Article pubs.acs.org/ac
RuSi@Ru(bpy)32+/Au@Ag2S Nanoparticles Electrochemiluminescence Resonance Energy Transfer System for Sensitive DNA Detection Mei-Sheng Wu,†,‡,§ Li-Jing He,†,§ Jing-Juan Xu,*,† and Hong-Yuan Chen† †
State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093, China ‡ Department of Chemistry, College of Science, Nanjing Agricultural University, Nanjing 210095, China ABSTRACT: This work describes a new electrochemiluminescence resonance energy transfer (ECL-RET) system with graphene oxide(GO)−Au/RuSi@Ru(bpy)32+/ chitosan (CS) composites as the ECL donor and Au@Ag2S nanoparticles (NPs) as ECL the acceptor for the first time. The ECL signal observed by the application of GO−Au/RuSi@Ru(bpy)32+/CS composites was enhanced for 5-fold compared to that of RuSi@Ru(bpy)32+/CS in the presence of coreactant tripropylamine (TPA) due to the increased surface area and improved electrical conductivity by using graphene oxide−gold nanoparticles (GO−Au) composite materials. In addition, we synthesized Au@Ag2S core−shell NPs, whose UV−vis absorption spectrum shows good spectral overlap with the ECL spectrum of GO−Au/RuSi@Ru(bpy)32+/CS composites by adjusting the amount of Na2S and AgNO3 in the process of synthesis. The distance between energy donor and acceptor was studied to get the highly effective ECL-RET. Then, this ECL-RET system was developed for sensitive and specific detection of target DNA, and the ECL quenching efficiency (ΔI/I0, ΔI = I0 − I) was found to be logarithmically related to the concentration of the target DNA in the range from 10 aM to 10 pM.
L
donor and acceptor. Less attention has been paid to enhance the ECL emission of the donor in the ECL-RET system. As a conventional ECL reagents, Ru(bpy)32+ has been widely used in ECL bioanalytical system due to its chemical stability, high ECL efficiency, and superior biocompatibility.13−15 Many efforts have been devoted to enhance the ECL signal, such as immobilization of in perfluorosulfonated ionomer Nafion film or by sol−gel chemistry,16 encapsulation large number of Ru(bpy)32+ molecules in silica nanoparticles,17 and modification of Ru(bpy)32+ molecules on graphene sheets.13,18 Although Ru(bpy)32+ ECL assay shows high sensitivity for biosensing applications, it is not suitable to be employed as an ECL donor due to that it is difficult to find an energy acceptor with suitable absorption wavelength and electrochemical stability.19 In this work, we design a new ECL-RET system based on the electronic excitation energy transfers from GO−Au/RuSi@ Ru(bpy)32+/CS composites (ECL donor) to Au@Ag2S NPs (ECL acceptor) (Scheme 1). To enhance the ECL intensity and improve the long-term stability of ECL-based sensors, we synthesized water-soluble graphene oxide−gold nanoparticles (GO−Au) composite materials and then successfully immobilized RuSi@Ru(bpy)32+ on its surface. Besides, the UV−vis absorption spectra of acceptor can be easily adjusted by Na2S and AgNO3, which shows a good match to the ECL spectrum of the donor. Results demonstrated that this ECL-RET pair had
uminescence resonance energy transfer (LRET) is a wellestablished molecular spectroscopy method that is caused by the energy transfer between donor and acceptor at the nanometer-scale (typically less than 10 nm).1 This unique feature of LRET enables real-time monitoring the interactions between donor/acceptor and external stimuli.2−4 Although fluorescence resonance energy transfer (FRET) has been intensively investigated for bioanalysis, it suffers from drawback such as the strong background autofluorescence caused by the external illumination. In an effort to overcome this drawback, a new LRET approach based on electrochemiluminescence (ECL-RET) has attracted growing attention in the construction of biosensors because of its remarkable advantages, such as high sensitivity, the absence of background from unselective photoexcitation, no interference from the scattered light, and no need of expensive instruments.5−9 However, challenges in this system include high ECL emission of donor and well overlap between the donor’s ECL spectrum and the acceptor’s absorption spectrum. Semiconductor nanocrystals (s-NCs) have recently attracted much attention as both the fascinating RET donor and acceptor because of their tunable absorption wavelength, large surface area, and biocompatibility.5,10,11 Previous studies have demonstrated that ECL-RET between s-NCs and Au nanopartilces (NPs, acceptor) was an efficiency strategy for biological applications.5,12 More recently, our groups have employed Ru(bpy)32+ as an excellent energy acceptor of s-NCs due to its high quantum yield.6 However, most of these approaches have been aimed at improving the energy transfer ratio between © 2014 American Chemical Society
Received: February 12, 2014 Accepted: April 7, 2014 Published: April 7, 2014 4559
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
Scheme 1. Preparation Procedures of (A) GO−Au/MPA/RuSi@Ru(bpy)32+/CS, (B) Au@Ag2S NPs, (C) ECL Biosensor for Target DNA Assay Based on Energy Transfer between GO−Au/RuSi@Ru(bpy)32+/CS and Au@Ag2S NPs
Table 1. Sequence of DNA Probes DNA A target DNA a-1 DNA B target DNA b-1 DNA C target DNA c-1 one-based mismatch DNA a-2 noncomplementary DNA a-3
5′-NH2-(CH2)6-CGAGCGCGGTGCTAGTGTCGCTCG-(CH2)6-SH-3′ ACACTAGCACCG 5′-NH2-(CH2)6-CGAGCGCGGCTTAGTCTTGGATCTGCGTGCTAGCGCTCG-(CH2)6-SH-3′ CTAGCACGCAGATCCAAGACTAAGCCG 5′-NH2-(CH2)6-CGAGCGCGGCTTAGTCTTGGATCAGTTTAACTTATCTCTGCGTGCTAGCGCTCG-(CH2)6-SH-3′ CTAGCACGCAGAGATAAGTTAAACTGATCCAAGACTAAGCCG ACACTATCACCG GTGAGTAACGTA
Instrumentation. The electrochemical and ECL emission measurements were conducted on a MPI-A multifunctional electrochemical and chemiluminescent analytical system (Remax Electronic Instrument Limited Co., Xi’an, China) at room temperature. The spectral width of the photomultiplier tube (PMT) was 350−650 nm, and the voltage of the PMT was set at −700 V in the process of detection. All electrochemical measurements were carried out on a CHI 660 electrochemical working station (CH Instruments, China). Chronocoulometry was performed using a potential window of 0 to −0.4 V in 5 mL of 50 μM RuHex solution that was degassed with nitrogen for 10 min. Both electrochemical and ECL properties were investigated on a three-electrode system with a glassy carbon electrode (GCE, 3 mm diameter) as the working electrode and a Pt wire and saturated calomel electrode (SCE) as the counter and reference electrodes, respectively. Transmission electron microscopy (TEM) was performed on a JEOL model 2000 instrument operating at 200 kV accelerating voltage. The UV− vis absorption spectra were obtained on a Shimadzu UV-3600 UV−vis-NIR photospectrometer (Shimadzu Co.). Synthesis of Au@Ag2S NPs. First, Au NPs were prepared according to the method reported previously with a minor modification.20 Briefly, an aqueous solution of 0.01% HAuCl4 (100 mL) was boiled with vigorous stirring, and then an aqueous solution of 1% trisodium citrate (1.0 mL) was quickly added to the boiling solution. The color of the solution turned from gray-yellow to deep red, indicating the formation of Au
high RET efficiency. Meanwhile, it exhibited an excellent distance-related ECL quenching effect. On the basis of this, a DNA sensor was developed via DNA hybridization and Au@ Ag2S NPs assembly induced ECL quenching of GO−Au/ RuSi@Ru(bpy)32+/CS composite on the electrode surface.
■
EXPERIMENTAL SECTION
Chemicals and Materials. Graphene oxide, HAuCl4, AgNO3, Na2S·9H2O, trisodium citrate, Triton X-100, 1hexanol, cyclohexane, tetraethyl orthosilicate (TEOS), NH3· H2O, acetone, glutaraldehyde (GA), Ru(bpy)32+, Ru(bpy)32+N-hydroxysuccinimide (NHS), 3-mercaptopropionic acid (MPA), N-(3-(dimethylamino)propyl)-N′-ethyl-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS), (3aminopropyl)triethoxysilane (APTES), hexaammineruthenium(III) chloride (RuHex), chitosan (CS), and tripropylamine (TPA) were obtained from Sigma-Aldrich. The ECL detection solution was 0.1 M phosphate buffer solution (pH 7.4, KH2PO4−K2HPO4, PBS) containing 50 mM NaCl and 25 mM TPA. 0.1 M PBS (pH 7.4) containing 0.1 M NaCl was employed for hybridization and preparation of DNA stock solutions. All other reagents were of analytical grade and used as received. Millipore ultrapure water (resistivity ≥ 18.2 MΩ cm) was used throughout the experiment. All of the DNA probes were synthesized by Sangon Biotech Co. Ltd. (Shanghai, China). DNA probes are listed in Table 1. 4560
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
Figure 1. TEM picture of synthesized (A) GO−Au, (B) RuSi@Ru(bpy)32+, and (C) GO−Au/RuSi@Ru(bpy)32+.
triethoxysilane (APTES) alcoholic solution for 2 h to form amino group functionalized RuSi NPs. The nanoparticles were then rinsed with ethanol to remove loosely bound APTES and resuspended in PBS. Ten microliters of 10 mg/mL Ru(bpy)32+NHS was added into 500 μL of the above amino group functionalized RuSi NP solution under stirring at room temperature, and the surface modification was allowed to proceed for 24 h. RuSi@Ru(bpy)32+ NPs were obtained after being collected by centrifugation and washed several times with PBS to remove excess Ru(bpy)32+-NHS, and then redispersed in 500 μL PBS. Preparation of GO−Au/MPA/RuSi@Ru(bpy)3 2+/CS Composites Film and Au/MPA/RuSi@Ru(bpy)32+/CS Composites Film. 50 microliters of 3.0 mM MPA was added to 500 μL of GO−Au solution and incubated at 37 °C for 5 h, then the terminal carboxylic acid groups of GO−Au/ MPA were activated by 10 mg of EDC and 5 mg of NHS for 2 h at 4 °C. Sequentially, 100 μL of RuSi@Ru(bpy)32+ was added to incubate at 30 °C for 3 h. The obtained GO−Au/MPA/ RuSi@Ru(bpy)32+ was mixed with chitosan (CS) solution homogeneously by sonicate. The final concentration of CS was 0.1 mg/mL in GO−Au/MPA/RuSi@Ru(bpy)32+/CS composites. Au/MPA/RuSi@Ru(bpy)32+/CS composites were prepared via the same procedure as above. The GCE was polished with finer grade sand papers and then polished to a mirror smoothness with aqueous slurries of alumina powders (average particle diameters: 0.3 and 0.05 μm Al2O3) on a polishing silk before the surface modification. Then the GCE was thoroughly rinsed with water and then sonicated in ethanol and ultrapure water in turn. The GO−Au/MPA/ RuSi@Ru(bpy)32+/CS composites film was achieved by dropping 10 μL of the obtained composites solution onto the pretreated surface of GCE and evaporated in air at room temperature. Then, the GO−Au/MPA/RuSi@Ru(bpy)32+/CS composites modified GCE was stored in PBS (pH 7.4) for characterization and further modification. Fabrication of the ECL DNA Sensor. The beforehand prepared GO−Au/MPA/RuSi@Ru(bpy)32+/CS composites film modified GCE was immersed in 100 μL of 2.5% (v/v) glutaraldehyde (GA) in PBS for 2 h of incubation at room temperature. After careful washing with PBS, the electrode was immersed in 60 μL of 0.2 μM stem−loop structure probes and incubated at 37 °C for 1 h. Subsequently, the electrode was rinsed thoroughly with 0.1 M PBS containing 0.10 M NaCl to remove the unbound probes on the surface of the electrode. Then the electrodes were immersed in a series of target DNA at different concentrations and incubated at 37 °C for 1 h. Finally, GCE/GO−Au/MPA/RuSi@Ru(bpy)32+/CS/ds DNA was soaked in 100 μL Au@Ag2S core−shell NPs solution at 4 °C overnight. After that, the prepared electrode was washed with
NPs, and was kept stirring for 10 min. The prepared Au NPs were stored in brown glass bottles at 4 °C. The as-synthesized citrate-capped Au NPs were used as core particles (seeds) in the preparation of Au@Ag core−shell NPs.21,22 The Au NPs dispersion (50 mL) was refluxed at 135 °C under stirring. After that, 1 mL of AgNO3 was added. Then 1% trisodium citrate was added dropwise. The reaction solution was refluxed for 1 h and then left to cool to room temperature. As a major advantage of the seed-mediated synthesis, the Ag shell thickness of the resulting Au@Ag core−shell NPs can be finely controlled by varying the concentration of AgNO3 (4, 5, and 6 mg/mL) added to the reaction solution. Au@Ag2S NPs were prepared by adding a small amount of 0.01 M Na2S into 10 mL of Au@Ag core−shell NPs with vigorous stirring, and the mixture was allowed to stir at room temperature in an air atmosphere for 12 h. The prepared Au@ Ag2S NPs were stored at 4 °C. Synthesis of GO−Au Composites and Au NPs. Au NPs were in situ synthesized on graphene oxide (GO) through the reduction of HAuCl4 by citrate.23 Specifically, 15 mg of GO was added to 55 mL of water and dispersed by sonication for 2 h. Twenty-five milliliters of 0.51 mM HAuCl4 solution was added to 25 mL of graphene oxide dispersion and stirred for 30 min to promote a uniform mixing. The reaction mixture was heated to 80 °C, after which 1 mL of 0.88 M sodium citrate was added dropwise. The reaction was allowed to proceed for 1 h at this temperature and then stirred overnight at room temperature. The final reaction precipitates were centrifuged and washed thoroughly with ultrapure water three times. Then, the obtained precipitate was redispersed into 40 mL of PBS (pH 7.4) and stored at 4 °C. To evaluate the signal amplification effect of Au NPs on ECL intensity, we synthesized Au NPs whose size was nearly the same as the diameter of Au in the GO−Au composites, according to our previous study.5 In brief, 0.6 mL of ice cold 0.1 M NaBH4 was added to 20 mL of 2.5 × 10−4 M HAuCl4(aq) under constant stirring. The solution was kept stirring in an ice bath for 10 min and then reacted at room temperature for 3 h. The prepared Au NPs were stored at 4 °C for further use. The average size of Au NPs was about 5 nm. Synthesis of RuSi@Ru(bpy)32+ Composites. The RuSi@ Ru(bpy)32+ was prepared according to our previous work.17 First, 1.77 mL of Triton X-100, 7.5 mL of cyclohexane, 1.8 mL of 1-hexanol, and 340 μL of Ru(bpy)32+ (40 mM) were mixed with constant magnetic stirring for 30 min to form the water-inoil microemulsion. After addition of 100 μL of tetraethyl orthosilicate (TEOS) and 60 μL of NH3·H2O, the hydrolysis reaction was allowed to continue for 24 h. Acetone was then added to destroy the emulsion, followed by centrifuging and washing with ethanol and water. The obtained orange-colored RuSi NPs were treated with 10% (3-aminopropyl)4561
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
ECL emission of GO−Au/RuSi@Ru(bpy)32+/CS/GCE under continuous potential scanning for 10 cycles. The light emission showed quite good stability, which suggested that this nanocomposite was suitable for ECL detection. Characterization of Au@Ag2S Core−Shell NPs. On the basis of the excellent ECL performance of GO−Au/RuSi@ Ru(bpy)32+ film, we further developed a new ECL-RET strategy by employing Ru(bpy)32+ as the ECL donor and Au@Ag2S NPs as the ECL acceptor. Scheme 1B shows the preparation procedures of Au@Ag2S NPs. Au seed was prepared through the reduction of HAuCl4 by citrate. A transmission electron microscopy (TEM) image showed that Au seed exhibited a highly monodispersion with a mean diameter of 40 nm (Figure 3A). After the reduction of AgNO3 on the surface of Au seed, the diameter of nanoparticles increased to 65 nm (Figure 3B). Then the obtained Au@Ag core−shell NPs were further reacted with Na2S to form Au@Ag2S core−shell NPs. Result demonstrated that the diameter was about 80 nm (Figure 3C). The formation of Au@Ag2S core−shell NPs was also confirmed by UV−vis absorption spectroscopy measurements (Figure 4A). Au seeds displayed a strong absorption band around 530 nm (curve a). After the deposition of Ag layer on Au, it showed a broad absorption at 420−500 nm (curve b). The blue-shifted surface plasmon absorbance indicated the coupling between the Au and Ag layers.25 Following the sequential formation of Au@ Ag2S, the peak position shifted to the red direction (curves c− e) due to the high refractive indices of the Ag2S shell.25 Moreover, the peak position could be easily controlled by changing the amount of Na2S and AgNO3 in the process of synthesis which is critical for efficient energy transfer to Au@ Ag2S from GO−Au/RuSi@Ru(bpy)32+/CS composites. First, we explored the influence of Na2S concentration on the absorption spectrum of Au@Ag2S NPs. As can be seen from Figure 4A, the absorption peak of Au@Ag2S NPs showed redshift with the increasing amount of Na2S (curves c and d). With further increases to the amount of Na2S, the maximum absorption peak position did not change (curve e). Then we optimized the amount of AgNO3 in the presence of excess Na2S and the corresponding UV−vis spectra are shown in Figure 4B. The UV−vis absorption peak was red-shifted with the increasing amount of AgNO3 (curves a−c) because of the increasing thickness of the Ag2S shell. It can be seen that the UV−vis absorption spectrum of Au@Ag2S NPs observed at 620 nm (curve b) had an excellent spectral overlap with the ECL spectrum of GO−Au/RuSi@Ru(bpy)32+/CS composites (curve d). Therefore, the Au@Ag2S NPs synthesized in 5 mg/mL AgNO3 was used in the ECL biosensor. Principle of the ECL Biosensor. The schematic diagram of the ECL biosensor is illustrated in Scheme 1C. The immobilization of MB on the electrode surface and the hybridization of target DNA were also quantified using RuHex approach.26 Because the DNA backbone is negatively charged, numerous RuHex can bind to the DNA backbone through electrostatic interaction, resulting in amplified electrochemical signals. The surface density of MB (curves a and a′) was estimated about 6.7 × 1012 molecules/cm2 and that of target DNA (curves b and b′) was about 5.5 × 1012 molecules/cm2 (Figure 5A). The hybridization efficiency was measured to be 82%. Then we evaluated the ECL response of the biosensor for sensing target DNA and the corresponding ECL signals are shown in Figure 5B. GO−Au/RuSi@Ru(bpy)32+/CS composites were used as the ECL donor (curve a) and Au@Ag2S NPs were used as the ECL acceptor. After the combination of
PBS thoroughly for the follow-up ECL characterization. Each step of the assembly process was characterized by ECL measurement. And the ECL responses of the electrode were recorded in 0.10 M PBS (pH 7.4) containing 50 mM NaCl and 25 mM TPA. The voltage of the PMT was set at −700 V.
■
RESULTS AND DISSCUSSION Characterization of GO−Au/RuSi@Ru(bpy)32+ Composites. On the basis of previous finding that the ECL intensity of RuSi@Ru(bpy)32+ NPs demonstrated a 24-fold improvement compared to Ru(bpy)32+,17 we synthesized a new type of GO− Au/RuSi@Ru(bpy)32+ composite materials in order to further improve the electric conductivity and trigger the strong ECL signal of Ru(bpy)32+. First, we decorated Au NPs on the GO sheet surface through the reduction of HAuCl4 with citrate (Scheme 1A). The successful synthesis of the GO−Au composite was confirmed by TEM (Figure 1A). Au NPs on the GO surface displayed good dispersion and uniform spherical shape with an average diameter of 4 nm. After that, RuSi@Ru(bpy)32+ NPs with a diameter of about 20 nm (Figure 1B) were conjugated on the GO−Au composite materials using mercaptopropionic acid (MPA) as a linker molecule. The TEM image in Figure 1C clearly indicated that RuSi@Ru(bpy)32+ NPs were successfully assembled on GO−Au composites. The as-prepared composites were then mixed with chitosan (CS) to form a uniform composite film on a glassy carbon electrode (GCE) surface. To reflect the advantages of this complex, we investigated the ECL intensity of GO−Au/RuSi@ Ru(bpy)32+/CS (curve a), GO/RuSi@Ru(bpy)32+/CS (curve b), Au/RuSi@Ru(bpy)32+/CS (curve c), and RuSi@Ru(bpy)32+/CS (curve d), shown in Figure 2. It can be seen that both of the application of the GO and Au NPs could enhance the ECL signal. However, the ECL intensity could be increased up to 5-fold by using GO−Au composites. The ECL improvements indicated that GO−Au composites were more effective than GO or Au NPs due to the increased surface area and electric conductivity.24 The inset of Figure 2 shows the
Figure 2. Cyclic ECL curves of (a) GO−Au/RuSi@Ru(bpy)32+/CS film on GCE, (b) GO/RuSi@Ru(bpy)32+/ CS film on GCE, (c) Au/ RuSi@Ru(bpy)32+/CS film on GCE, and (d) RuSi@Ru(bpy)32+/CS film on GCE. Inset is the stability of ECL emission under continuous cyclic potential scan for 10 cycles from GO−Au/MPA/RuSi@ Ru(bpy)32+/CS. PMT: −700 V. ECL detection buffer: 0.1 M PBS (pH 7.4) + 25 mM TPA + 50 mM NaCl. Scan rate: 100 mV/s. 4562
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
Figure 3. TEM pictures of synthesized (A) Au NPs, (B) Au@Ag NPs, and (C) Au@Ag2S NPs.
Figure 4. (A) UV−vis absorption spectra of Au NPs (a), Au@Ag NPs (b), and Au@Ag2S NPs synthesized in 0.4 mL (c), 0.8 mL (d) and 1.0 mL Na2S (e). (B) UV−vis absorption spectra of Au@Ag2S NPs synthesized in different amount of AgNO3: 4.0 mg/mL (a), 5.0 mg/mL (b), 6.0 mg/mL (c). (d): ECL spectrum of GO−Au/MPA/RuSi@Ru(bpy)32+/CS obtained by a series of optical filters (from 520 to 660 nm, spaced 20 nm).
Figure 5. (A) Chronocoulometric response curves for 0.2 μM MB bound to GO−Au/RuSi@Ru(bpy)32+/CS modified GCE before (a, a′) and after hybridized with 0.2 μM target DNA (b, b′) with (a, b) and without (a′, b′) 50 μM Ru(NH3)63+. (B) Cyclic ECL curves of (a) GO−Au/RuSi@ Ru(bpy)32+/CS film on GCE, (b) GCE/GO−Au/RuSi@Ru(bpy)32+/CS/MB, (c) GCE/GO−Au/RuSi@Ru(bpy)32+/CS/MB/tDNA (1 × 10−14 M), (d) GCE/GO−Au/RuSi@Ru(bpy)32+/CS/MB/tDNA (1 × 10−14 M)/Au@Ag2S NPs, and (e) GCE/GO−Au/RuSi@Ru(bpy)32+/CS/MB/ tDNA (1 × 10−11 M)/Au@Ag2S NPs. PMT: −700 V. ECL detection buffer: 0.10 M PBS (pH 7.4) +25 mM TPA + 50 mM NaCl. Scan rate, 100 mV/s. Inset: comparison of ECL-RET efficiency (ΔI/I) with different separation distances between the GO−Au/RuSi@Ru(bpy)32+/CS film and Au@Ag2S NPs. The concentration of the target DNA is 100 fM.
was exposed on the surface of the electrode, to attach to Au@ Ag2S NPs. Because of this, it was very suitable for the detection of target DNA. Effect of Separation Distance on the ECL-RET Efficiency. The distance between energy donor and acceptor is important for the efficiency of energy transfer. Herein, the separation distance between GO−Au/RuSi@Ru(bpy)32+/CS composites and Au@Ag2S NPs can be systematically controlled by varying the DNA lengths. The MBs with a 6-bp stem and 12-nct, 27-nct, and 47-nct loops were used to investigate the distance dependence of the ECL-RET efficiency. In the presence of target DNA and Au@Ag2S NPs, the distances between GO−Au/RuSi@Ru(bpy)32+/CS composites and Au@ Ag2S NPs were about 8, 13, and 18 nm for the 12-nct, 27-nct, and 47-nct loops (1 nm for 3 bases), respectively. As shown in
hairpin DNA (MB) on the electrode surface, the ECL signal decreased slightly (curve b). In the presence of target DNA, MB was hybridized with its target to form a rigid doublestranded DNA that stood upright on the electrode surface. It also had no obvious effect on the ECL signal (curve c). Meanwhile, the -SH at the 3′-end of the opened MB was far away from electrode surface, which easily combined with Au@ Ag2S NPs. The ECL signal demonstrated a significant decrement (curve d). This is because the Förster resonance energy transfer (FRET) occurred due to the perfectly spectral overlap of the ECL spectrum of GO−Au/RuSi@Ru(bpy)32+/ CS composites and the UV−vis absorption spectrum of the synthesized Au@Ag2S core−shell NPs. When the concentration of the target DNA increased to 10−11 M, the ECL intensity decreased further (curve e). This is because more -SH 4563
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
Figure 6. (A) ECL signals of the biosensor incubated with different concentrations of target DNA (from a to h, 0 M, 10 aM, 100 aM, 1 fM, 10 fM, 100 fM, 1 pM, 10 pM, respectively). (B) Linear relationship between ECL-RET efficiency (ΔI/I) and the logarithm of target DNA concentration, three measurements for each point.
efficiency. Under the optimized conditions, this ECL-RET system was developed for ultrasensitive and specific detection of target DNA. This study provides a new ECL donor and acceptor system and broadens the application of ECL-RET in bioanalysis.
the inset of Figure 5B, the ECL quenching efficiency decreased from 52.3% to 21.9% when the separation distance increased from 8 to 18 nm due to that the energy transfer quenching is a short-range effect. On the basis of the obtained results, we used a 12-nct loop MB in the ECL-RET biosensor for target DNA detection. Analytical Performance of the Biosensor in DNA Detection. Under the optimized conditions, we investigated the relationship between the ECL intensity and the concentration of target DNA. As shown in Figure 6A, the intensity of ECL was very sensitive to the change of the target DNA, ranging from 0 to 10 pM. The presence of target DNA made the ring of the hairpin DNA open and form a rigid double-stranded DNA, then Au@Ag2S NPs were able to attach to the other end of the DNA and caused ECL quenching. And the more target DNA, the larger ECL quenching efficiency was obtained, which allowed us to achieve the sensitive detection of target DNA. The ECL quenching efficiency (ΔI/I0, ΔI = I0 − I) was found to be logarithmically related to the concentration of the target DNA in the range from 10 aM to 10 pM (R = 0.995, shown in Figure 6B). The selectivity of the biosensor for target DNA was tested via comparing the ECL quenching efficiency in sensing 100 fM complete complementary target sequences (T1), the one-basemismatched DNA sequences (T2), and the noncomplementary DNA sequences (T3), respectively. The ECL quenching efficiency reached 0.52 for complete complementary sequences, whereas it was only 0.13 and 0.07 for one-base mismatch and noncomplementary sequences, respectively. It was caused by the thermodynamic factor that restrained the hybridization of mismatched sequence with the probe DNA.27 These results indicated that the developed approach exhibited an excellent specificity to distinguish the single-base mismatched DNA, which benefits from using the stem−loop DNA probe as the sensing component.
■
AUTHOR INFORMATION
Corresponding Author
*J.-J. Xu. Tel/Fax: +86-25-83597294. E-mail: [email protected]. Author Contributions §
The paper was written through contributions of all authors. All authors have given approval to the final version of the paper. These authors contributed equally. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This work was supported by the 973 Program (Grant 2012CB932600), the National Natural Science Foundation (21025522, 21327902, 21305068, and 21121091), the Natural Science Foundation of Jiangsu Province (Grant BK20130666), and Postdoctoral Science Foundation (2013M540432) of China.
■
REFERENCES
(1) Rajapakse, H. E.; Gahlaut, N.; Mohandessi, S.; Yu, D.; Turner, J. R.; Miller, L. W. Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 13582− 13587. (2) Lai, J. P.; Shah, B. P.; Garfunkel, E.; Lee, K. B. ACS Nano 2013, 7, 2741−2750. (3) Freeman, R.; Liu, X. Q.; Willner, I. J. Am. Chem. Soc. 2011, 133, 11597−11604. (4) Yao, H. Q.; Zhang, Y.; Xiao, F.; Xia, Z. Y.; Rao, J. H. Angew. Chem., Int. Ed. 2007, 46, 4346−4349. (5) Wang, J.; Shan, Y.; Zhao, W. W.; Xu, J. J.; Chen, H. Y. Anal. Chem. 2011, 83, 4004−4011. (6) Wu, M. S.; Shi, H. W.; Xu, J. J.; Chen, H. Y. Chem. Commun. 2011, 47, 7752−7754. (7) He, L. J.; Wu, M. S.; Xu, J. J.; Chen, H. Y. Chem. Commun. 2013, 49, 1539−1541. (8) Hu, X. F.; Zhang, X. L.; Jin, W. R. Electrochim. Acta 2013, 94, 367−373. (9) Qi, W.; Wu, D.; Zhao, J.; Liu, Z.; Zhang, W.; Zhang, L.; Xu, G. Anal. Chem. 2013, 85, 3207−3212. (10) Tian, J. N.; Liu, R. J.; Zhao, Y. C.; Peng, Y.; Hong, X.; Xu, Q.; Zhao, S. L. Nanotechnology 2010, 21 DOI: 10.1088/0957-4484/21/ 30/305101. (11) Zhou, H.; Liu, J.; Xu, J. J.; Chen, H. Y. Chem. Commun. 2011, 47, 8358−8360.
■
CONCLUSION We have demonstrated an efficient ECL-RET system between GO−Au/RuSi@Ru(bpy)32+/CS composites and Au@Ag2S NPs for high sensitive and specific detection of the target DNA. Graphene oxide−gold nanoparticles (GO−Au) composite materials were functionalized with RuSi@Ru(bpy)32+ and modified on the electrode surface to get an excellent ECL intensity and stability. In addition, we synthesized Au@Ag2S core−shell NPs whose UV−vis absorption peak could be easily tuned to match well with the ECL emission spectrum of GO− Au/RuSi@Ru(bpy)32+/CS composites. Also, the distance between them was investigated to get a higher ECL-RET 4564
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
(12) Cheng, Y.; Lei, J. P.; Chen, Y. L.; Ju, H. X. Biosens. Bioelectron. 2014, 51, 431−436. (13) Li, H. J.; Chen, J. A.; Han, S.; Niu, W. X.; Liu, X. Q.; Xu, G. B. Talanta 2009, 79, 165−170. (14) Sardesai, N. P.; Barron, J. C.; Rusling, J. F. Anal. Chem. 2011, 83, 6698−6703. (15) Wang, X. Y.; Yun, W.; Dong, P.; Zhou, J. M.; He, P. G.; Fang, Y. Z. Langmuir 2008, 24, 2200−2205. (16) Szentirmay, M. N.; Martin, C. R. Anal. Chem. 1984, 56, 1898− 1902. (17) Wu, M. S.; Qian, G. S.; Xu, J. J.; Chen, H. Y. Anal. Chem. 2012, 84, 5407−5414. (18) Li, S. W.; Zhong, X.; Yang, H. L.; Hu, Y. Y.; Zhang, F. W.; Niu, Z. Y.; Hu, W. Q.; Dong, Z. P.; Jin, J.; Li, R.; Ma, J. T. Carbon 2011, 49, 4239−4245. (19) Wilson, R.; Johansson, M. K. Chem. Commun. 2003, 2710− 2711. (20) Zhang, S. S.; Zhong, H.; Ding, C. F. Anal. Chem. 2008, 80, 7206−7212. (21) Chen, X.; Liu, H. L.; Zhou, X. D.; Hu, J. M. Nanoscale 2010, 2, 2841−2846. (22) Xie, W.; Su, L.; Donfack, P.; Shen, A. G.; Zhou, X. D.; Sackmann, M.; Materny, A.; Hu, J. M. Chem. Commun. 2009, 5263− 5265. (23) Dervishi, E.; Bourdo, S.; Driver, J. A.; Watanabe, F.; Biris, A. R.; Ghosh, A.; Berry, B.; Saini, V.; Biris, A. S. ACS Nano 2012, 6, 501− 511. (24) Wang, F.; Chen, X.; Zhao, Z.; Tang, S.; Huang, X.; Lin, C.; Cai, C.; Zheng, N. J. Mater. Chem. 2011, 21, 11244−11252. (25) Zhu, J. M.; Shen, Y. H.; Xie, A. J.; Zhu, L. J. Mater. Chem. 2009, 19, 8871−8875. (26) Steel, A. B.; Herne, T. M.; Tarlov, M. J. Anal. Chem. 1998, 70, 4670−4677. (27) Bonnet, G.; Tyagi, S.; Libchaber, A.; Kramer, F. R. Proc. Natl. Acad. Sci. U. S. A. 1999, 96, 6171−6176.
4565
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
RuSi@Ru(bpy)32+/Au@Ag2S Nanoparticles Electrochemiluminescence Resonance Energy Transfer System for Sensitive DNA Detection Mei-Sheng Wu,†,‡,§ Li-Jing He,†,§ Jing-Juan Xu,*,† and Hong-Yuan Chen† †
State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093, China ‡ Department of Chemistry, College of Science, Nanjing Agricultural University, Nanjing 210095, China ABSTRACT: This work describes a new electrochemiluminescence resonance energy transfer (ECL-RET) system with graphene oxide(GO)−Au/RuSi@Ru(bpy)32+/ chitosan (CS) composites as the ECL donor and Au@Ag2S nanoparticles (NPs) as ECL the acceptor for the first time. The ECL signal observed by the application of GO−Au/RuSi@Ru(bpy)32+/CS composites was enhanced for 5-fold compared to that of RuSi@Ru(bpy)32+/CS in the presence of coreactant tripropylamine (TPA) due to the increased surface area and improved electrical conductivity by using graphene oxide−gold nanoparticles (GO−Au) composite materials. In addition, we synthesized Au@Ag2S core−shell NPs, whose UV−vis absorption spectrum shows good spectral overlap with the ECL spectrum of GO−Au/RuSi@Ru(bpy)32+/CS composites by adjusting the amount of Na2S and AgNO3 in the process of synthesis. The distance between energy donor and acceptor was studied to get the highly effective ECL-RET. Then, this ECL-RET system was developed for sensitive and specific detection of target DNA, and the ECL quenching efficiency (ΔI/I0, ΔI = I0 − I) was found to be logarithmically related to the concentration of the target DNA in the range from 10 aM to 10 pM.
L
donor and acceptor. Less attention has been paid to enhance the ECL emission of the donor in the ECL-RET system. As a conventional ECL reagents, Ru(bpy)32+ has been widely used in ECL bioanalytical system due to its chemical stability, high ECL efficiency, and superior biocompatibility.13−15 Many efforts have been devoted to enhance the ECL signal, such as immobilization of in perfluorosulfonated ionomer Nafion film or by sol−gel chemistry,16 encapsulation large number of Ru(bpy)32+ molecules in silica nanoparticles,17 and modification of Ru(bpy)32+ molecules on graphene sheets.13,18 Although Ru(bpy)32+ ECL assay shows high sensitivity for biosensing applications, it is not suitable to be employed as an ECL donor due to that it is difficult to find an energy acceptor with suitable absorption wavelength and electrochemical stability.19 In this work, we design a new ECL-RET system based on the electronic excitation energy transfers from GO−Au/RuSi@ Ru(bpy)32+/CS composites (ECL donor) to Au@Ag2S NPs (ECL acceptor) (Scheme 1). To enhance the ECL intensity and improve the long-term stability of ECL-based sensors, we synthesized water-soluble graphene oxide−gold nanoparticles (GO−Au) composite materials and then successfully immobilized RuSi@Ru(bpy)32+ on its surface. Besides, the UV−vis absorption spectra of acceptor can be easily adjusted by Na2S and AgNO3, which shows a good match to the ECL spectrum of the donor. Results demonstrated that this ECL-RET pair had
uminescence resonance energy transfer (LRET) is a wellestablished molecular spectroscopy method that is caused by the energy transfer between donor and acceptor at the nanometer-scale (typically less than 10 nm).1 This unique feature of LRET enables real-time monitoring the interactions between donor/acceptor and external stimuli.2−4 Although fluorescence resonance energy transfer (FRET) has been intensively investigated for bioanalysis, it suffers from drawback such as the strong background autofluorescence caused by the external illumination. In an effort to overcome this drawback, a new LRET approach based on electrochemiluminescence (ECL-RET) has attracted growing attention in the construction of biosensors because of its remarkable advantages, such as high sensitivity, the absence of background from unselective photoexcitation, no interference from the scattered light, and no need of expensive instruments.5−9 However, challenges in this system include high ECL emission of donor and well overlap between the donor’s ECL spectrum and the acceptor’s absorption spectrum. Semiconductor nanocrystals (s-NCs) have recently attracted much attention as both the fascinating RET donor and acceptor because of their tunable absorption wavelength, large surface area, and biocompatibility.5,10,11 Previous studies have demonstrated that ECL-RET between s-NCs and Au nanopartilces (NPs, acceptor) was an efficiency strategy for biological applications.5,12 More recently, our groups have employed Ru(bpy)32+ as an excellent energy acceptor of s-NCs due to its high quantum yield.6 However, most of these approaches have been aimed at improving the energy transfer ratio between © 2014 American Chemical Society
Received: February 12, 2014 Accepted: April 7, 2014 Published: April 7, 2014 4559
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
Scheme 1. Preparation Procedures of (A) GO−Au/MPA/RuSi@Ru(bpy)32+/CS, (B) Au@Ag2S NPs, (C) ECL Biosensor for Target DNA Assay Based on Energy Transfer between GO−Au/RuSi@Ru(bpy)32+/CS and Au@Ag2S NPs
Table 1. Sequence of DNA Probes DNA A target DNA a-1 DNA B target DNA b-1 DNA C target DNA c-1 one-based mismatch DNA a-2 noncomplementary DNA a-3
5′-NH2-(CH2)6-CGAGCGCGGTGCTAGTGTCGCTCG-(CH2)6-SH-3′ ACACTAGCACCG 5′-NH2-(CH2)6-CGAGCGCGGCTTAGTCTTGGATCTGCGTGCTAGCGCTCG-(CH2)6-SH-3′ CTAGCACGCAGATCCAAGACTAAGCCG 5′-NH2-(CH2)6-CGAGCGCGGCTTAGTCTTGGATCAGTTTAACTTATCTCTGCGTGCTAGCGCTCG-(CH2)6-SH-3′ CTAGCACGCAGAGATAAGTTAAACTGATCCAAGACTAAGCCG ACACTATCACCG GTGAGTAACGTA
Instrumentation. The electrochemical and ECL emission measurements were conducted on a MPI-A multifunctional electrochemical and chemiluminescent analytical system (Remax Electronic Instrument Limited Co., Xi’an, China) at room temperature. The spectral width of the photomultiplier tube (PMT) was 350−650 nm, and the voltage of the PMT was set at −700 V in the process of detection. All electrochemical measurements were carried out on a CHI 660 electrochemical working station (CH Instruments, China). Chronocoulometry was performed using a potential window of 0 to −0.4 V in 5 mL of 50 μM RuHex solution that was degassed with nitrogen for 10 min. Both electrochemical and ECL properties were investigated on a three-electrode system with a glassy carbon electrode (GCE, 3 mm diameter) as the working electrode and a Pt wire and saturated calomel electrode (SCE) as the counter and reference electrodes, respectively. Transmission electron microscopy (TEM) was performed on a JEOL model 2000 instrument operating at 200 kV accelerating voltage. The UV− vis absorption spectra were obtained on a Shimadzu UV-3600 UV−vis-NIR photospectrometer (Shimadzu Co.). Synthesis of Au@Ag2S NPs. First, Au NPs were prepared according to the method reported previously with a minor modification.20 Briefly, an aqueous solution of 0.01% HAuCl4 (100 mL) was boiled with vigorous stirring, and then an aqueous solution of 1% trisodium citrate (1.0 mL) was quickly added to the boiling solution. The color of the solution turned from gray-yellow to deep red, indicating the formation of Au
high RET efficiency. Meanwhile, it exhibited an excellent distance-related ECL quenching effect. On the basis of this, a DNA sensor was developed via DNA hybridization and Au@ Ag2S NPs assembly induced ECL quenching of GO−Au/ RuSi@Ru(bpy)32+/CS composite on the electrode surface.
■
EXPERIMENTAL SECTION
Chemicals and Materials. Graphene oxide, HAuCl4, AgNO3, Na2S·9H2O, trisodium citrate, Triton X-100, 1hexanol, cyclohexane, tetraethyl orthosilicate (TEOS), NH3· H2O, acetone, glutaraldehyde (GA), Ru(bpy)32+, Ru(bpy)32+N-hydroxysuccinimide (NHS), 3-mercaptopropionic acid (MPA), N-(3-(dimethylamino)propyl)-N′-ethyl-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS), (3aminopropyl)triethoxysilane (APTES), hexaammineruthenium(III) chloride (RuHex), chitosan (CS), and tripropylamine (TPA) were obtained from Sigma-Aldrich. The ECL detection solution was 0.1 M phosphate buffer solution (pH 7.4, KH2PO4−K2HPO4, PBS) containing 50 mM NaCl and 25 mM TPA. 0.1 M PBS (pH 7.4) containing 0.1 M NaCl was employed for hybridization and preparation of DNA stock solutions. All other reagents were of analytical grade and used as received. Millipore ultrapure water (resistivity ≥ 18.2 MΩ cm) was used throughout the experiment. All of the DNA probes were synthesized by Sangon Biotech Co. Ltd. (Shanghai, China). DNA probes are listed in Table 1. 4560
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
Figure 1. TEM picture of synthesized (A) GO−Au, (B) RuSi@Ru(bpy)32+, and (C) GO−Au/RuSi@Ru(bpy)32+.
triethoxysilane (APTES) alcoholic solution for 2 h to form amino group functionalized RuSi NPs. The nanoparticles were then rinsed with ethanol to remove loosely bound APTES and resuspended in PBS. Ten microliters of 10 mg/mL Ru(bpy)32+NHS was added into 500 μL of the above amino group functionalized RuSi NP solution under stirring at room temperature, and the surface modification was allowed to proceed for 24 h. RuSi@Ru(bpy)32+ NPs were obtained after being collected by centrifugation and washed several times with PBS to remove excess Ru(bpy)32+-NHS, and then redispersed in 500 μL PBS. Preparation of GO−Au/MPA/RuSi@Ru(bpy)3 2+/CS Composites Film and Au/MPA/RuSi@Ru(bpy)32+/CS Composites Film. 50 microliters of 3.0 mM MPA was added to 500 μL of GO−Au solution and incubated at 37 °C for 5 h, then the terminal carboxylic acid groups of GO−Au/ MPA were activated by 10 mg of EDC and 5 mg of NHS for 2 h at 4 °C. Sequentially, 100 μL of RuSi@Ru(bpy)32+ was added to incubate at 30 °C for 3 h. The obtained GO−Au/MPA/ RuSi@Ru(bpy)32+ was mixed with chitosan (CS) solution homogeneously by sonicate. The final concentration of CS was 0.1 mg/mL in GO−Au/MPA/RuSi@Ru(bpy)32+/CS composites. Au/MPA/RuSi@Ru(bpy)32+/CS composites were prepared via the same procedure as above. The GCE was polished with finer grade sand papers and then polished to a mirror smoothness with aqueous slurries of alumina powders (average particle diameters: 0.3 and 0.05 μm Al2O3) on a polishing silk before the surface modification. Then the GCE was thoroughly rinsed with water and then sonicated in ethanol and ultrapure water in turn. The GO−Au/MPA/ RuSi@Ru(bpy)32+/CS composites film was achieved by dropping 10 μL of the obtained composites solution onto the pretreated surface of GCE and evaporated in air at room temperature. Then, the GO−Au/MPA/RuSi@Ru(bpy)32+/CS composites modified GCE was stored in PBS (pH 7.4) for characterization and further modification. Fabrication of the ECL DNA Sensor. The beforehand prepared GO−Au/MPA/RuSi@Ru(bpy)32+/CS composites film modified GCE was immersed in 100 μL of 2.5% (v/v) glutaraldehyde (GA) in PBS for 2 h of incubation at room temperature. After careful washing with PBS, the electrode was immersed in 60 μL of 0.2 μM stem−loop structure probes and incubated at 37 °C for 1 h. Subsequently, the electrode was rinsed thoroughly with 0.1 M PBS containing 0.10 M NaCl to remove the unbound probes on the surface of the electrode. Then the electrodes were immersed in a series of target DNA at different concentrations and incubated at 37 °C for 1 h. Finally, GCE/GO−Au/MPA/RuSi@Ru(bpy)32+/CS/ds DNA was soaked in 100 μL Au@Ag2S core−shell NPs solution at 4 °C overnight. After that, the prepared electrode was washed with
NPs, and was kept stirring for 10 min. The prepared Au NPs were stored in brown glass bottles at 4 °C. The as-synthesized citrate-capped Au NPs were used as core particles (seeds) in the preparation of Au@Ag core−shell NPs.21,22 The Au NPs dispersion (50 mL) was refluxed at 135 °C under stirring. After that, 1 mL of AgNO3 was added. Then 1% trisodium citrate was added dropwise. The reaction solution was refluxed for 1 h and then left to cool to room temperature. As a major advantage of the seed-mediated synthesis, the Ag shell thickness of the resulting Au@Ag core−shell NPs can be finely controlled by varying the concentration of AgNO3 (4, 5, and 6 mg/mL) added to the reaction solution. Au@Ag2S NPs were prepared by adding a small amount of 0.01 M Na2S into 10 mL of Au@Ag core−shell NPs with vigorous stirring, and the mixture was allowed to stir at room temperature in an air atmosphere for 12 h. The prepared Au@ Ag2S NPs were stored at 4 °C. Synthesis of GO−Au Composites and Au NPs. Au NPs were in situ synthesized on graphene oxide (GO) through the reduction of HAuCl4 by citrate.23 Specifically, 15 mg of GO was added to 55 mL of water and dispersed by sonication for 2 h. Twenty-five milliliters of 0.51 mM HAuCl4 solution was added to 25 mL of graphene oxide dispersion and stirred for 30 min to promote a uniform mixing. The reaction mixture was heated to 80 °C, after which 1 mL of 0.88 M sodium citrate was added dropwise. The reaction was allowed to proceed for 1 h at this temperature and then stirred overnight at room temperature. The final reaction precipitates were centrifuged and washed thoroughly with ultrapure water three times. Then, the obtained precipitate was redispersed into 40 mL of PBS (pH 7.4) and stored at 4 °C. To evaluate the signal amplification effect of Au NPs on ECL intensity, we synthesized Au NPs whose size was nearly the same as the diameter of Au in the GO−Au composites, according to our previous study.5 In brief, 0.6 mL of ice cold 0.1 M NaBH4 was added to 20 mL of 2.5 × 10−4 M HAuCl4(aq) under constant stirring. The solution was kept stirring in an ice bath for 10 min and then reacted at room temperature for 3 h. The prepared Au NPs were stored at 4 °C for further use. The average size of Au NPs was about 5 nm. Synthesis of RuSi@Ru(bpy)32+ Composites. The RuSi@ Ru(bpy)32+ was prepared according to our previous work.17 First, 1.77 mL of Triton X-100, 7.5 mL of cyclohexane, 1.8 mL of 1-hexanol, and 340 μL of Ru(bpy)32+ (40 mM) were mixed with constant magnetic stirring for 30 min to form the water-inoil microemulsion. After addition of 100 μL of tetraethyl orthosilicate (TEOS) and 60 μL of NH3·H2O, the hydrolysis reaction was allowed to continue for 24 h. Acetone was then added to destroy the emulsion, followed by centrifuging and washing with ethanol and water. The obtained orange-colored RuSi NPs were treated with 10% (3-aminopropyl)4561
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
ECL emission of GO−Au/RuSi@Ru(bpy)32+/CS/GCE under continuous potential scanning for 10 cycles. The light emission showed quite good stability, which suggested that this nanocomposite was suitable for ECL detection. Characterization of Au@Ag2S Core−Shell NPs. On the basis of the excellent ECL performance of GO−Au/RuSi@ Ru(bpy)32+ film, we further developed a new ECL-RET strategy by employing Ru(bpy)32+ as the ECL donor and Au@Ag2S NPs as the ECL acceptor. Scheme 1B shows the preparation procedures of Au@Ag2S NPs. Au seed was prepared through the reduction of HAuCl4 by citrate. A transmission electron microscopy (TEM) image showed that Au seed exhibited a highly monodispersion with a mean diameter of 40 nm (Figure 3A). After the reduction of AgNO3 on the surface of Au seed, the diameter of nanoparticles increased to 65 nm (Figure 3B). Then the obtained Au@Ag core−shell NPs were further reacted with Na2S to form Au@Ag2S core−shell NPs. Result demonstrated that the diameter was about 80 nm (Figure 3C). The formation of Au@Ag2S core−shell NPs was also confirmed by UV−vis absorption spectroscopy measurements (Figure 4A). Au seeds displayed a strong absorption band around 530 nm (curve a). After the deposition of Ag layer on Au, it showed a broad absorption at 420−500 nm (curve b). The blue-shifted surface plasmon absorbance indicated the coupling between the Au and Ag layers.25 Following the sequential formation of Au@ Ag2S, the peak position shifted to the red direction (curves c− e) due to the high refractive indices of the Ag2S shell.25 Moreover, the peak position could be easily controlled by changing the amount of Na2S and AgNO3 in the process of synthesis which is critical for efficient energy transfer to Au@ Ag2S from GO−Au/RuSi@Ru(bpy)32+/CS composites. First, we explored the influence of Na2S concentration on the absorption spectrum of Au@Ag2S NPs. As can be seen from Figure 4A, the absorption peak of Au@Ag2S NPs showed redshift with the increasing amount of Na2S (curves c and d). With further increases to the amount of Na2S, the maximum absorption peak position did not change (curve e). Then we optimized the amount of AgNO3 in the presence of excess Na2S and the corresponding UV−vis spectra are shown in Figure 4B. The UV−vis absorption peak was red-shifted with the increasing amount of AgNO3 (curves a−c) because of the increasing thickness of the Ag2S shell. It can be seen that the UV−vis absorption spectrum of Au@Ag2S NPs observed at 620 nm (curve b) had an excellent spectral overlap with the ECL spectrum of GO−Au/RuSi@Ru(bpy)32+/CS composites (curve d). Therefore, the Au@Ag2S NPs synthesized in 5 mg/mL AgNO3 was used in the ECL biosensor. Principle of the ECL Biosensor. The schematic diagram of the ECL biosensor is illustrated in Scheme 1C. The immobilization of MB on the electrode surface and the hybridization of target DNA were also quantified using RuHex approach.26 Because the DNA backbone is negatively charged, numerous RuHex can bind to the DNA backbone through electrostatic interaction, resulting in amplified electrochemical signals. The surface density of MB (curves a and a′) was estimated about 6.7 × 1012 molecules/cm2 and that of target DNA (curves b and b′) was about 5.5 × 1012 molecules/cm2 (Figure 5A). The hybridization efficiency was measured to be 82%. Then we evaluated the ECL response of the biosensor for sensing target DNA and the corresponding ECL signals are shown in Figure 5B. GO−Au/RuSi@Ru(bpy)32+/CS composites were used as the ECL donor (curve a) and Au@Ag2S NPs were used as the ECL acceptor. After the combination of
PBS thoroughly for the follow-up ECL characterization. Each step of the assembly process was characterized by ECL measurement. And the ECL responses of the electrode were recorded in 0.10 M PBS (pH 7.4) containing 50 mM NaCl and 25 mM TPA. The voltage of the PMT was set at −700 V.
■
RESULTS AND DISSCUSSION Characterization of GO−Au/RuSi@Ru(bpy)32+ Composites. On the basis of previous finding that the ECL intensity of RuSi@Ru(bpy)32+ NPs demonstrated a 24-fold improvement compared to Ru(bpy)32+,17 we synthesized a new type of GO− Au/RuSi@Ru(bpy)32+ composite materials in order to further improve the electric conductivity and trigger the strong ECL signal of Ru(bpy)32+. First, we decorated Au NPs on the GO sheet surface through the reduction of HAuCl4 with citrate (Scheme 1A). The successful synthesis of the GO−Au composite was confirmed by TEM (Figure 1A). Au NPs on the GO surface displayed good dispersion and uniform spherical shape with an average diameter of 4 nm. After that, RuSi@Ru(bpy)32+ NPs with a diameter of about 20 nm (Figure 1B) were conjugated on the GO−Au composite materials using mercaptopropionic acid (MPA) as a linker molecule. The TEM image in Figure 1C clearly indicated that RuSi@Ru(bpy)32+ NPs were successfully assembled on GO−Au composites. The as-prepared composites were then mixed with chitosan (CS) to form a uniform composite film on a glassy carbon electrode (GCE) surface. To reflect the advantages of this complex, we investigated the ECL intensity of GO−Au/RuSi@ Ru(bpy)32+/CS (curve a), GO/RuSi@Ru(bpy)32+/CS (curve b), Au/RuSi@Ru(bpy)32+/CS (curve c), and RuSi@Ru(bpy)32+/CS (curve d), shown in Figure 2. It can be seen that both of the application of the GO and Au NPs could enhance the ECL signal. However, the ECL intensity could be increased up to 5-fold by using GO−Au composites. The ECL improvements indicated that GO−Au composites were more effective than GO or Au NPs due to the increased surface area and electric conductivity.24 The inset of Figure 2 shows the
Figure 2. Cyclic ECL curves of (a) GO−Au/RuSi@Ru(bpy)32+/CS film on GCE, (b) GO/RuSi@Ru(bpy)32+/ CS film on GCE, (c) Au/ RuSi@Ru(bpy)32+/CS film on GCE, and (d) RuSi@Ru(bpy)32+/CS film on GCE. Inset is the stability of ECL emission under continuous cyclic potential scan for 10 cycles from GO−Au/MPA/RuSi@ Ru(bpy)32+/CS. PMT: −700 V. ECL detection buffer: 0.1 M PBS (pH 7.4) + 25 mM TPA + 50 mM NaCl. Scan rate: 100 mV/s. 4562
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
Figure 3. TEM pictures of synthesized (A) Au NPs, (B) Au@Ag NPs, and (C) Au@Ag2S NPs.
Figure 4. (A) UV−vis absorption spectra of Au NPs (a), Au@Ag NPs (b), and Au@Ag2S NPs synthesized in 0.4 mL (c), 0.8 mL (d) and 1.0 mL Na2S (e). (B) UV−vis absorption spectra of Au@Ag2S NPs synthesized in different amount of AgNO3: 4.0 mg/mL (a), 5.0 mg/mL (b), 6.0 mg/mL (c). (d): ECL spectrum of GO−Au/MPA/RuSi@Ru(bpy)32+/CS obtained by a series of optical filters (from 520 to 660 nm, spaced 20 nm).
Figure 5. (A) Chronocoulometric response curves for 0.2 μM MB bound to GO−Au/RuSi@Ru(bpy)32+/CS modified GCE before (a, a′) and after hybridized with 0.2 μM target DNA (b, b′) with (a, b) and without (a′, b′) 50 μM Ru(NH3)63+. (B) Cyclic ECL curves of (a) GO−Au/RuSi@ Ru(bpy)32+/CS film on GCE, (b) GCE/GO−Au/RuSi@Ru(bpy)32+/CS/MB, (c) GCE/GO−Au/RuSi@Ru(bpy)32+/CS/MB/tDNA (1 × 10−14 M), (d) GCE/GO−Au/RuSi@Ru(bpy)32+/CS/MB/tDNA (1 × 10−14 M)/Au@Ag2S NPs, and (e) GCE/GO−Au/RuSi@Ru(bpy)32+/CS/MB/ tDNA (1 × 10−11 M)/Au@Ag2S NPs. PMT: −700 V. ECL detection buffer: 0.10 M PBS (pH 7.4) +25 mM TPA + 50 mM NaCl. Scan rate, 100 mV/s. Inset: comparison of ECL-RET efficiency (ΔI/I) with different separation distances between the GO−Au/RuSi@Ru(bpy)32+/CS film and Au@Ag2S NPs. The concentration of the target DNA is 100 fM.
was exposed on the surface of the electrode, to attach to Au@ Ag2S NPs. Because of this, it was very suitable for the detection of target DNA. Effect of Separation Distance on the ECL-RET Efficiency. The distance between energy donor and acceptor is important for the efficiency of energy transfer. Herein, the separation distance between GO−Au/RuSi@Ru(bpy)32+/CS composites and Au@Ag2S NPs can be systematically controlled by varying the DNA lengths. The MBs with a 6-bp stem and 12-nct, 27-nct, and 47-nct loops were used to investigate the distance dependence of the ECL-RET efficiency. In the presence of target DNA and Au@Ag2S NPs, the distances between GO−Au/RuSi@Ru(bpy)32+/CS composites and Au@ Ag2S NPs were about 8, 13, and 18 nm for the 12-nct, 27-nct, and 47-nct loops (1 nm for 3 bases), respectively. As shown in
hairpin DNA (MB) on the electrode surface, the ECL signal decreased slightly (curve b). In the presence of target DNA, MB was hybridized with its target to form a rigid doublestranded DNA that stood upright on the electrode surface. It also had no obvious effect on the ECL signal (curve c). Meanwhile, the -SH at the 3′-end of the opened MB was far away from electrode surface, which easily combined with Au@ Ag2S NPs. The ECL signal demonstrated a significant decrement (curve d). This is because the Förster resonance energy transfer (FRET) occurred due to the perfectly spectral overlap of the ECL spectrum of GO−Au/RuSi@Ru(bpy)32+/ CS composites and the UV−vis absorption spectrum of the synthesized Au@Ag2S core−shell NPs. When the concentration of the target DNA increased to 10−11 M, the ECL intensity decreased further (curve e). This is because more -SH 4563
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
Figure 6. (A) ECL signals of the biosensor incubated with different concentrations of target DNA (from a to h, 0 M, 10 aM, 100 aM, 1 fM, 10 fM, 100 fM, 1 pM, 10 pM, respectively). (B) Linear relationship between ECL-RET efficiency (ΔI/I) and the logarithm of target DNA concentration, three measurements for each point.
efficiency. Under the optimized conditions, this ECL-RET system was developed for ultrasensitive and specific detection of target DNA. This study provides a new ECL donor and acceptor system and broadens the application of ECL-RET in bioanalysis.
the inset of Figure 5B, the ECL quenching efficiency decreased from 52.3% to 21.9% when the separation distance increased from 8 to 18 nm due to that the energy transfer quenching is a short-range effect. On the basis of the obtained results, we used a 12-nct loop MB in the ECL-RET biosensor for target DNA detection. Analytical Performance of the Biosensor in DNA Detection. Under the optimized conditions, we investigated the relationship between the ECL intensity and the concentration of target DNA. As shown in Figure 6A, the intensity of ECL was very sensitive to the change of the target DNA, ranging from 0 to 10 pM. The presence of target DNA made the ring of the hairpin DNA open and form a rigid double-stranded DNA, then Au@Ag2S NPs were able to attach to the other end of the DNA and caused ECL quenching. And the more target DNA, the larger ECL quenching efficiency was obtained, which allowed us to achieve the sensitive detection of target DNA. The ECL quenching efficiency (ΔI/I0, ΔI = I0 − I) was found to be logarithmically related to the concentration of the target DNA in the range from 10 aM to 10 pM (R = 0.995, shown in Figure 6B). The selectivity of the biosensor for target DNA was tested via comparing the ECL quenching efficiency in sensing 100 fM complete complementary target sequences (T1), the one-basemismatched DNA sequences (T2), and the noncomplementary DNA sequences (T3), respectively. The ECL quenching efficiency reached 0.52 for complete complementary sequences, whereas it was only 0.13 and 0.07 for one-base mismatch and noncomplementary sequences, respectively. It was caused by the thermodynamic factor that restrained the hybridization of mismatched sequence with the probe DNA.27 These results indicated that the developed approach exhibited an excellent specificity to distinguish the single-base mismatched DNA, which benefits from using the stem−loop DNA probe as the sensing component.
■
AUTHOR INFORMATION
Corresponding Author
*J.-J. Xu. Tel/Fax: +86-25-83597294. E-mail: [email protected]. Author Contributions §
The paper was written through contributions of all authors. All authors have given approval to the final version of the paper. These authors contributed equally. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This work was supported by the 973 Program (Grant 2012CB932600), the National Natural Science Foundation (21025522, 21327902, 21305068, and 21121091), the Natural Science Foundation of Jiangsu Province (Grant BK20130666), and Postdoctoral Science Foundation (2013M540432) of China.
■
REFERENCES
(1) Rajapakse, H. E.; Gahlaut, N.; Mohandessi, S.; Yu, D.; Turner, J. R.; Miller, L. W. Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 13582− 13587. (2) Lai, J. P.; Shah, B. P.; Garfunkel, E.; Lee, K. B. ACS Nano 2013, 7, 2741−2750. (3) Freeman, R.; Liu, X. Q.; Willner, I. J. Am. Chem. Soc. 2011, 133, 11597−11604. (4) Yao, H. Q.; Zhang, Y.; Xiao, F.; Xia, Z. Y.; Rao, J. H. Angew. Chem., Int. Ed. 2007, 46, 4346−4349. (5) Wang, J.; Shan, Y.; Zhao, W. W.; Xu, J. J.; Chen, H. Y. Anal. Chem. 2011, 83, 4004−4011. (6) Wu, M. S.; Shi, H. W.; Xu, J. J.; Chen, H. Y. Chem. Commun. 2011, 47, 7752−7754. (7) He, L. J.; Wu, M. S.; Xu, J. J.; Chen, H. Y. Chem. Commun. 2013, 49, 1539−1541. (8) Hu, X. F.; Zhang, X. L.; Jin, W. R. Electrochim. Acta 2013, 94, 367−373. (9) Qi, W.; Wu, D.; Zhao, J.; Liu, Z.; Zhang, W.; Zhang, L.; Xu, G. Anal. Chem. 2013, 85, 3207−3212. (10) Tian, J. N.; Liu, R. J.; Zhao, Y. C.; Peng, Y.; Hong, X.; Xu, Q.; Zhao, S. L. Nanotechnology 2010, 21 DOI: 10.1088/0957-4484/21/ 30/305101. (11) Zhou, H.; Liu, J.; Xu, J. J.; Chen, H. Y. Chem. Commun. 2011, 47, 8358−8360.
■
CONCLUSION We have demonstrated an efficient ECL-RET system between GO−Au/RuSi@Ru(bpy)32+/CS composites and Au@Ag2S NPs for high sensitive and specific detection of the target DNA. Graphene oxide−gold nanoparticles (GO−Au) composite materials were functionalized with RuSi@Ru(bpy)32+ and modified on the electrode surface to get an excellent ECL intensity and stability. In addition, we synthesized Au@Ag2S core−shell NPs whose UV−vis absorption peak could be easily tuned to match well with the ECL emission spectrum of GO− Au/RuSi@Ru(bpy)32+/CS composites. Also, the distance between them was investigated to get a higher ECL-RET 4564
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
Analytical Chemistry
Article
(12) Cheng, Y.; Lei, J. P.; Chen, Y. L.; Ju, H. X. Biosens. Bioelectron. 2014, 51, 431−436. (13) Li, H. J.; Chen, J. A.; Han, S.; Niu, W. X.; Liu, X. Q.; Xu, G. B. Talanta 2009, 79, 165−170. (14) Sardesai, N. P.; Barron, J. C.; Rusling, J. F. Anal. Chem. 2011, 83, 6698−6703. (15) Wang, X. Y.; Yun, W.; Dong, P.; Zhou, J. M.; He, P. G.; Fang, Y. Z. Langmuir 2008, 24, 2200−2205. (16) Szentirmay, M. N.; Martin, C. R. Anal. Chem. 1984, 56, 1898− 1902. (17) Wu, M. S.; Qian, G. S.; Xu, J. J.; Chen, H. Y. Anal. Chem. 2012, 84, 5407−5414. (18) Li, S. W.; Zhong, X.; Yang, H. L.; Hu, Y. Y.; Zhang, F. W.; Niu, Z. Y.; Hu, W. Q.; Dong, Z. P.; Jin, J.; Li, R.; Ma, J. T. Carbon 2011, 49, 4239−4245. (19) Wilson, R.; Johansson, M. K. Chem. Commun. 2003, 2710− 2711. (20) Zhang, S. S.; Zhong, H.; Ding, C. F. Anal. Chem. 2008, 80, 7206−7212. (21) Chen, X.; Liu, H. L.; Zhou, X. D.; Hu, J. M. Nanoscale 2010, 2, 2841−2846. (22) Xie, W.; Su, L.; Donfack, P.; Shen, A. G.; Zhou, X. D.; Sackmann, M.; Materny, A.; Hu, J. M. Chem. Commun. 2009, 5263− 5265. (23) Dervishi, E.; Bourdo, S.; Driver, J. A.; Watanabe, F.; Biris, A. R.; Ghosh, A.; Berry, B.; Saini, V.; Biris, A. S. ACS Nano 2012, 6, 501− 511. (24) Wang, F.; Chen, X.; Zhao, Z.; Tang, S.; Huang, X.; Lin, C.; Cai, C.; Zheng, N. J. Mater. Chem. 2011, 21, 11244−11252. (25) Zhu, J. M.; Shen, Y. H.; Xie, A. J.; Zhu, L. J. Mater. Chem. 2009, 19, 8871−8875. (26) Steel, A. B.; Herne, T. M.; Tarlov, M. J. Anal. Chem. 1998, 70, 4670−4677. (27) Bonnet, G.; Tyagi, S.; Libchaber, A.; Kramer, F. R. Proc. Natl. Acad. Sci. U. S. A. 1999, 96, 6171−6176.
4565
dx.doi.org/10.1021/ac500591n | Anal. Chem. 2014, 86, 4559−4565
