M.L., Dickson, D.W. and Klein, R.L. (2009) Mimicking aspects of frontotemporal lobar degeneration and Lou Gehrig’s disease in rats via TDP-43 overexpression. Mol. Ther., 17, 607–613. 70. Wils, H., Kleinberger, G., Janssens, J., Pereson, S., Joris, G., Cuijt, I., Smits, V., Ceuterick-de Groote, C., Van Broeckhoven, C. and Kumar-Singh, S. (2010) TDP-43 transgenic mice develop spastic paralysis and neuronal inclusions characteristic of ALS and frontotemporal lobar degeneration. Proc. Natl Acad. Sci. USA, 107, 3858–3863. 71. He, Y. and Smith, R. (2009) Nuclear functions of heterogeneous nuclear ribonucleoproteins A/B. Cell. Mol. Life Sci. CMLS, 66, 1239– 1256. 72. Fratta, P., Mizielinska, S., Nicoll, A.J., Zloh, M., Fisher, E.M., Parkinson, G. and Isaacs, A.M. (2012) C9orf72 hexanucleotide repeat associated with amyotrophic lateral sclerosis and frontotemporal dementia forms RNA G-quadruplexes. Sci. Reports, 2, 1016.


34. Lanson, N.A. Jr, Maltare, A., King, H., Smith, R., Kim, J.H., Taylor, J.P., Lloyd, T.E. and Pandey, U.B. (2011) A Drosophila model of FUS-related neurodegeneration reveals genetic interaction between FUS and TDP-43. Hum. Mol. Genet., 20, 2510– 2523. 35. Ou, S.H., Wu, F., Harrich, D., Garcia-Martinez, L.F. and Gaynor, R.B. (1995) Cloning and characterization of a novel cellular protein, TDP-43, that binds to human immunodeficiency virus type 1 TAR DNA sequence motifs. J. Virol., 69, 3584– 3596. 36. Kim, S.H., Shanware, N.P., Bowler, M.J. and Tibbetts, R.S. (2010) Amyotrophic lateral sclerosis-associated proteins TDP-43 and FUS/TLS function in a common biochemical complex to co-regulate HDAC6 mRNA. J. Biol. Chem., 285, 34097–34105. 37. Tollervey, J.R., Curk, T., Rogelj, B., Briese, M., Cereda, M., Kayikci, M., Konig, J., Hortobagyi, T., Nishimura, A.L., Zupunski, V. et al. (2011) Characterizing the RNA targets and position-dependent splicing regulation by TDP-43. Nat. Neurosci., 14, 452– 458. 38. Polymenidou, M., Lagier-Tourenne, C., Hutt, K.R., Huelga, S.C., Moran, J., Liang, T.Y., Ling, S.C., Sun, E., Wancewicz, E., Mazur, C. et al. (2011) Long pre-mRNA depletion and RNA missplicing contribute to neuronal vulnerability from loss of TDP-43. Nat. Neurosci., 14, 459– 468. 39. Liu-Yesucevitz, L., Bilgutay, A., Zhang, Y.J., Vanderweyde, T., Citro, A., Mehta, T., Zaarur, N., McKee, A., Bowser, R., Sherman, M. et al. (2010) Tar DNA binding protein-43 (TDP-43) associates with stress granules: analysis of cultured cells and pathological brain tissue. PLoS One, 5, e13250. 40. McDonald, K.K., Aulas, A., Destroismaisons, L., Pickles, S., Beleac, E., Camu, W., Rouleau, G.A. and Vande Velde, C. (2011) TAR DNA-binding protein 43 (TDP-43) regulates stress granule dynamics via differential regulation of G3BP and TIA-1. Hum. Mol. Genet., 20, 1400– 1410. 41. Pesiridis, G.S., Tripathy, K., Tanik, S., Trojanowski, J.Q. and Lee, V.M. (2011) A ‘two-hit’ hypothesis for inclusion formation by carboxyl-terminal fragments of TDP-43 protein linked to RNA depletion and impaired microtubule-dependent transport. J. Biol. Chem., 286, 18845–18855. 42. Todd, P.K., Oh, S.Y., Krans, A., Pandey, U.B., Di Prospero, N.A., Min, K.T., Taylor, J.P. and Paulson, H.L. (2010) Histone deacetylases suppress CGG repeat-induced neurodegeneration via transcriptional silencing in models of fragile X tremor ataxia syndrome. PLoS Genet., 6, e1001240. 43. Fiesel, F.C., Voigt, A., Weber, S.S., Van den Haute, C., Waldenmaier, A., Gorner, K., Walter, M., Anderson, M.L., Kern, J.V., Rasse, T.M. et al. (2010) Knockdown of transactive response DNA-binding protein (TDP-43) downregulates histone deacetylase 6. EMBO J., 29, 209 –221. 44. Todd, P.K., Oh, S.Y., Krans, A., He, F., Sellier, C., Frazer, M., Renoux, A.J., Chen, K.C., Scaglione, K.M., Basrur, V. et al. (2013) CGG repeat-associated translation mediates neurodegeneration in fragile X tremor ataxia syndrome. Neuron, 78, 440–455. 45. Garcia-Arocena, D., Yang, J.E., Brouwer, J.R., Tassone, F., Iwahashi, C., Berry-Kravis, E.M., Goetz, C.G., Sumis, A.M., Zhou, L., Nguyen, D.V. et al. (2010) Fibroblast phenotype in male carriers of FMR1 premutation alleles. Hum. Mol. Genet., 19, 299– 312. 46. D’Ambrogio, A., Buratti, E., Stuani, C., Guarnaccia, C., Romano, M., Ayala, Y.M. and Baralle, F.E. (2009) Functional mapping of the interaction between TDP-43 and hnRNP A2 in vivo. Nucleic. Acids Res., 37, 4116– 4126. 47. Lagier-Tourenne, C., Polymenidou, M. and Cleveland, D.W. (2010) TDP-43 and FUS/TLS: emerging roles in RNA processing and neurodegeneration. Hum. Mol. Genet., 19, R46–R64. 48. Han, T.W., Kato, M., Xie, S., Wu, L.C., Mirzaei, H., Pei, J., Chen, M., Xie, Y., Allen, J., Xiao, G. et al. (2012) Cell-free formation of RNA granules: bound RNAs identify features and components of cellular assemblies. Cell, 149, 768–779. 49. Buratti, E. and Baralle, F.E. (2001) Characterization and functional implications of the RNA binding properties of nuclear factor TDP-43, a novel splicing regulator of CFTR exon 9. J. Biol. Chem., 276, 36337–36343. 50. Voigt, A., Herholz, D., Fiesel, F.C., Kaur, K., Muller, D., Karsten, P., Weber, S.S., Kahle, P.J., Marquardt, T. and Schulz, J.B. (2010) TDP-43-mediated neuron loss in vivo requires RNA-binding activity. PLoS One, 5, e12247. 51. Johnson, B.S., Snead, D., Lee, J.J., McCaffery, J.M., Shorter, J. and Gitler, A.D. (2009) TDP-43 is intrinsically aggregation-prone, and amyotrophic lateral sclerosis-linked mutations accelerate aggregation and increase toxicity. J. Biol. Chem., 284, 20329– 20339. 52. Romano, M., Feiguin, F. and Buratti, E. (2012) Drosophila Answers to TDP-43 Proteinopathies. J. Amino Acids, 2012, 356081.


73. Reddy, K., Zamiri, B., Stanley, S.Y., Macgregor, R.B. Jr and Pearson, C.E. (2013) The disease-associated r(GGGGCC)n repeat from the C9orf72 gene forms tract length-dependent uni- and multimolecular RNA G-quadruplex structures. J. Biol. Chem., 288, 9860–9866. 74. Mori, K., Lammich, S., Mackenzie, I.R., Forne, I., Zilow, S., Kretzschmar, H., Edbauer, D., Janssens, J., Kleinberger, G., Cruts, M. et al. (2013) hnRNP A3 binds to GGGGCC repeats and is a constituent of p62-positive/ TDP43-negative inclusions in the hippocampus of patients with C9orf72 mutations. Acta Neuropathol., 125, 413 –423. 75. Sareen, D., O’Rourke, J.G., Meera, P., Muhammad, A.K., Grant, S., Simpkinson, M., Bell, S., Carmona, S., Ornelas, L., Sahabian, A. et al. (2013) Targeting RNA foci in iPSC-derived motor neurons from ALS patients with a C9ORF72 repeat expansion. Sci. Trans. Med., 5, 208ra149. 76. Bischof, J., Maeda, R.K., Hediger, M., Karch, F. and Basler, K. (2007) An optimized transgenesis system for Drosophila using germ-

5051

line-specific phiC31 integrases. Proc. Natl Acad. Sci. USA, 104, 3312 – 3317. 77. Pandey, U.B., Nie, Z., Batlevi, Y., McCray, B.A., Ritson, G.P., Nedelsky, N.B., Schwartz, S.L., DiProspero, N.A., Knight, M.A., Schuldiner, O. et al. (2007) HDAC6 rescues neurodegeneration and provides an essential link between autophagy and the UPS. Nature, 447, 859– 863. 78. Mankodi, A., Takahashi, M.P., Jiang, H., Beck, C.L., Bowers, W.J., Moxley, R.T., Cannon, S.C. and Thornton, C.A. (2002) Expanded CUG repeats trigger aberrant splicing of ClC-1 chloride channel pre-mRNA and hyperexcitability of skeletal muscle in myotonic dystrophy. Mol. Cell, 10, 35– 44. 79. Louis, E., Moskowitz, C., Friez, M., Amaya, M. and Vonsattel, J.P. (2006) Parkinsonism, dysautonomia, and intranuclear inclusions in a fragile X carrier: a clinical-pathological study. Mov. Disord., 21, 420– 425.


Lowering the B1 threshold for improved BEAR B1 mapping.

Alcohol and B1 deficiency.

Coxsackie B1 endocarditis.

Aflatoxin B1 and Reye's syndrome.

Biosynthesis of aflatoxin B1. Conversion of versicolorin A to aflatoxin B1 by Aspergillus parasiticus.

Transmission and Demographic Dynamics of Coxsackievirus B1.

Reduction of aflatoxin B1 to aflatoxicol.

Inactivation of cathepsin B1 by diazomethyl ketones.

Specific spectrophotometric assays for cathepsin B1.

B1 estimation using adiabatic refocusing: BEAR.

Linking vitamin B1 with cancer cell metabolism.

Degradation of aflatoxin B1 by microorganisms.

The spread of Coxsackie B1 infection.

Epileptic manifestations and vitamin B1 deficiency.

Total synthesis of elansolids B1 and B2.

Prostaglandin B1: the L-shaped prostaglandin.

Structures of steffimycin and steffimycin B1.

Enzyme-linked immunosorbent analysis for aflatoxin B1.

Genome sequences of five b1 subcluster mycobacteriophages.

Characterization of monosomes produced by aflatoxin B1.

Role of lamin b1 in chromatin instability.

Production of antibody against aflatoxin B1.

Total synthesis of the antibiotic elansolid B1.

ACTH Regulation of Adrenal SR-B1.

B1.

Follow Us

Suggest Documents