Plant Molecular Biology12: 169-179, 1989 © 1989KluwerAcademicPublishers. Printed in the Netherlands

169

Structural and functional analyses of Arabidopsis thaliana chlorophyll a/bbinding protein (cab) promoters Amitava Mitra, Hong K. Choi and Gynheung An Institute of Biological Chemistry, Washington State University, Pullman, WA 99164-6340, USA Received 12 September 1988;acceptedin revised form 23 October 1988

Key words: gene family, photosynthetic gene, promoter, tissue-specific element

Abstract

Arabidopsis thaliana carries three functional copies of the chlorophyll a/b-binding protein (cab) gene which code for an identical mature protein. DNA sequence comparison of all three cab promoters indicated that cab2 and cab3 are more closely related compared to cabl. Although the highest degree of homology was found between the TATA box and - 256 of cab3 promoter, suggesting that this region plays a major role in promoter function, this promoter regions are only 47°70 homologous. To study whether these promoters are regulated by identical cis-acting regulatory elements, the promoters were mutated by progressive deletions and the effects on the promoter activity were measured in either transformed plants or cultured cells. It was found that the minimum sequence necessary for the light-dependent tissue-specific promoter activity of the cab3 is the 89 bp DNA fragment (between - 7 4 and -164) at the region of the TATA and the CCAAT boxes. However, an additional 45 bp DNA fragment (between -164 and -209) upstream of the CCAAT box was necessary for the full promoter activity in the leaves. The regulatory element in the 45 bp region appears to be a positive regulator or enhancer which is specific to photosynthetic cells, since the region did not enhance the promoter activity in cultured cells. This region contains an octamer, TGCCACGT (cab2) or TGCCACAT (cab3), which is similar to the previously identified element, TGACACGT from Arabidopsis cabl promoter. The upstream regions of the cab promoters appear to contain additional elements which are functionally distinct in each promoter since the upstream region of cab1 activated a non-functional nos promoter whereas that of cab3 did not.

Introduction

The chlorophyll a/b-binding protein, a major structural component of the light-harvesting complex, is encoded by a gene family located on the nuclear chromosomes [17]. The protein is synthesized on cytoplasmic ribosomes and transported into the chloroplasts where it is processed and finally assembled in the thylakoid membrane [15]. The gene is primarily induced to express in the photosynthetic cells by light. Chlorophyll a/b-binding protein (cab)

genes have been isolated and studied from a variety of plant species including pea [10], petunia [11], A rabidopsis thaliana [17], Nicotiana plumbaginifolia [8], tomato [21], wheat [16], maize [22] and Lemna [15]. It was shown that a 400 bp 5 ' upstream region of pea cab gene is sufficient for both organ-specific and light-regulated expression in a heterologous tobacco system. Later it was demonstrated that the 247 b p sequence from -100 to -347 acted as both a lightinducible enhancer and tissue-specific silencer [23].

170 Castresana et ai. [9] have studied the cabE gene of N. plumbaginifolia and postulated that the 5' control region contains several positive and negative regulatory elements. In the 5' promoter region of the wheat cabl gene, a p hytochrome regulated element was reported to be present [20]. Many proteins are encoded by a gene family in eukaryotes. It is unknown whether individual members in a gene family are regulated differently. There are three cab genes in A. thaliana which code for an identical mature protein [17]. Although all three promoters confer tissue-specific and photoregulated activity in transformed tobacco cells, differential promoter activity was observed in certain developmental stages [4]. In an attempt to understand why plants maintain multiple copies of a gene, we have studied the 5' control region of two Arabidopsis cab genes and the results were compared with that from the third copy.

Materials and methods

BAL-31 from the EcoRI site of pGA870, followed by StuI digestion and self ligation. This procedure resulted in generation of KpnI and XhoI sites at the deletion end point of each mutant. The 5' deletion mutants were cloned into the binary vector pGA655 to construct pGA871. These molecules were transferred into A. tumefaciens LBA4404 by direct DNA upake method [6]. A similar procedure was used to generate 5' deletion mutants from cab2, and 3' deletion mutants from both cab2 and cab3.

DNA sequencing The deletion end points were deduced by labelling either the XhoI or Asp718 site located at the deletion end points with ot-32p nucleotide and by sequencing the fragment using the chemical modification method of Maxam and Gilbert [18]. Both strands of the entire promoter regions were sequenced from the overlapping promoter mutants that are spaced less than 200 bp intervals.

Bacterial strains Plant transformation Escherichia coli host strain MC1000 (ara, leu, lac, gal, str) [7] was used as recipient for routine cloning experiments. The Agrobacterium strain LBA4404 [14] containing Ach5 chromosomal background and a disarmed helper tumor-inducing (Ti) plasmid, pAL4404, was used for plant transformation.

Molecular cloning Deletion mutants of both cab2 and cab3 promoters were generated by BAL-31 exonuclease digestion using a pair of plasmids, pGA616 and pGA617, which were generated from pUC18 and pUC19 by inserting an oligonucleotide (GGTACCTCGAGGCCT) at the unique SspI site [13]. The oligonucleotide sequence contains restriction endonuclease sites for KpnI (Asp718), XhoI, and StuI. The 1607 bp EcoRISacI fragment containing the 959 bp promoter region and the 648 bp coding region of cab3 was inserted into the multiple cloning sites of pGA617, generating pGA870 (Fig. 1). The 5' promoter mutants were obtained by progressive deletion with

Aseptically grown Nicotiana tabacum cv. Xanthi nc leaves were used for plant transformation by leafdisk cocultivation method [3]. The transformants were selected on 500 mg/1 kanamycin which generated very few non-transformed "escapes". At least 25 independently transformed shoots for each deletion mutant were grown either in the dark or under light. Three to four weeks later these shoots were pooled for chloramphenicol acetyltransferase (CAT) assay [12]. Suspension culture cells (NT1) derived from N. tabacum cv. Bright Yellow were transformed as described [1] and fifty independently transformed calli that were grown under light were pooled for CAT activity.

Results

Physical structure of cab3 promoter Sets of both 5' and 3' deletion mutants were generated from the cab promoters and used for deducing

171

""

MC$

Ssp I m

~.~x

st

pUC

19

i I I

POLYLINKER R

I

E c o RI

-q~---1607 bp----~

I

J

cab3

S

I pGA 580

•-

,9

DELETION Hpo I - Bgl II Xbol --~ Xhol

!

MCS

H X : .

,(. •

JEcoRI iBal 31

|stul

"~""

.9

_ . . L . _ j'

Fig. 1. Construction of cab3 5' deletion mutants. The plasmid pGA870 was constructed by inserting the 1607 bp EcoRI-SstI fragment of the cab3 gene into the multiple cloning site (MCS) of pGA617, a derivative of pUC19. The 5' deletion mutants (pGA871) were generated from pGA870 by BAL-31 digestion. All the mutants contain the identical linker DNA sequence (Kpnl and Xhol) at the deletion end points. These mutants were cloned into pGA655, a binary Ti-plasmid vector to form pGA872, bla, betalactamase gene; cat, chloramphenicol acetyltransferase gene; npt, neomycin phosphotransferase gene expressable in plants; ori, colEl origin of replication; oriT, RK2 origin of conjugal transfer; ori V, RK2 origin of replication; tet, tetracycline resistance gene of RK2 plasmid; trfA*, a segment code for a replication protein; closed box, cab3; open box, the T-DNA borders. Restriction enzyme sites: H, HindllI; K, KpnI; R, EcoRI; S, Sstl; Sa, Sail; St, Stul; X, XhoI.

172 the primary DNA sequences between the translation initiation codon and the EcoRI site (Figs. 2 and 3). It was demonstrated earlier that the 959 bp cab3 promoter fragment and 788 bp cab2 fragment contain the regulatory elements responsible for the light-dependent tissue-specific expression of the Arabidopsis cab genes in transgenic tobacco plants [4]. The cab3 and cab2 promoters are 87070 identical from the translation start site to - 256 of cab3; thereafter the sequences are highly divergent (Fig. 4). The cabl promoter sequence has diverged more compared to the other two cab promoters. Highest homology between all three genes was found between the TATA box and - 2 5 6 of cab3; 4707o of the DNA sequence between - 2 5 6 and the TATA box of cab3 is homologous to the corresponding region of the cabl gene. Much less homology (34070) is found in the region between the respective TATA boxes and the ATG start codons.

Analysis of 5' deletion mutants in transformed tobacco plants Effects of the 5' deletions on the cab3 promoter were studied in transformed tobacco plants. The promoter strength was determined by measuring CAT activity of the primary transformed shoots that were grown under light. To minimize variation due to the position effect, 25 independently transformed shoots were pooled for assaying the promoter strength. In order to examine tissue specific expression, at least two transformed plants from each deletion were examined for CAT activity in leaf, stem, and root tissues. For light regulation, transformed shoots were regenerated under light or in dark and assayed for CAT activity. The results indicated that progressive deletions of the farther upstream region between the EcoRI site and - 2 0 9 had no significant effect on the strength and specificity of the cab3 pro-

GAATTCGG -780

AAAAAGCGAATAAATAAGTTTGTTCAAAAGGTTGTTGAAGTTTACAATAAAGATKACTTG

-720

AATCATGATAAGAAAAAAAGTAGCTATATGTTCTCTAAAGTCTAAACCCATGATGATGAA 39 CATGCCATATG/~TTi~TATA~TCTTTCATGTTCTTAGA~TGGTCGAT/~GTTAA/~C 90 AGTGTTTCA~AATCGTTGTGTTTCTTCGATAAAGAGTAAAACGTCAAAGTTTTAAGGTG 07 ATATCACATAATTCATGAGA~I'ATTTTGGTTATIGATi~AGTGACGATGA/~TCGATTC

-660 -600 -540 -480 -420

ATAATTGAAATTAAACTGGTAGTGAT~ATGAACTAATTACCATTGAAAATATTGATATTT 414 _378 ATGTGTGVGGTAAATGCTTTTTATAATGTTACTTTATATTAAT~I?TTCGATCATCAGAATC

-360

TATATTTTCAAAATGTTATACTTTAAGTTTTAGTTATTGGGTTGTAGCAAAAATCATTCT

-300

TG

-240

CACAAAACGCTTGGCTGCAA~GAAAAAATCAAAACAAATGCTGGTGGACTAGAGATTGCC

-180

ACGTAAGACTACTAAACGATAAAACAAAAATCTTAAAATCCAATGAATGAACAGATAAAG

-120

ATTACTTCAGATATAACAAACGTTACAATATCCCTATATAATCCAACACTATCGAACCAG

-60

TTTTAATCACTCTCACTCACAAGTTAGTCATAAAAAAAAAAAAAACACAAAAAAGTTTCA

+i

ATG GCC GCC TCA ACA ATG GCT CTC TCC TCC CCT GCT TTC GCC GGA

.298

CACGAGGGTGTA

W256

GTAAG

G

AACCGTTGAAGTATTCAG

G

CTCATAACTTGTGGT

. 97

Fig. 2. Primary structure of the Arabidopsis thaliana cab2 promoter. ATG initiationcodon, TATAbox and CCAATbox sequencesare in bold letters. The DNA sequencesimilarto the G box [9] is underlined.The end points of the 5' deletionmutants studiedin this report are indicated above the sequence with arrowheads.

173 -959

GAATTCATGTGTGAGGGCAATTAGTGATTGTAAAAATAAAATTGTGTTTTGTAAAAAAC 9O

-900

TTTTACTGTCt/~TTATTTAGGGTGATG~/~TCAGT~I~CTACGAATGATAGCTTA

-840

~GAGTTTCTATC~GTGATTGAG~TAGTTTGTTGC~ATTAAACCTCTa~%C~

15

AAT 726

-780

GTTTTCTGTTGTGGTTTTTCATCTCTACAAATTTTGAATTTTATGATGAATTAG~MAAGAT

-720

AGAATGAGTTACTTTAGATTTTAAAAGGTTGTTCAAGTTTACAAAACAGATTACTAGAAT 37 CATGATTAAAAATTTACAAGCTAITATTGTCTAAACC/hn, TGATGTTGAACATACCAGAT

-660 -600

GATAGTTTTTCAGTGTTTGAAC~CAATTGGATAGTTTTTATGTTTCTGCAAAATATGC 31

-540

~T/~TCA~GTTTTTGAGTCTTTGCATTTTGATTTi~/~GCA/~,J~C/~CTGAGTTTC ~39

-480

AAGGTTAAATTAATTACATTATTCATGAGATTTATCAGG~TTAGTGGATAAACTGACAAT G

-420

GAATCAATGTTATTGTAAATTGGTAGTGATGTTGGACTTCTAATGTTACTCTCTATGATG 31

-360

TTTCGGTCATCGGTATCACACTATCTTTACI~TTTATTTA/~GGgAAGATCACAC;~,AT/~

-300

GTTATCTCTATTCAGAACTATTAAGCTGCTTCCAAAAGACTTGCAACATGTGGTCTCGAA

-240 -180

ATGCTTTGG'CTGCAATGAAAAAATCATAGCA~AAGCTAGTGGACTAGAGACTGCCACATA 164 131 AGAATAGTAAACGTTAAYAACCAAAATCTCAAAAATCCAATGAGTAAAGAGIATATAGATTA

-

CTTCATAGATAACAAACGTTACTCGCAATTTTCCTATA

20

.232

,209

TCCA

CCTACCTAACCAT

-60 42

+I

u

A T G GCC GCC TCC ACA ATG GCT CTC TCC TCC CCT GCC TTC GCC GGA

Fig. 3. Primary structure of the Arabidopsis t h a ~ n a c a ~ promoten ATG initiation codon, TATA box, CCAAT box, and G box am indicated as shown in the ~g. 2. The end points of the 5' deletion mutants used ~ r this study are indicated above the DNA sequence with arrowheads. Similarl~ the 3' deletion end points are shown below the promoter sequence.

370 cab3 cab2 cabl

,360 ~

740

250

730

720

210

@ccA~ GAC'r'reC.AACA ~ ' r ~ a ' c G Z , ~ T Gcr'r'rGC,C T G e , ~ , , T C ~ r e A T A G C / ~ AT TCAGTGGCTCAT~,~CT'X~rC, G T C a C ~ C GC'x'r- G ~ T C , ~ ~ ~ a~JATCC ATGAAACC, C.ACC T A G A - -TATCT/mla%RA-C - - A C A T A T ~ T ' r GCG - B T C - TGCGzmld%G 200

190

180

170

~60

3~50

AGCTAG~,C,A e r A C ~ ---trC,CCaCA~/~Ca~T^GAT,.ACGTTA,~CCAA~TerC~V.A'I'C_,C~ ~ C T A G A C a d m ~ T - - -ITGC C.d%CG '11R~%GAC T A C " I ' / I I d m t A C G A T A I I . d % A ~ ~ zm~amjJldm~ T G C - G A G C C A T TimlAC C A C G T A A ~ C,~d%AC2m~dm,T - C T A A A C C C ClmJj~m~a%- -2m, a%imld%~ATGAC T

140 A~-'~ A~CCRAT~

1,30

120

~AT TAAAGAGATATAGATTA~I~ZA GAATGR~%CAGATAAAGATTACTTCA

ii0

i00

~0

- TAGAT~kAC.AAACGTT~CT C T CAATTTTCC - GATATAACAAACGTTAC .... A A T A T C C C

A ( ~ C C A A ~ G C A A C C T C A G A G A T T GATA T - T T C A A G A T A A G A C A G TATTTAG- - A T T T C T G T A T

~o

70

6,0

.~o

,)o

~ATATAA~CCAACC -C-TAC CT A- ACCA- TTTTC AATCACTCTCACTCACAAGTTAGTCACC ~ATATAAT~ CCAACA- C - TATCGA-ACCAGTTTT -AATCACTCTCACTCACRAGTTAGTCAT ~TATATAT;~GCGAAAATCGCATCAATACCA-AAC CACCCAT TTCTTGGCTTACAACAACAAATCTT

~o

!o ...... ......

:}o --

+i-.

CACAA- A A A G ~ ' X ~ I C , CCGCC'rCCACAATC,GCX~X'C'rCCX'CC CA~G~~CGCCTCAACAATGGCTCTCTCCTCC

AAACGTTTTACTTTGTGC TGCACTACTCAACCTT~CGCCTCAACAAT~CTCC Fig. 4. Homology comparison between the three cab promoters. Bold letters indicate homologous bases. ATG initiation codon, TATA box, CCAAT box and G box sequences are marked. The numbers indicate the distance from the start codon of cab3. The arrow indicates the region up to which the promoters share maximum homology.

174 m o t e r (Fig. 5). F u r t h e r deletion to - 1 6 4 , which is 18 bp u p s t r e a m from the C C A A T box, drastically reduced the p r o m o t e r strength. T h e 5' deletion m u t a n t - 164 had 22°7o activity of the wild type, a fivefold decrease in p r o m o t e r strength. However, the

m u t a n t - 1 6 4 retained light i n d u c i b i l i t y a n d tissue specificity. F u r t h e r deletions, which i n c l u d e d the C C A A T box, abolished the p r o m o t e r activity. These results indicate that at least one regulatory e l e m e n t is located between - 209 a n d - 164. The ele-

Fig. 5. Analysis of cab3 5' deletion mutants in transformed tobacco plants. A. Effects of mutation on the strength and light regulation of the cab3 promoter are shown as CAT units per gram of total protein. At least 25 independently transformed tobacco shoots grown under light (L) or in dark (D) were analyzed. B. Effect of mutation on the tissue specificityof the cab3 promoter is shown as CAT activity

in leaf (L), stem (S) and root (R). One unit of CAT catalyzes acetylation of one nmole chloramphenicol per rain at 37 °C.

175 ment appears to be a positive regulatory sequence since deletion of the element did not affect the promoter specificity. The results also suggest that the DNA sequence downstream from position -164 is sufficient to confer light-dependent tissue-specific expression of the cab3 gene.

Effects of the 5' deletions in cultured tobacco cells We have demonstrated earlier that the Arabidopsis cab promoters are functional in cultured tobacco ceils [4]. Although the promoter strength is lower in the non-photosynthetic cells, the promoter activity is light-dependent. In order to examine whether the regulatory elements necessary for the lightdependent, tissue-specific expression are also required for the promoter function in undifferentiated cells, the 5' deletion mutants that were connected to the cat reporter gene were transferred into NT1 cells and the CAT activity was measured from the transformed calli (Fig. 6). Unlike the result in transformed plants, the 5' deletion - 164 exhibited a similar level of CAT activity compared to the other mutants that contained more complete promoter sequences. However, the promoter strength of these mutants was much lower in cultured tobacco ceils compared to that in green

Fig. 6. Promoter activity of cab3 5' deletion m u t a n t s in cultured tobacco cells. Suspension cultured tobacco cells were transformed with 5' deletion mutants and pools of fifty independently transformed calli were analyzed for CAT activity. The deletion end points are shown at the left. cm, chloramphenicol; ac-cm, acetylchloramphenicol.

leaves. Further deletion (-131) destroyed the promoter function in cultured cells. These results suggest that the regulatory element located between -209 and -164 is not recognized in cultured cells and therefore the region contains a tissue-specific positive element or an enhancer element which functions only in photosynthetic cells. The results further indicate that the downstream regulatory elements in the CCAAT-TATA region are responsible for light induction and function in both photosynthetic and cultured cells. Similarly, the effect of 5' deletions on the cab2 promoter function was also studied in cultured tobacco cells. The 5' deletion mutants (-726, -639, -590, -507, -414, -378, -298, -256, -220, -197) exhibited light-dependent promoter activity in cultured cells. The biggest deletion carries the 55 bp upstream of the CCAAT box, suggesting that the light-dependent promoter element is located downstream from position -197 (data not shown).

Analysis of 3' deletion mutants In order to define the 3' boundary of the cab3 promoters, 3' deletion mutants were generated by progressive BAL-31 digestion from the BamHI site which is located in the cab coding region at + 154 from the translation start point. These mutant promoters were linked to cat by subcloning into the binary promoter probing vector pGA582 [5] at the KnpI site. These molecules were transferred to plants via Agrobacterium-mediated transformation. Shoots were regenerated both under light and in dark, and the effects of mutations were determined by measuring CAT activity in the transformed plants. The 3' deletion mutant - 8, which removed all the cab coding region and the eight bp leader sequence, displayed strong CAT activity in the light-grown shoots and weak activity in dark-grown tissues (Fig. 7). The mutant also exhibited the tissuespecific expression of the promoter. The 3' deletion -42, which removed the 14 bp poly(A) tract, reduced the promoter activity by more than fivefold. Deletion of an additional 32 nucleotides to - 74, only 4 bp downstream from the TATA box, did

176

Fig. 7. Characterization of cab3 3' deletion mutants. A. Effects of mutation on the strength and light regulation of the cab3 promoter are shown as CAT units per gram of total protein. At least 25 independently transformed tobacco shoots grown under light (L) or in dark (D) were analyzed. B. Effects of mutation on the tissue specificity of the cab3 promoter is shown as CAT activity in leaf (L), stem (S) and root (R).

not further alter the promoter strength. However, deletion of a part of the TATA box significantly reduced the promoter activity and deletion of the entire TATA box abolished promoter activity, demonstrating the importance of the TATA box sequence in cab promoter function.

Chimeric promoter analysis In order to further investigate the cis regulatory elements associated with tissue specificity and light regulation of the cab promoter, the 3' deletion mutants were connected to a heterologous nopaline syn-

thase (nos) promoter. Two sets of promoter fusions were constructed. The first set was constructed by linking the cab3 mutants to the functional nos promoter -155 [2]. The second set was generated by connecting the 3' cab3 deletion mutants to the defective nos promoter -101 which carries the C C A A T box and TATA box regions but lacks the essential upstream regulatory elements [2]. All the chimeric fusions between cab3 deletion mutants and nos-155 showed a strong promoter activity both in shoot and root, indicating the absence of any silencer element in the upstream region of the cab3 promoter (data not shown). The fusions between the cab3 mutants and nos-lOl, however, did

177 not show any CAT activity. This result implies that the upstream sequence of the cab3 promoter lacks sequences required to activate the heterologous nos promoter.

Discussion

A. thaliana, which has a small genome size [19], contains only three copies of the cab gene [17], unlike other angiosperms that have a higher copy number [8]. All three genes are almost equally functional when tested in transformed tobacco plants [4]. In order to understand the molecular mechanisms controlling the light-dependent and tissue-specific promoter activity, we first determined the nucleotide sequences of the cab promoter regions. Comparison of the promoter sequences revealed a high degree of homology between the cab2 and cab3 promoter sequences, whereas the cabl promoter shows less homology with the other two cab promoters. Highest sequence homology between all three promoters is found between the TATA box and position -256 of cab3, suggesting that important regulatory elements required for the cab promoter activity and specificity may be present in this area. Within this region, the conserved TATA box and CCAAT box sequences are found in all three promoters. In addition, the DNA sequence NANA is repeated several times between the CCAAT and TATA boxes of the cab promoters. The importance of similar sequences has been proposed earlier [8]. An octanucleotide TGCCACGT which is identical to the G box sequence of the N. plumbaginifolia cabE gene is found 37 bp upstream from the CCAAT box of cab2. A similar G box sequence is also present at the same location in the cab3 promoter region. In cab1, the G box sequence is located at the most distal upstream region [13]. The G box, a highly conserved sequence in promoters of several photosynthetic genes, is the binding site of a nuclear protein factor [9]. Deletion mutagenesis of the cab3 5' promoter region has revealed that the downstream sequence from position -209 is sufficient for a high level of promoter activity in the heterologous tobacco system. Therefore, all the upstream regulatory elements

necessary for the cab promoter activity should be present within the 62 bp region from the CCAAT box. There is a dramatic decrease of cab3 promoter activity when 45 nucleotides are deleted from the -209 mutant. Both mutants, however, retained tissue-specific expression and light regulation. Hence, it appears that a positive regulatory element is present between -209 and -164 and that the element enhances expression of the cab3 gene in photosynthetic cells. The observation that addition of the 45 nucleotides to the mutant -164 did not enhance the promoter strength in cultured cells further supports the suggestion that this region carries a positive regulatory element specific to photosynthetic cells. The 45 bp region between -209 and -164 contains an octameric nucleotide sequence, TGCCACAT, which is similar to an inverted sequence of the G box element of N. plumbaginifolia cabE promoter where a nuclear protein factor interacts [9]. The G box sequence was also found at the same position in the cab2 promoter. Analysis of the cabl promoter indicated that a positive regulatory element responsible for tissue-specific expression is present at 140 bp upstream from the CCAAT box, where a similar G box sequence is located [13]. Therefore, it is likely that the octameric nucleotide sequence in the 45 bp region of cab2 and cab3 is the positive regulatory dement which enhances the promoter activity in photosynthetic cells. However, it appears that the cabl upstream promoter region contains additional regulatory elements which are functionally different from that of cab3 since the cab3 upstream i~ragment was unable to activate a non-functional nos promoter whereas a similar cabl-nos promoter fusion was functional in the photosynthetic cells. One explanation for this difference could be the fact that there are three G-box sequences in the cabl upstream region, but only one in the cab2 and cab3. Alternatively an additional sequence element not related to the G-box sequence may be present only in cabl. For example a potential Z-DNA forming sequence was found in the essential region of the cabl promoter, but no such sequence was found in the other two cab genes. The 3 ' deletion analysis of the cab3 promoter indicated that deletion of the poly(A) stretch between

178 -15 and - 2 8 reduced CAT activity sixfold. It is unclear whether the decrease in gene expression is due to inefficient transcription initiation, instability of mRNA, or improper translation. It was also found that the TATA box is essential for the promoter function since the deletion of the TATA box abolished the promoter activity. Therefore, the minimum DNA sequence necessary for the light-dependent tissue-specific activity of the cab3 promoter is located in the 89 bp region between the TATA box and a position 18 bp upstream of the CCAAT box. Whether the CCAAT box or TATA box regions play an important role in controlling the promoter specificity is unknown. Also, the possible involvement of other sequences, such as the NANA repeats found between the TATA and CCAAT boxes, has still to be investigated. Other cab genes seem to require a longer upstream sequence for their efficient expression. Castresana et al. [9] reported that a 657 bp upstream region is required for the maximum activity of the N. plumbaginifolia cabE promoter. In the wheat cab gene, a 285 bp upstream sequence from the CCAAT box is needed for full promoter function [20]. The compact promoter structure of Arabidopsis cab2 and cab3 may reflect the fact that the Arabidopsis genome size is much smaller than that of most angiosperms, which may result not only a simpler gehome organization but also in a tighter linkage between structural genes and their controlling elements.

Acknowledgements We thank Sam Ha, Laszlo Marton, Mike Costa, Mehdi Naderi and Sharmila Mitra for helpful discussions; Barry McGurl for critical reading of the manuscript and Kyungsook An for help with plant tissue culture. This work was supported in part by grants from the National Science Foundation (DCB8417721 and-8616018).

References 1. An G: High efficiency transformation of cultured tobacco cells. Plant Physiol 79:568-570 (1985).

2. An G, Ebert PR, Yi B-Y, Choi C-H: Both TATA box and upstream regions are required for the nopaline synthase promoter activity in transformed tobacco cells. Mol Gen Genet 203:245-250 (1986). 3. An G, Watson BD, Chiang CC: Transformation of tobacco, tomato, potato, and Arabidopsis thaliana using a binary Ti vector system. Plant Physiol 81:301-305 (1986). 4. An G: Integrated regulation of the photosynthetic gene family from Arabidopsis thaliana in transformed tobacco cells. Mol Gen Genet 207:210-216 0987). 5. An G: Binary Ti Vectors for plant transformation and promoter analysis. Meth Enzymol 153:292-305 (1987). 6. An G, Ebert PR, Mitra A, Ha SB: Binary Vectors. In: Gelvin SB, Schilperoort RA (eds) Plant Molecular Biology Manual, pp. A3: 1-19, Kluwer Academic Publishers, Dordrecht (1988). 7. Casadaban M J, Cohen SN: Analysis of gene control signals by DNA fusion and cloning in Escherichia co1£ J Mol Biol 138:179-207 (1980). 8. Castresana C, Staneloni R, Malik VS, Cashmore AR: Molecular Characterization of two clusters of genes encoding the Type I CAB polypeptides of PSII in Nicotiana plumbaginifofia. Plant Mol Biol I0:117-126 (1987). 9. Castresana C, Gracia-Luque 1, Alonso E, Malik VS, Cashmore AR: Both positive and negative elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia. EMBO J 7:1929-1936 (1988). 10. Coruzzi G, Broglie R, Cashmore AR, Chua N-H: Nucleotide sequences of two pea cDNA clones encoding the small subunit of ribulose 1,5-bisphosphate carboxylase and the major chlorophyll a / b binding thylakoid polypeptide. J Biol Chem 258: 1399-1402 (1983). 11. Dunsmuir P, Smith SM, Bedbrook J: The major chlorophyll a / b binding protein of petunia is composed of several polypeptides encoded by a number of distinct nuclear genes. J Mol Appl Genet 2: 285-300 (1983). 12. Gorman CM, Moffat LF, Howard BH: Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051 (1982). 13. Ha SB, An G: Identification of upstream regulatory elements involved in the developmental expression of the Arabidopsis cabl gene. Proc Natl Acad Sci USA 85:8017-8021 (1988). 14. Hoekema A, Hirsch PR, Hooykaas PJJ, Schilperoort RA: A binary vector strategy based on separation of vir- and Tregion of the Agrobacterium tumefaciens Ti-plasmid. Nature 303:179-181 (1983). 15. Karlin-Neumann GA, Kohorn BD, Thornber P, Tobin EM: A chlorophyll a/b-protein encoded by a gene containing an intron with characteristic of a transposable element. J Mol Appl Genet 3 : 4 5 - 6 1 (1985). 16. Lamppa G, Nagy F, Chua N-H: Light regulated and organspecific expression of a wheat Cab gene in transgenic tobacco. Nature 316:750-752 (1985). 17. Leutwiler LS, Meyerowitz EM, Tobin EM: Structure and expression of three light-harvesting chlorophyll a/b-binding protein genes in Arabidopsis thaliana. Nucleic Acids Res 14: 4051 - 4076 (1986).

179 18. Maxam AM, Gilbert W: A new method for sequencing DNA. Proc Natl Acad Sci USA 74:560-564 (1977). 19. Meyerowitz EM, Pruitt RE: Arabidopsis thaliana and plant molecular genetics. Science 229:1214-1218 (1985). 20. Nagy F, Boutry M, Hsu M-Y, Wong M, Chua N-H: The 5' proximal region of the wheat Cab-1 gene contains a 268-bp enhancer-like sequence for phytochrome response. EMBO J 6:2537-2542 (1987). 21. Pichersky E, Bernatzky R, Tanksley SD, Breidenbach RB, Kausch AP, Cashmore AR: Molecular characterization and

genetic mapping of clusters of genes coding chlorophyll a/bbinding proteins in Lycopersicon esculentum (tomato). Gene 40:247-258 0985). 22. Sheen J-Y, Bogorad L: Differential expression of six lightharvesting chlorophyll a/b binding protein genes in maize leaf cell types. Proc Natl Acad Sci USA 83:7811 - 7815 (1986). 23. Simpson J, Schell J, Montagu MV, Herrera-Estrella L: Light inducible and tissue-specific pea lhcp gene expression involves an upstream element combining enhancer- and silencer-like properties. Nature 323:551-554 0986).