Mol Biol Rep DOI 10.1007/s11033-014-3538-2
Association of vitamin D receptor FokI and ApaI polymorphisms with lung cancer risk in Tunisian population Wajih Kaabachi • Safa Kaabachi • Ahlem Rafrafi Amira ben Amor • Kalthoum Tizaoui • Faycal Haj sassi • Kamel Hamzaoui
•
Received: 22 May 2013 / Accepted: 19 June 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Many studies reported that Vitamin D Receptor (VDR) gene polymorphisms might influence the cancer risk due to their antiproliferative, antiangiogenic, and apoptotic effects. The aim of this study was to explore the genetic association of VDR polymorphisms with lung cancer risk in Tunisian population. The genotype and haplotype frequencies of four VDR polymorphisms, FokI (rs2228570), BsmI (rs1544410), ApaI (rs7975232) and TaqI (rs731236) were studied using polymerase chain reaction and restriction fragment length polymorphism analysis in 240 patients with lung cancer and 280 healthy controls. The distribution of genotype frequencies differed significantly between lung cancer subjects and controls (FokI Padj = 0.002; ApaI Padj = 0.013). Haplotype analyses revealed a significant association between G-A-C and A-C-T haplotypes and lung cancer risk (Pcorr = 0.0128, Pcorr = 0.008). When patients were stratified according to gender, age, and smoking, significant associations were detected with FokI and TaqI polymorphisms. We found a lack of association between BsmI, TaqI polymorphisms and lung cancer risk
Electronic supplementary material The online version of this article (doi:10.1007/s11033-014-3538-2) contains supplementary material, which is available to authorized users. W. Kaabachi (&) S. Kaabachi A. Rafrafi A. b. Amor K. Tizaoui F. Haj sassi K. Hamzaoui Department of Basic Sciences, Medicine School of Tunis, Tunis El Manar University, Tunis 1007, Tunisia e-mail: [email protected] S. Kaabachi e-mail: [email protected] A. Rafrafi e-mail: [email protected] A. b. Amor e-mail: [email protected]
(P [ 0.05). Only, the attributable proportion due to interaction and the synergic index for interaction between ApaI polymorphism and smoking were statistically significant (Padj = 0.74, 95 % CI = 0.38–1.20) and (Padj = 0.63, 95 % CI = 0.05–1.21), respectively. Both the additive interaction measures suggested the existence of a biological interaction between SNP ApaI, but not FokI, and smoking. The multiplicative interaction measure was not statistically significant (P [ 0.05). This is the first study in Tunisia, which suggested that VDR FokI and ApaI polymorphisms might be risk factors for lung cancer development. Keywords Lung cancer Single nucleotide polymorphism RFLP Vitamin D receptor Biological interaction
Introduction Lung cancer is currently the most occurring cancer worldwide in both men and women [1]. The underlying etiology for the development of lung cancer remains poorly
K. Tizaoui e-mail: [email protected] F. Haj sassi e-mail: [email protected] K. Hamzaoui e-mail: [email protected] W. Kaabachi S. Kaabachi A. Rafrafi A. b. Amor K. Tizaoui F. Haj sassi K. Hamzaoui Homeostasis and Cell Dysfunction, Research Unit UR/12-SP-15, A. Mami Hospital of Pneumology, Ariana, Tunisia
123
Mol Biol Rep
understood and needs elucidation. Previous studies have reported that both environmental and genetic risk factors might affect lung cancer development. Environmental factors could be listed as, age, gender, ethnicity, smoking habit, air pollution, lung disease history, and nutrition [2, 8]. Genetic factors can alter the risk of catching the disease. There have been numerous reported oncogenes, tumor suppressors, and DNA repair genes that interfere with the lung cancer process [35]. There has been much recent interest in the role of the vitamin D axis in lung disease, which includes vitamin D and vitamin D receptor (VDR). The vitamin D has been considered as a potential anti-proliferative, anti-angiogenic agent and responsible for decrease mortality caused by tumors, including lung cancer [29, 31]. The VDR gene is located on chromosome 12, to 12q13.11 [6] and is spanned approximately 100 kb long [40]. The DNA binding domain is encoded by exons 2–3, whereas the ligand-binding domain is encoded by exons 6–9 [17]. Calcitriol, the biologically most active metabolite of vitamin D (1, 25(OH) 2D3), binds to VDR with retinoic acid and controls the expression (or repress) at least 913 genes [26, 38, 42]. Since the expression and nuclear activation of VDR are necessary for the effects of vitamin D, four well-known polymorphisms FokI (C/T), BsmI (A/G), ApaI (A/C) and TaqI (T/C) identified in human VDR gene were extensively studied for their association with cancer risk [25, 34]. Several studies have analyzed the association of various VDR genetic variants with lung cancer risk, and the results were inconsistent [9, 18, 30]. Here we conducted a case–control study to evaluate the association between the VDR variants with lung cancer susceptibility in the Tunisian population. We also examined the eventual interaction between the VDR polymorphisms and cigarette smoking on the lung cancer risk. To our knowledge, no Tunisian case–control study regarding this issue has been previously reported.
females) were divided into two groups according to histopathological criteria, 202 patients with non small cell lung cancer (NSCLC) and 38 patients with small cell lung cancer. A, 280 controls subjects were selected from healthy blood volunteers’ donors, during the same period. The study was approved by the Institutional Ethics Committee of Medical University of Tunisia and written informed consent was obtained from all participants. VDR genotyping The genomic DNA was isolated from peripheral blood cells using a salting-out method [27]. Purity of DNA was measured by means of absorption spectrometry, and the samples with absorbance values from 1.8 to 2.0 at the length of A260/A280 were selected for polymerase chain reaction (PCR) amplification. The DNA samples were stored at -20 °C and the VDR gene polymorphisms were genotyped by PCR. The amplification was performed in a total volume of 25 ll, containing 50 ng of genomic DNA, (19) Taq polymerase buffer (Promega), 2.5 mM MgCl2, 0.5 mM of a dNTP-Mix (Promega), 20 pmol of each primer, 0.5 U of Go-Taq DNA polymerase (Promega) and Nuclease-Free Water (GIBCO). The primers used for amplification were listed in Table 1 [32]. The cycling conditions were set as follows: initial denaturation for 4 min at 94 °C, 30 cycles of 94 °C, annealing temperature was 58 °C (FokI) or 60 °C (BsmI/ApaI/TaqI) and 72 °C for each 1 min respectively, and final extension for 5 min at 72 °C. The volume of the restriction assays was 25 ll containing 10 ll of the PCR product, buffer, and 5 U of the appropriate restriction enzyme (Fermentas) listed in Table 1. Digested fragments were visualized on a 3 % agarose gel. For quality control, randomly selected PCR products were subjected for repeated genotyping to verify the RFLP results and concordance was 100 %. Samples with ambiguous results were repeated. Statistical analysis
Materials and methods Study population The study population was composed of 520 unrelated Tunisian whites’ subjects. A total of 240 lung cancer patients were recruited from September 2009 to February 2013. Different variables were recorded at the time of registration in 2009: sex, age, smoking, treatment modalities, clinical stage, clinical T factor, clinical N factor, clinical M factor and histological subtype of lung cancer (Table 2). Additionally, we investigated for all surgical cases the histopathological LVI (vascular, lymphatic invasion) parameters (Table 2). The lung cancer patients (224 males and 16
123
The allele and genotype frequencies of VDR polymorphisms were compared using the Chi square test (2 9 2 contingency Tables), the Open Epi Info7 and the IBM SPSS Statistics 19 softwares packages programs were used for analysis. When the expected cell frequencies were less than five, Fisher’s exact test was applied. We performed the logistic regression analysis to calculate the association. A P values of less than 0.05 likelihood ratio test [LRT], was considered statistically significant. The Hardy–Weinberg equilibrium was calculated for all samples. All statistical tests were two-sided. Haploview program version 4.2 was used to calculate the pairwise Linkage Disequilibrium (LD) between the
Mol Biol Rep Table 1 Restriction fragment length polymorphism conditions for the identification of VDR gene polymorphisms VDR SNPs
Amplicon (bp)
Primers for PCR amplification (50 –30 )
Restriction enzymes
Annealing temp. (°C)
Restriction fragment lengths (bp)
FokI C/T (F/f)
265
F: AGCTGGCCCTGGCACTGACTCTGCTCT
FokI
37
FF: 265
R: ATGGAAACACCTTGCTTCTTCTCCCTC
Ff: 265, 196 and 69 ff: 196 and 69
BsmI A/G (B/b)
825
F: CAACCAAGACTACAAGTACCGCGTCAGTGA
ApaI A/C (A/a)
740
F: CAGAGCATGGACAGGGAGCAA
BsmI
37
BB: 825
ApaI
65
AA: 740
R: AACCAGCGGGAAGAGGTCAAGGG
Bb: 825, 650 and 175
R: GCAACTCCTCATGGCTGAGGTCTC
Aa: 740, 530 and 210 aa: 530 and 210 bb: 650 and 175
TaqI T/C (T/t)
740
F: CAGAGCATGGACAGGGAGCAA
TaqI
R: GCAACTCCTCATGGCTGAGGTCTC
65
TT: 245 and 495 Tt: 495, 290, 245, and 205 tt: 290, 245, and 205
SNP single-nucleotide polymorphism, BP base pairs, F forward, R reverse
VDR SNPs [7]. The Haplotype frequencies and effects were performed using Haploview, a web-based calculator Snpstats [41] and Plink softwares. The P value for the patient-control differences in haplotype distributions were adjusted for multiple tests by Bonferroni correction. Only the allele frequencies of the haplotype[1 % were included in the analyses, those \1 % were excluded. We included an interaction term (genotype* smoking) into the logistic regression model, to test statistical (multiplicative) interactions. Alternative measures of interactions on the additive scale were based on ORs. Three measures for additive interaction, namely the relative excess risk due to interaction (RERI), attributable proportion (AP), and synergy index (SI), were calculated using the method described by Andersson et al. [3]. RERI = 0, AP = 0, or S = 1 means no interaction or strict additivity; RERI [ 0, AP [ 0, or S [ 1 means positive interaction or more than additivity; RERI \ 0, AP \ 0, or S \ 1 means negative interaction or less than additivity [24]. If any of the null values (0 in RERI and AP or 1 in S) falls outside the 95 % CI of its respective measurement, then the additive interaction is considered statistically significant [3, 20, 24].
Results A total of 240 patients and 280 controls were genotyped for the VDR FokI, BsmI, ApaI and TaqI polymorphisms. The mean age (±SD) of patients group was 58, 51 ± 10.25 years and the mean age of controls group was 52.64 ± 6.36 years. We divided subjects into two age groups, the first included the youngest aged subjects ranged between 30 and 55 years and the second included the oldest aged subjects ranged between 56 and 85 years. According
to tobacco smoking habit, subjects were considered never smokers if they had never smoked in their lifetime. Current smokers or habitual smokers if they had smoked or stopped smoking less than 1 year before either the date of diagnosis of lung cancer. Former smokers were defined as those who had stopped smoking one or more years before either the date of diagnosis of lung cancer. Due to the small number of former smoker (10 patients), Current and former smokers were combined in ever smokers group for subsequent statistical analysis. The most histological lung cancer type observed was adenocarcinoma of the lung (60 %) and more than 80 % of patients had advanced lung tumor stages. We reported detailed clinical characteristics of sample study population in Table 2. The distribution of genotypes and allele frequencies of VDR gene polymorphisms The distribution of genotype frequencies of VDR gene polymorphisms were in agreement with Hardy–Weinberg equilibrium (P [ 0.05). Significant genotypic distributions between lung cancer patients and healthy controls were noted for the VDR FokI (Padj = 0.002), and ApaI (Padj = 0.013) variants. For the FokI polymorphism, the frequency of FF genotype in the lung cancer group (55.8 %) was higher than the corresponding value in the control group (41.4 %). The distribution of F allele frequencies were significantly different between patient and control groups (P = 0.001). In addition, patients carrying one copy of F allele were twice and a half as likely to develop lung cancer than healthy individuals (ORadj = 2.45, 95 % CI = 1.10–5.18). The major C allele (F variant) of FokI polymorphism conferred an increased lung cancer risk than the minor T allele (f variant) in our population (Table 3).
123
Mol Biol Rep Table 2 Clinical characteristics of the case–control study population
Characteristics
Lung cancer cases
Number of subjects Age
Smoking statusb
240
280
Mean (±SDa)
58.51 ± 10.25
52.64 ± 6.36
Range (years)
30–85
39–69
a
SD standard deviation
b
Includes cigarettes (tobacco) and water pipes (equivalent to more than one packet of cigarettes)
154(55.0 %)
10(0.041 %)
4(0.014 %)
144 (60 %)
Squamous cell lung carcinoma
58 (24.16 %)
Small cell lung carcinoma
38 (15.83 %) 14 (5.8 %) 226 (94.2 %)
UICC-TNMd
Clinical T factore
Clinical M factorg
f
Traitements
LVI
h
T2
28 (11.66 %)
T3
34 (14.16 %)
T4
178 (74.16 %)
N0 N1
32 (13.33 %) 27 (11.25 %)
N2
94 (39.16 %)
N3
61 (25.41 %)
NXi
26 (10.83 %)
M0
92 (34.45 %)
M1
174 (65.16 %)
MXj
1 (0.37 %)
Chemoradiotherapy
16 (6.66 %)
Surgery
14 (5.80 %)
Yes No
9(64.48 %) 5(35.71 %)
Chemotherapy
210 (87.5 %)
Others
g
Lymphatic invasion
i
Vascular invasion
MX means metastasis can’t be evaluated
For the ApaI polymorphism, individuals with AA or Aa genotype showed a statistically significant association with higher lung cancer risk compared with those sharing aa genotype (Padj = 0.013). The OR was calculated, and carriers with one or two copies of A allele were 2.30 and 2.64 times as likely to develop lung cancer (OR adj = 2.30, 95 % CI = 1.22–4.35) and (OR adj = 2.64, 95 % CI = 1.37–5.07), respectively. The major A allele (A variant) of ApaI polymorphism was associated with higher lung cancer risk than the minor C allele (a variant) in our population (Table 3).
123
212(88.33 %)
Former or ex-smokers Adenocarcinoma
Clinical N factorf
122(43.57 %)
Current
III or IV (Advanced)
UICC, International Union Against Cancer; TNM, tumor, node, metastasis e Clinical T factor stands for tumor
j
56–85 18(7.56 %)
d
NX means the nearby lymph nodes cannot be evaluated
Oldest subject
I or II (Early)
Current and former smokers were combined in ever smokers group
Clinical M factor stands for metastasis h LVI, vascular, lymphatic invasion
30–55
Pathologic Stage
c
Clinical N factor stands for Lymphe node
Youngest subject Non smokers Smokersc
Histologic cell type
Controls
Yes
6(42.58 %)
No
8(57.14 %)
For the BsmI and TaqI polymorphisms, no differences were observed in genotype distributions and allele frequencies between cases and controls. The BsmI and TaqI polymorphisms were not associated with lung cancer risk (Table 3). Linkage disequilibrium analysis of the VDR SNPs were conducted and illustrated in Fig. 1. The 30 UTR VDR SNPs (BsmI-ApaI-TaqI) showed significant LD with each other. We had also estimated haplotypes for the VDR polymorphisms located in the 30 UTR region. The VDR haplotype frequencies were represented in
Mol Biol Rep Table 3 Genotype distributions and allele frequencies of VDR polymorphisms between cases and control VDR SNPs
Genotypes/ alleles
n (%) of
Logistic regression analysis
Cases (n = 240)
Controls (n = 280)
Crude OR (95 % CI)
ff (TT)
16 (6.7)
30 (10.7)
Ff (CT) FF (CC)
90 (37.5) 134 (55.8)
134 (47,9) 116 (41,4)
1.25 (0.64–2.44) 2.16 (1.12–4.17)
f (T)
122 (25.4)
194 (34.6)
1.00
F (C)
358 (74.5)
366 (65.3)
1.56 (1.18–2.05)
FokI F/f (C/T)
Pa value
Adjusted OR (95 % CI)
0.004 1.00c
BsmI B/b (A/G)
Pb value 0.002
1.00 0.495 0.021
1.25 (0.59–2.66) 2.45 (1.10–5.18)
0.553 0.019
0.001 0.970
1.00c
0.735
bb (GG)
74 (30.8)
84 (30.0)
Bb (AG)
126 (52.5)
150 (53.6)
0.95 (0.58–1.67)
0.812
0.83 (0.53–1.31)
0.432
BB (AA)
40 (16.7)
46 (16.7)
0.98 (0.64–1.41)
0.961
0.89 (0.48–1.62)
0.704
b (G)
274 (57.0)
318 (56.7)
1.00
B (A)
206 (42.9)
242 (43.2)
0.99 (0.77–1.27)
ApaI A/a (A/C)
1.00
0.923 0.029
1.00c
0.013
aa (CC)
21 (8.8)
46 (16.4)
Aa (AC)
118 (49.2)
134 (47.9)
1.92 (1.08–3.41)
0.024
2.30 (1.22–4.35)
0.010
AA (AA)
101 (42.1)
100 (35.7)
2.21 (1.23–3.97)
0.008
2.64 (1.37–5.07)
0.003
a (C)
160 (33.3)
226 (40.35)
1.00
A (A)
320 (66.6)
334 (59.64)
1.35 (1.04–1.76)
tt (CC)
32 (13.3)
36 (12.9)
Tt (TC)
118 (49.2)
146 (52.1)
TaqI T/t (T/C)
TT (TT)
1.00
0.019 0.790
1.00c
0.151 1.00
0.90 (0.53–1.55)
0.727
0.79 (0.43–1.44)
0.455
1.03 (0.59–1.80)
0.908
1.23 (0.65–2.31)
0.520
90 (37.5)
98 (35.0)
t (C)
182 (37.9)
218 (38.9)
1.00
T (T)
298 (62.0)
342 (61.0)
1.04 (0.81–1.35)
0.738
CI confidence interval, OR odds ratio, SNP single-nucleotide polymorphism, N number a
Two-tailed Pearson’s v2-test
b
Adjusted for age, sex, and smoking
c
The [ff], [bb], [aa] and [tt] are the reference groups
Table 4. The most frequent haplotypes in our population were G-A-T or b-A-T (22.8 %) and A-A-C or B-At (22.3 %). The frequency of the haplotype G-A-C was significantly associated with increased lung cancer risk (OR = 4.48, 95 % CI = 2.18–9.20, Pcorr = 0.0128). Similarly, A-C-T haplotype was found significantly (Pcorr = 0.008) more frequent in healthy individuals (11.2 %) than in cases (2.8 %) and was associated with high lung cancer risk (OR = 5.82, 95 %CI = 2.63–12.86). This result confirms the high lung cancer risk associated to the ApaI A alleles (Table 4). The simultaneous analysis of VDR haplotype frequencies of FokI (C/T), BsmI (A/G), ApaI (A/C) and TaqI (T/ C), revealed high prevalence of C-G-C-T or F-b-aT (16.24 %) and C-A-A-C or F-B-A-t (16.21 %) haplotypes in cases and controls. The frequencies of most haplotypes having C or F allele (C-G-C-T, C-A-A-C and C-G-A-
T) were higher in lung cancer cases compared to controls (Supplementary Table 1). Genotype distributions and allele frequencies of VDR FokI and ApaI polymorphisms according to gender, age and tobacco smoking status The stratification of our population according to gender status indicated that, F allele was significantly associated with higher risk among women subjects (OR = 4.29, CI = 1.39–13.18, P = 0.007) than men subjects (OR = 1.44, CI = 1.44–1.93, P = 0.012). For ApaI polymorphism, the men subjects with one copy or two copies of A allele had a 2.51 and 2.96 fold increased risk to develop lung cancer (Padj = 0.004 and Padj = 0.001), respectively. When we stratified our population by age and smoking status, we found that the oldest age-subjects with two copies
123
Mol Biol Rep
Genotype distributions and allele frequencies of VDR FokI and ApaI polymorphisms according to histological types and tumor stages
Fig. 1 Pairwise linkage analysis of 4 SNPs in the VDR gene as measured by D0 . The number on each cell indicates the Log of Odds (LOD) score of Linkage disequilibrium LD (D0 9 10-2) between the respective pairs and strength is depicted by progression of grayscale intensity (min = 0 = white; max = 1.0 = dark grey). The darkest colour represents strongest linkage disequilibium. The chromosome positions of each SNP taken as reference
of F allele had a higher risk to develop lung cancer (OR = 3.96, CI = 1.38–11.33, PAdj = 0.010) than healthy subjects. In contradiction, the youngest age-subjects with two copies of A allele had an increased risk to develop lung cancer (OR = 3.91, CI = 1.53–9.99, PAdj = 0.004) than healthy individuals. The stratification related to smoking status indicated that the F allele was associated (P = 0.0047) with increased lung cancer risk with the non-smokers subjects (OR = 3.45, CI = 1.32–9.50). Inversely, the smokers subjects with one or two copies of A allele were 2.52 and 2.62 times as likely to develop lung cancer, (Padj = 0.007, Padj = 0.007), respectively (Supplementary Table 2–4).
Table 4 Analysis of VDR haplotype frequencies with the risk of lung cancer
Stratification by histologic cell types indicated a difference in allelic and genotypic distribution of VDR polymorphisms among the histological lung cancer groups. For FokI polymorphism, the subjects carrying FF genotype were 2.43 times as likely to develop an adenocarcinoma (AD) of the lung (OR = 2.43, 95 % CI = 1.04–5.64; PAdj = 0.039). For ApaI polymorphism, the subjects with Aa or aa genotype were twice and a half as likely to develop an AD of the lung (OR = 2.57, 95 % CI = 1.21–5.46; PAdj = 0.014). In addition, the subjects with Aa genotype had 3.17 fold increased risk to develop an epidemoide carcinoma of the lung (OR = 3.17, 95 % CI = 1.09–9.20; PAdj = 0.014). After stratification by tumor stage, our results suggested that, the subjects with two copies of F allele had a 3.26 fold high risk to reach an advanced stage of the lung (OR = 3.26, 95 % CI = 1.44–7.36; PAdj = 0.004). Furthermore, the subjects carrying the homozygous AA or Aa genotype had a 2.78 and 2.26 fold increased risk to reach an advanced stage of the lung (PAdj = 0.003; PAdj = 0.014) (Supplementary Table 6, 7). Gene-environment interactions between VDR FokI, ApaI polymorphisms and smoking For the gene-environment interaction study between VDR polymorphisms and tobacco smoking, we combined subjects, with at least one FokI F or ApaI A allele copies, in one group. Smokers with at least one copy of the F or A allele had a higher risk to develop lung cancer than those with the homozygous ff or aa genotype. The multiplicative interaction measures were not significant for the FokI (PAdj = 0.261) and ApaI (PAdj = 0.472) polymorphisms. Additionally, the additive interactions between VDR SNPs and smoking were examined (Table 5). The estimated SI (SIadj = 2.78, 95 %
Haplotype BsmIApaI-TaqI
Total frequency
Case frequency
Control frequency
Haplotype effect OR (95 % CI)
P value
Pc value
G-A-T/b-A-T
0.228
0.283
0.171
1.00a
–
–
A-A-C/B-A-t
0.223
0.271
0.165
1.15 (0.75–1.77)
0.53
4.24
G-C-T/b-a-T
0.222
0.236
0.204
1.43 (0.90–2.26)
0.13
1.04
A-A-T/B-A-T
0.093
0.073
0.122
2.21 (1.16–4.20)
0.016
0.128
Pc value with Bonferroni correction
G-A-C/b-A-t
0.083
0.038
0.137
4.48 (2.18–9.20)
1.10-4
8.10-4
A-C-T/B-a-T
0.070
0.028
0.112
5.82 (2.63–12.86) \0.0001 \0.0008
N number, CI confidence interval, OR odds ratio
A-C-C/B-a-t
0.043
0.056
0.032
0.95 (0.38–2.39)
0.92
7.36
G-C-C/b-a-t
0.035
0.012
0.054
5.78 (1.86–17.98)
0.0026
0.0508
a
The reference group
123
Mol Biol Rep Table 5 Interaction of VDR ApaI polymorphism and cigarette smoking VDR SNPs
Genotypes
ApaI
aa
Smoking
N of cases/ controls
Crude
Adjusted
Never
2/15
1.00c
AA ? Aa
Never
19/107
G
1.33 (0.27–12.91)
1.000
0.88 (0.17–4.63)
1.00
aa AA ? Aa
Ever Ever
19/31 200/127
E EG
4.59 (0.94–22.63) 11.81 (2.65–52.51)
0.059 110-3
5.38 (0.96–30.13) 11.67 (2.48–45.7)
0.05 210-3
1.92 (0.36–10.25)
0.441
1.88 (0.33–10.51)
0.47
OR (95 % CI)
Multiplicative interaction measure
a
Pb value
OR (95 % CI)
P value
1.00c
Additive interaction measure
Additive interaction values
(95 % CI)
Additive interaction values
(95 % CI)
Relative excess risk due to interaction (RERI)
6.88
(-2.58–16.35)
7.04
(-2.95–17.04)
Attributable proportion due to interaction (AP)
0.58
(0.30–0.85)
0.58
(0.30–0.87)
Synergy index for interaction (SI)
2.75
(1.05–7.14)
2.78
(1.04–7.47)
Estimate values of RERI, AP and SI CI confidence interval, OR odds ratio, SNP single-nucleotide polymorphism, N number, G the genetic factor, E the environmental factor a
The P value for v2 test or fisher’s exact tests
b
Adjusted for age and sex status Subject non-smoker with [aa] is the reference group
c
CI = 1.04–7.47) and AP (APadj = 0.58, 95 % CI = 0.30–0.87) measures for the ApaI polymorphism were statistically significant, though RERI was not (Table 5). The additive interaction between ApaI polymorphism and smoking was significant. For the FokI polymorphism, the different measures for the additive interaction were not significant (Supplementary Table 5).
Discussion Lung cancer is a complex disease for which underlying causes remain unclear. There is growing evidence of a malignancy role for vitamin D and VDR in lung cancer. The objective of this case–control study was to evaluate the association between VDR gene polymorphisms and the risk for lung cancer among Tunisian patients. Our results revealed a significant association between VDR FokI (Padj = 0.004), ApaI (Padj = 0.029) polymorphisms and lung cancer risk. Our study showed that the FokI FF genotype (ORadj = 2.45, 95 % CI = 1.10–5.18) and ApaI AA genotype (ORadj = 2.64, 95 % CI = 1.37–5.07) were associated with higher increased lung cancer risk compared with the ff and aa genotypes, respectively. No significant difference was found in the distribution of genotypes and allele frequencies between patients and healthy controls for BsmI (P = 0.97) and TaqI (P = 0.79) polymorphisms. The BsmI and TaqI polymorphisms were not associated with lung cancer risk. Furthermore, we did not report any multiplicative
interactions between VDR polymorphisms and tobacco smoking. However, we found an additive interaction between ApaI but not FokI polymorphism, and tobacco smoking on the risk of lung cancer among Tunisians. The genotypes distribution of FokI and ApaI polymorphisms vary considerably across ethnic groups. The high frequencies of the FF and AA genotypes in control subjects, reported in the current study, were similar to those observed in Turkish, German and Italian populations [9, 13, 14]. This similarity in genotypes distribution suggested an ancestral common origin. The association of FokI F and ApaI A alleles with increased lung cancer risk in our study, was not reported before in Tunisian population. The FokI polymorphism results were also in concordance with the reported findings by Turna et al. [10]. The F allele in TTFF combined genotype of VDR gene was associated with worse survival in resected NSCLC patients [10]. In contrast, Heist et al. [18] reported that Fok F and BsmI B alleles were associated with improved survival in the advanced NSCLC population. For ApaI and TaqI polymorphisms located in the 30 UTR of the VDR gene, our results were different from previous findings of Dogan et al. [9] in Turkish population, in which TaqI polymorphism was associated with lung cancer risk while ApaI variant was not. Morover, Xiong et al. [5] demonstrated, in the Chinese population, that aa genotype carriers of ApaI polymorphism had a longer mean overall survival (OS) compared with AA carriers in patients with NSCLC.
123
Mol Biol Rep
The VDR FokI and ApaI polymorphisms were also investigated for their association with cancer risk. Our findings were concordant to reported results of Turna et al., Huang et al., Guy et al., Mittal et al., and Park et al. [10, 12, 16, 28, 33], with significant malignancy role of FokI F alleles in the development of lung, breast, bladder, colorectal and prostate cancers. Similarities were also observed for the implication of ApaI polymorphism in breast, renal and ovarian cancer studies [11, 37, 44]. The ApaI and two other VDR polymorphisms, BsmI and TaqI do not alter the amino acid sequence of the VDR protein [36]. They might yield important results when evaluated together with a haplotype analysis. The most frequent haplotypes in the 30 UTR of VDR gene are B-A-t and b-a-T [36]. Moreover, Thakkinstian et al. [4] indicated that the most common haplotype for the VDR gene, regardless of ethnicity, is B-A-t and b-A-T in Caucasians. In our study, the most frequent haplotype were G-A-T/b-AT (22.8 %) and A-A-C/B-A-t (22.3 %). The distribution of haplotypes in our population was consistent with the report of Thakkinstian et al. [4].Our results were similar to those observed in Caucasian ethnicity. The mechanisms through which VDR gene polymorphisms might modulate the susceptibility to lung cancer are still unclear. The findings regarding functional significance of VDR FokI polymorphism have been inconsistent [15, 19, 43]. It has been reported that the short 424-amino-acid VDR protein variant (C allele or F allele) is less effective than the long 427-amino-acid variant (T allele or f allele) in transactivation of the vitamin D (1, 25(OH) 2D3) signal [15]. Consequently, the potential beneficial effects of vitamin D such as anti-angiogenic, anti-invasive anti and proliferative properties [29, 31], were low in patients carrying the FokI F allele. These effects may be explained by the association between Fok F allele and high lung cancer risk observed in our population. The current study indicated that the patients with VDR FF, AA or Aa genotype had increased risk to develop an adenocarcinoma of the lung (AD). It has been reported that the increased VDR expression in lung AD patients was correlated with improved survival subjects. This correlation was due to a low proliferative status and G1 arrest in high VDR-expressing tumors [21]. Our findings suggested that the FokI and ApaI polymorphisms might be considered as potential biomarkers in the etiology of lung cancer, particularly the AD forms in the Tunisian population. Because smoking is an established cause of lung cancer, we evaluated whether a gene-environment interaction existed between the FokI or ApaI polymorphisms and smoking (Table 5). We did not detect any multiplicative interaction between VDR polymorphisms and tobacco smoking.Our results were in concordance to reported geneenvironment studies among Japanese and Caucasian
123
population [22, 23, 39]. Moreover, our findings suggested the presence of additive interaction between ApaI polymorphisms and tobacco smoking, which affects the risk of lung cancer development. In previously cited studies that had investigated VDR SNPs and lung cancer risk, geneenvironment interactions were not examined [5, 9, 18, 30]. To the best of our knowledge, no Tunisian studies on the ApaI and FokI polymorphisms SNP and tobacco smoking interaction with the risk of lung cancer were previously reported. Our data reported significant genetic association of VDR polymorphisms with lung cancer risk in the Tunisian population. VDR polymorphisms, contribute to better understanding the role of VDR in lung cancer development. In addition, investigation of the gene–gene and gene– environment interactions of the VDR gene, in association with lung cancer risk, may help to elucidate the molecular pathways in human lung cancer. Acknowledgments The authors thank all the and patients who participated in this study. The Tunisian ministry of high education and research supported this work. Many thanks to Professor Agnes Hamzaoui, head of Unit Research. UR/12-SP-15, Homeostasis and Cell Dysfunction. A. Mami Hospital of Pneumology, Ariana. Tunisia. Conflict of Interest
None.
References 1. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D (2011) Global cancer statistics. CA Cancer J Clin 61(2):69–90 2. Alberg AJ, Brock MV, Samet JM (2005) Epidemiology of lung cancer: looking to the future. J Clin Oncol 23(14):3175–3185 3. Andersson T, Alfredsson L, Kallberg H, Zdravkovic S, Ahlbom A (2005) Calculating measures of biological interaction. Eur J Epidemiol 20(7):575–579 4. Thakkinstian A, D’Este C, Attia J (2004) Haplotype analysis of VDR gene polymorphisms: a meta-analysis. Osteoporos Int 15(9):729–734 5. Xiong L, Cheng J, Gao J, Wang J, Liu X, Wang L (2013) Vitamin D receptor genetic variants are associated with chemotherapy response and prognosis in patients with advanced non-small-cell lung cancer. Clin Lung Cancer 14(4):433–439 6. Baker AR, McDonnell DP, Hughes M, Crisp TM, Mangelsdorf DJ, Haussler MR, Pike JW, Shine J, O’Malley BW (1988) Cloning and expression of full-length cDNA encoding human vitamin D receptor. Proc Natl Acad Sci USA 85(10):3294–3298 7. Barrett JC, Fry B, Maller J, Daly MJ (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21(2):263–265 8. Danaei G, Vander Hoorn S, Lopez AD, Murray CJ, Ezzati M; Comparative Risk Assessment collaborating group (Cancers) (2005) Causes of cancer in the world: comparative risk assessment of nine behavioural and environmental risk factors. Lancet 366(9499):1784–1793 9. Dogan I, Onen HI, Yurdaku AS, Konac E, Ozturk C, Varol A, Ekmekci A (2009) Polymorphisms in the vitamin D receptor gene and risk of lung cancer. Med Sci Monit 15(8):BR232–242 10. Turna A, Pekc¸olaklar A, Metin M, Yaylim I, Gurses A (2012) The effect of season of operation on the survival of patients with
Mol Biol Rep
11.
12.
13.
14.
15.
16.
17.
18.
19.
20. 21.
22.
23.
24.
25.
resected non-small cell lung cancer. Interact CardioVasc Thorac Surg 14(2):151–155 Hou MF, Tien YC, Lin GT, Chen CJ, Liu SY, Huang TJ (2002) Association of vitamin D receptor gene polymorphism with sporadic breast cancer in Taiwanese patients. Breast Cancer Res Treat 74(1):1–7 Huang SP, Huang CY, Wu WJ, Pu YS, Chen J, Chen YY, Yu CC, Wu TT, Wang JS, Lee YH, Huang JK, Huang CH, Wu MT (2006) Association of vitamin D receptor FokI polymorphism with prostate cancer risk, clinicopathological features and recurrence of prostate specific antigen after radical prostatectomy. Int J Cancer 119(8):1902–1907 Falleti E, Bitetto D, Fabris C, Cussigh A, Fontanini E, Fornasiere E, Fumolo E, Bignulin S, Cmet S, Minisini R, Pirisi M, Toniutto P (2010) Vitamin D receptor gene polymorphisms and hepatocellular carcinoma in alcoholic cirrhosis. World J Gastroenterol 16(24):3016–3024 Flu¨gge J, Krusekopf S, Goldammer M, Osswald E, Terhalle W, Malzahn U, Roots I (2007) Vitamin D receptor haplotypes protect against development of colorectal cancer. Eur J Clin Pharmacol 63(11):997–1005 Gross C, Krishnan AV, Malloy PJ, Eccleshall TR, Zhao XY, Feldman D (1998) The vitamin D receptor gene starts codon polymorphism: a functional analysis of FokI variants. J Bone Miner Res 13(11):1691–1699 Guy M, Lowe LC, Bretherton-Watt D, Mansi JL, Peckitt C, Bliss J, Given Wilson R, Thomas V, Colston KW (2004) Vitamin D receptor gene polymorphisms and breast cancer risk. Clin Cancer Res 10(16):5472–5481 Haussler MR, Whitfield GK, Haussler CA, Hsieh JC, Thompson PD, Selznick SH, Dominguez CE, Jurutka PW (1998) The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. J Bone Miner Res 13(3):325–349 Heist RS, Zhou W, Wang Z, Liu G, Neuberg D, Asomaning LSuK, Hollis BW, Lynch TJ, Wain JC, Giovannucci E, Christiani DC (2008) Circulating 25-Hydroxyvitamin D, VDR polymorphisms, and survival in advanced non-small cell lung cancer. J Clin Oncol 26(34):5596–5602 Jurutka PW, Remus LS, Whitfield GK, Thompson PD, Hsieh JC, Zitzer H, Tavakkoli P, Galligan MA, Dang HT, Haussler CA, Haussler MR (2000) The polymorphic N terminus in human vitamin D receptor isoforms influences transcriptional activity by modulating interaction with transcription factor IIB. Mol Endocrinol 14(3):401–420 Kalilani L, Atashili J (2006) Measuring additive interaction using odds ratios. Epidemiol Perspect Innov 18(3):5 Kim SH, Chen G, King AN, Jeon CK, Christensen PJ, Zhao L, Simpson RU, Thomas DG, Giordano TJ, Brenner DE, Hollis B, Beer DG, Ramnath N (2012) Characterization of vitamin D receptor (VDR) in lung adenocarcinoma. Lung Cancer 77(2):265–271 Kiyohara C, Takayama k, Nakanishi Y (2010) Lung cancer susceptibility and hOGG1 Ser326Cys Polymorphism: a meta-analysis. Cancers 2(4):1813–1829 Kiyohara C, Horiuchi T, Takayama K, Nakanishi Y (2010) IL1B rs1143634 polymorphism, cigarette smoking, alcohol use, and lung cancer risk in a Japanese population. J Thorac Oncol 5(3):299–304 Knol MJ, VanderWeele TJ, Groenwold RH, Klungel OH, Rovers MM, Grobbee DE (2011) Estimating measures of interaction on an additive scale for preventive exposures. Eur J Epidemiol 26(6):433–438 Ko¨stner K, Denzer N, Mu¨ller CS, Klein R, Tilgen W, Reichrath J (2009) The relevance of vitamin D receptor (VDR) gene polymorphisms for cancer: a review of the literature. Anticancer Res 29(9):3511–3536
26. Li C, Liu Z, Zhang Z, Strom SS, Gershenwald JE, Prieto VG, Lee JE, Ross MI, Mansfield PF, Cormier JN, Duvic M, Grimm EA, Wei Q (2007) Genetic variants of the vitamin D receptor gene alter risk of cutaneous melanoma. J Invest Dermatol 127(2):276–280 27. Miller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure for extractin DNA from human nucleated cells. Nucleic Acids Res 16(3):1215 28. Mittal RD, Manchanda PK, Bhat S, Hk Bid (2007) Association of vitamin-D receptor (Fok-I) gene polymorphism with bladder cancer in an Indian population. B J U Int 99(4):933–937 29. Nakagawa k, Sasaki Y, Kato S, Kubodera N, Okano T (2005) 22-Oxa-1a, 25- dihydroxyvitamin D3 inhibits metastasis and angiogenesis in lung cancer. Carcinogenesis 26(6):1044–1054 30. Zhou W, Heist R, Liu G, Neuberg D, Asomaning K, Su L, Wain JC, Lynch TJ, Giovannucci E, Christiani DC (2006) Polymorphisms of vitamin D receptor and survival in early-stage nonsmall cell lung cancer patients. Cancer Epidemiol Biomarkers Prev 15(11):2239–2245 31. Ordonez MP, Larriba MJ, Pendas-Franco N, Aguilera O, Gonzalez-Sancho JM, Munoz A (2005) Vitamin D and cancer: an update of in vitro and in vivo data. Front Biosci 1(10):2723–2749 32. Pani MA, Knapp M, Donner H, Braun J, Baur MP, Usadel KH, Badenhoop K (2000) Vitamin D receptor allele combinations influence genetic susceptibility to type 1 diabetes in germans. Diabetes 49(3):504–507 33. Park k, Woo M, Nam JH, Kim JC (2006) Start codon polymorphisms in the vitamin D receptor and colorectal cancer risk. Cancer Lett 237(2):199–206 34. Raimondi S, Johansson H, Maisonneuve P, andini S (2009) Review and meta-analysis on vitamin D receptor polymorphisms and cancer risk. Carcinogenesis 30(7):1170–1180 35. Risch A, Plass C (2008) Lung cancer epigenetics and genetics. Int J Cancer 123(1):1–7 36. Morrison NA, Qi JC, Tokita A, Kelly PJ, Crofts L, Nguyen TV (1994) Prediction of bone density from vitamin D receptor alleles. Nature 367(6460):284–287 37. Obara W, Suzuki Y, Kato K, Tanji S, Konda R, Fujioka T (2007) Vitamin D receptor gene polymorphisms are associated with increased risk and progression of renal cell carcinoma in a Japanese population. Int J Urol 14(6):483–487 38. Yee YK, Chintalacharuvu SR, Nagpal LJ (2005) Vitamin D receptor modulators for inflammation and cancer. Mini Rev Med Chem 5(8):761–778 39. Ter-Minassian M, Zhai R, Asomaning K, Su L, Zhou W, Liu G, Heist RS, Lynch TJ, Wain JC, Lin X, De Vivo I, Christiani DC (2008) Apoptosis gene polymorphisms, age, smoking and the risk of non-small cell lung cancer. Carcinogenesis 29(11):2147–2152 40. Uitterlinden AG, Fang Y, Van Meurs JB, Pols HA, Van Leeuwen JP (2004) Genetics and biology of vitamin D receptor polymorphisms. Gene 338(2):143–156 41. Sole´ X, Guino´ E, Valls J, Iniesta R, Moreno V (2006) SNPStats: a web tool for the analysis of association studies. Bioinformatics 22(15):1928–1929 42. Wang TT, Tavera-Mendoza LE, Laperriere D, Libby E, MacLeod NB, Nagai Y, Bourdeau V, Konstorum A, Lallemant B, Zhang R, Mader S, White JH (2005) Large- scale in silico and microarraybased identification of direct 1,25-dihydroxyvitamin D3 target genes. Mol Endocrinol 19(11):2685–2695 43. Whitfield GK, Remus LS, Jurutka PW, Zitzer H, Oza AK, Dang HT, Haussler CA, Galligan MA, Thatcher ML, Encinas DC, Haussler MR (2001) Functionally relevant polymorphisms in the human nuclear vitamin D receptor gene. Mol Cell Endocrinol 177(1–2):145–159 44. Lurie G, Wilkens LR, Thompson PJ, McDuffie KE, Carney ME, Terada KY, Goodman MT (2007) Vitamin D receptor gene polymorphisms and epithelial ovarian cancer risk. Cancer Epidemiol Biomarkers Prev 16(12):2566–2571
123
Association of vitamin D receptor FokI and ApaI polymorphisms with lung cancer risk in Tunisian population Wajih Kaabachi • Safa Kaabachi • Ahlem Rafrafi Amira ben Amor • Kalthoum Tizaoui • Faycal Haj sassi • Kamel Hamzaoui
•
Received: 22 May 2013 / Accepted: 19 June 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Many studies reported that Vitamin D Receptor (VDR) gene polymorphisms might influence the cancer risk due to their antiproliferative, antiangiogenic, and apoptotic effects. The aim of this study was to explore the genetic association of VDR polymorphisms with lung cancer risk in Tunisian population. The genotype and haplotype frequencies of four VDR polymorphisms, FokI (rs2228570), BsmI (rs1544410), ApaI (rs7975232) and TaqI (rs731236) were studied using polymerase chain reaction and restriction fragment length polymorphism analysis in 240 patients with lung cancer and 280 healthy controls. The distribution of genotype frequencies differed significantly between lung cancer subjects and controls (FokI Padj = 0.002; ApaI Padj = 0.013). Haplotype analyses revealed a significant association between G-A-C and A-C-T haplotypes and lung cancer risk (Pcorr = 0.0128, Pcorr = 0.008). When patients were stratified according to gender, age, and smoking, significant associations were detected with FokI and TaqI polymorphisms. We found a lack of association between BsmI, TaqI polymorphisms and lung cancer risk
Electronic supplementary material The online version of this article (doi:10.1007/s11033-014-3538-2) contains supplementary material, which is available to authorized users. W. Kaabachi (&) S. Kaabachi A. Rafrafi A. b. Amor K. Tizaoui F. Haj sassi K. Hamzaoui Department of Basic Sciences, Medicine School of Tunis, Tunis El Manar University, Tunis 1007, Tunisia e-mail: [email protected] S. Kaabachi e-mail: [email protected] A. Rafrafi e-mail: [email protected] A. b. Amor e-mail: [email protected]
(P [ 0.05). Only, the attributable proportion due to interaction and the synergic index for interaction between ApaI polymorphism and smoking were statistically significant (Padj = 0.74, 95 % CI = 0.38–1.20) and (Padj = 0.63, 95 % CI = 0.05–1.21), respectively. Both the additive interaction measures suggested the existence of a biological interaction between SNP ApaI, but not FokI, and smoking. The multiplicative interaction measure was not statistically significant (P [ 0.05). This is the first study in Tunisia, which suggested that VDR FokI and ApaI polymorphisms might be risk factors for lung cancer development. Keywords Lung cancer Single nucleotide polymorphism RFLP Vitamin D receptor Biological interaction
Introduction Lung cancer is currently the most occurring cancer worldwide in both men and women [1]. The underlying etiology for the development of lung cancer remains poorly
K. Tizaoui e-mail: [email protected] F. Haj sassi e-mail: [email protected] K. Hamzaoui e-mail: [email protected] W. Kaabachi S. Kaabachi A. Rafrafi A. b. Amor K. Tizaoui F. Haj sassi K. Hamzaoui Homeostasis and Cell Dysfunction, Research Unit UR/12-SP-15, A. Mami Hospital of Pneumology, Ariana, Tunisia
123
Mol Biol Rep
understood and needs elucidation. Previous studies have reported that both environmental and genetic risk factors might affect lung cancer development. Environmental factors could be listed as, age, gender, ethnicity, smoking habit, air pollution, lung disease history, and nutrition [2, 8]. Genetic factors can alter the risk of catching the disease. There have been numerous reported oncogenes, tumor suppressors, and DNA repair genes that interfere with the lung cancer process [35]. There has been much recent interest in the role of the vitamin D axis in lung disease, which includes vitamin D and vitamin D receptor (VDR). The vitamin D has been considered as a potential anti-proliferative, anti-angiogenic agent and responsible for decrease mortality caused by tumors, including lung cancer [29, 31]. The VDR gene is located on chromosome 12, to 12q13.11 [6] and is spanned approximately 100 kb long [40]. The DNA binding domain is encoded by exons 2–3, whereas the ligand-binding domain is encoded by exons 6–9 [17]. Calcitriol, the biologically most active metabolite of vitamin D (1, 25(OH) 2D3), binds to VDR with retinoic acid and controls the expression (or repress) at least 913 genes [26, 38, 42]. Since the expression and nuclear activation of VDR are necessary for the effects of vitamin D, four well-known polymorphisms FokI (C/T), BsmI (A/G), ApaI (A/C) and TaqI (T/C) identified in human VDR gene were extensively studied for their association with cancer risk [25, 34]. Several studies have analyzed the association of various VDR genetic variants with lung cancer risk, and the results were inconsistent [9, 18, 30]. Here we conducted a case–control study to evaluate the association between the VDR variants with lung cancer susceptibility in the Tunisian population. We also examined the eventual interaction between the VDR polymorphisms and cigarette smoking on the lung cancer risk. To our knowledge, no Tunisian case–control study regarding this issue has been previously reported.
females) were divided into two groups according to histopathological criteria, 202 patients with non small cell lung cancer (NSCLC) and 38 patients with small cell lung cancer. A, 280 controls subjects were selected from healthy blood volunteers’ donors, during the same period. The study was approved by the Institutional Ethics Committee of Medical University of Tunisia and written informed consent was obtained from all participants. VDR genotyping The genomic DNA was isolated from peripheral blood cells using a salting-out method [27]. Purity of DNA was measured by means of absorption spectrometry, and the samples with absorbance values from 1.8 to 2.0 at the length of A260/A280 were selected for polymerase chain reaction (PCR) amplification. The DNA samples were stored at -20 °C and the VDR gene polymorphisms were genotyped by PCR. The amplification was performed in a total volume of 25 ll, containing 50 ng of genomic DNA, (19) Taq polymerase buffer (Promega), 2.5 mM MgCl2, 0.5 mM of a dNTP-Mix (Promega), 20 pmol of each primer, 0.5 U of Go-Taq DNA polymerase (Promega) and Nuclease-Free Water (GIBCO). The primers used for amplification were listed in Table 1 [32]. The cycling conditions were set as follows: initial denaturation for 4 min at 94 °C, 30 cycles of 94 °C, annealing temperature was 58 °C (FokI) or 60 °C (BsmI/ApaI/TaqI) and 72 °C for each 1 min respectively, and final extension for 5 min at 72 °C. The volume of the restriction assays was 25 ll containing 10 ll of the PCR product, buffer, and 5 U of the appropriate restriction enzyme (Fermentas) listed in Table 1. Digested fragments were visualized on a 3 % agarose gel. For quality control, randomly selected PCR products were subjected for repeated genotyping to verify the RFLP results and concordance was 100 %. Samples with ambiguous results were repeated. Statistical analysis
Materials and methods Study population The study population was composed of 520 unrelated Tunisian whites’ subjects. A total of 240 lung cancer patients were recruited from September 2009 to February 2013. Different variables were recorded at the time of registration in 2009: sex, age, smoking, treatment modalities, clinical stage, clinical T factor, clinical N factor, clinical M factor and histological subtype of lung cancer (Table 2). Additionally, we investigated for all surgical cases the histopathological LVI (vascular, lymphatic invasion) parameters (Table 2). The lung cancer patients (224 males and 16
123
The allele and genotype frequencies of VDR polymorphisms were compared using the Chi square test (2 9 2 contingency Tables), the Open Epi Info7 and the IBM SPSS Statistics 19 softwares packages programs were used for analysis. When the expected cell frequencies were less than five, Fisher’s exact test was applied. We performed the logistic regression analysis to calculate the association. A P values of less than 0.05 likelihood ratio test [LRT], was considered statistically significant. The Hardy–Weinberg equilibrium was calculated for all samples. All statistical tests were two-sided. Haploview program version 4.2 was used to calculate the pairwise Linkage Disequilibrium (LD) between the
Mol Biol Rep Table 1 Restriction fragment length polymorphism conditions for the identification of VDR gene polymorphisms VDR SNPs
Amplicon (bp)
Primers for PCR amplification (50 –30 )
Restriction enzymes
Annealing temp. (°C)
Restriction fragment lengths (bp)
FokI C/T (F/f)
265
F: AGCTGGCCCTGGCACTGACTCTGCTCT
FokI
37
FF: 265
R: ATGGAAACACCTTGCTTCTTCTCCCTC
Ff: 265, 196 and 69 ff: 196 and 69
BsmI A/G (B/b)
825
F: CAACCAAGACTACAAGTACCGCGTCAGTGA
ApaI A/C (A/a)
740
F: CAGAGCATGGACAGGGAGCAA
BsmI
37
BB: 825
ApaI
65
AA: 740
R: AACCAGCGGGAAGAGGTCAAGGG
Bb: 825, 650 and 175
R: GCAACTCCTCATGGCTGAGGTCTC
Aa: 740, 530 and 210 aa: 530 and 210 bb: 650 and 175
TaqI T/C (T/t)
740
F: CAGAGCATGGACAGGGAGCAA
TaqI
R: GCAACTCCTCATGGCTGAGGTCTC
65
TT: 245 and 495 Tt: 495, 290, 245, and 205 tt: 290, 245, and 205
SNP single-nucleotide polymorphism, BP base pairs, F forward, R reverse
VDR SNPs [7]. The Haplotype frequencies and effects were performed using Haploview, a web-based calculator Snpstats [41] and Plink softwares. The P value for the patient-control differences in haplotype distributions were adjusted for multiple tests by Bonferroni correction. Only the allele frequencies of the haplotype[1 % were included in the analyses, those \1 % were excluded. We included an interaction term (genotype* smoking) into the logistic regression model, to test statistical (multiplicative) interactions. Alternative measures of interactions on the additive scale were based on ORs. Three measures for additive interaction, namely the relative excess risk due to interaction (RERI), attributable proportion (AP), and synergy index (SI), were calculated using the method described by Andersson et al. [3]. RERI = 0, AP = 0, or S = 1 means no interaction or strict additivity; RERI [ 0, AP [ 0, or S [ 1 means positive interaction or more than additivity; RERI \ 0, AP \ 0, or S \ 1 means negative interaction or less than additivity [24]. If any of the null values (0 in RERI and AP or 1 in S) falls outside the 95 % CI of its respective measurement, then the additive interaction is considered statistically significant [3, 20, 24].
Results A total of 240 patients and 280 controls were genotyped for the VDR FokI, BsmI, ApaI and TaqI polymorphisms. The mean age (±SD) of patients group was 58, 51 ± 10.25 years and the mean age of controls group was 52.64 ± 6.36 years. We divided subjects into two age groups, the first included the youngest aged subjects ranged between 30 and 55 years and the second included the oldest aged subjects ranged between 56 and 85 years. According
to tobacco smoking habit, subjects were considered never smokers if they had never smoked in their lifetime. Current smokers or habitual smokers if they had smoked or stopped smoking less than 1 year before either the date of diagnosis of lung cancer. Former smokers were defined as those who had stopped smoking one or more years before either the date of diagnosis of lung cancer. Due to the small number of former smoker (10 patients), Current and former smokers were combined in ever smokers group for subsequent statistical analysis. The most histological lung cancer type observed was adenocarcinoma of the lung (60 %) and more than 80 % of patients had advanced lung tumor stages. We reported detailed clinical characteristics of sample study population in Table 2. The distribution of genotypes and allele frequencies of VDR gene polymorphisms The distribution of genotype frequencies of VDR gene polymorphisms were in agreement with Hardy–Weinberg equilibrium (P [ 0.05). Significant genotypic distributions between lung cancer patients and healthy controls were noted for the VDR FokI (Padj = 0.002), and ApaI (Padj = 0.013) variants. For the FokI polymorphism, the frequency of FF genotype in the lung cancer group (55.8 %) was higher than the corresponding value in the control group (41.4 %). The distribution of F allele frequencies were significantly different between patient and control groups (P = 0.001). In addition, patients carrying one copy of F allele were twice and a half as likely to develop lung cancer than healthy individuals (ORadj = 2.45, 95 % CI = 1.10–5.18). The major C allele (F variant) of FokI polymorphism conferred an increased lung cancer risk than the minor T allele (f variant) in our population (Table 3).
123
Mol Biol Rep Table 2 Clinical characteristics of the case–control study population
Characteristics
Lung cancer cases
Number of subjects Age
Smoking statusb
240
280
Mean (±SDa)
58.51 ± 10.25
52.64 ± 6.36
Range (years)
30–85
39–69
a
SD standard deviation
b
Includes cigarettes (tobacco) and water pipes (equivalent to more than one packet of cigarettes)
154(55.0 %)
10(0.041 %)
4(0.014 %)
144 (60 %)
Squamous cell lung carcinoma
58 (24.16 %)
Small cell lung carcinoma
38 (15.83 %) 14 (5.8 %) 226 (94.2 %)
UICC-TNMd
Clinical T factore
Clinical M factorg
f
Traitements
LVI
h
T2
28 (11.66 %)
T3
34 (14.16 %)
T4
178 (74.16 %)
N0 N1
32 (13.33 %) 27 (11.25 %)
N2
94 (39.16 %)
N3
61 (25.41 %)
NXi
26 (10.83 %)
M0
92 (34.45 %)
M1
174 (65.16 %)
MXj
1 (0.37 %)
Chemoradiotherapy
16 (6.66 %)
Surgery
14 (5.80 %)
Yes No
9(64.48 %) 5(35.71 %)
Chemotherapy
210 (87.5 %)
Others
g
Lymphatic invasion
i
Vascular invasion
MX means metastasis can’t be evaluated
For the ApaI polymorphism, individuals with AA or Aa genotype showed a statistically significant association with higher lung cancer risk compared with those sharing aa genotype (Padj = 0.013). The OR was calculated, and carriers with one or two copies of A allele were 2.30 and 2.64 times as likely to develop lung cancer (OR adj = 2.30, 95 % CI = 1.22–4.35) and (OR adj = 2.64, 95 % CI = 1.37–5.07), respectively. The major A allele (A variant) of ApaI polymorphism was associated with higher lung cancer risk than the minor C allele (a variant) in our population (Table 3).
123
212(88.33 %)
Former or ex-smokers Adenocarcinoma
Clinical N factorf
122(43.57 %)
Current
III or IV (Advanced)
UICC, International Union Against Cancer; TNM, tumor, node, metastasis e Clinical T factor stands for tumor
j
56–85 18(7.56 %)
d
NX means the nearby lymph nodes cannot be evaluated
Oldest subject
I or II (Early)
Current and former smokers were combined in ever smokers group
Clinical M factor stands for metastasis h LVI, vascular, lymphatic invasion
30–55
Pathologic Stage
c
Clinical N factor stands for Lymphe node
Youngest subject Non smokers Smokersc
Histologic cell type
Controls
Yes
6(42.58 %)
No
8(57.14 %)
For the BsmI and TaqI polymorphisms, no differences were observed in genotype distributions and allele frequencies between cases and controls. The BsmI and TaqI polymorphisms were not associated with lung cancer risk (Table 3). Linkage disequilibrium analysis of the VDR SNPs were conducted and illustrated in Fig. 1. The 30 UTR VDR SNPs (BsmI-ApaI-TaqI) showed significant LD with each other. We had also estimated haplotypes for the VDR polymorphisms located in the 30 UTR region. The VDR haplotype frequencies were represented in
Mol Biol Rep Table 3 Genotype distributions and allele frequencies of VDR polymorphisms between cases and control VDR SNPs
Genotypes/ alleles
n (%) of
Logistic regression analysis
Cases (n = 240)
Controls (n = 280)
Crude OR (95 % CI)
ff (TT)
16 (6.7)
30 (10.7)
Ff (CT) FF (CC)
90 (37.5) 134 (55.8)
134 (47,9) 116 (41,4)
1.25 (0.64–2.44) 2.16 (1.12–4.17)
f (T)
122 (25.4)
194 (34.6)
1.00
F (C)
358 (74.5)
366 (65.3)
1.56 (1.18–2.05)
FokI F/f (C/T)
Pa value
Adjusted OR (95 % CI)
0.004 1.00c
BsmI B/b (A/G)
Pb value 0.002
1.00 0.495 0.021
1.25 (0.59–2.66) 2.45 (1.10–5.18)
0.553 0.019
0.001 0.970
1.00c
0.735
bb (GG)
74 (30.8)
84 (30.0)
Bb (AG)
126 (52.5)
150 (53.6)
0.95 (0.58–1.67)
0.812
0.83 (0.53–1.31)
0.432
BB (AA)
40 (16.7)
46 (16.7)
0.98 (0.64–1.41)
0.961
0.89 (0.48–1.62)
0.704
b (G)
274 (57.0)
318 (56.7)
1.00
B (A)
206 (42.9)
242 (43.2)
0.99 (0.77–1.27)
ApaI A/a (A/C)
1.00
0.923 0.029
1.00c
0.013
aa (CC)
21 (8.8)
46 (16.4)
Aa (AC)
118 (49.2)
134 (47.9)
1.92 (1.08–3.41)
0.024
2.30 (1.22–4.35)
0.010
AA (AA)
101 (42.1)
100 (35.7)
2.21 (1.23–3.97)
0.008
2.64 (1.37–5.07)
0.003
a (C)
160 (33.3)
226 (40.35)
1.00
A (A)
320 (66.6)
334 (59.64)
1.35 (1.04–1.76)
tt (CC)
32 (13.3)
36 (12.9)
Tt (TC)
118 (49.2)
146 (52.1)
TaqI T/t (T/C)
TT (TT)
1.00
0.019 0.790
1.00c
0.151 1.00
0.90 (0.53–1.55)
0.727
0.79 (0.43–1.44)
0.455
1.03 (0.59–1.80)
0.908
1.23 (0.65–2.31)
0.520
90 (37.5)
98 (35.0)
t (C)
182 (37.9)
218 (38.9)
1.00
T (T)
298 (62.0)
342 (61.0)
1.04 (0.81–1.35)
0.738
CI confidence interval, OR odds ratio, SNP single-nucleotide polymorphism, N number a
Two-tailed Pearson’s v2-test
b
Adjusted for age, sex, and smoking
c
The [ff], [bb], [aa] and [tt] are the reference groups
Table 4. The most frequent haplotypes in our population were G-A-T or b-A-T (22.8 %) and A-A-C or B-At (22.3 %). The frequency of the haplotype G-A-C was significantly associated with increased lung cancer risk (OR = 4.48, 95 % CI = 2.18–9.20, Pcorr = 0.0128). Similarly, A-C-T haplotype was found significantly (Pcorr = 0.008) more frequent in healthy individuals (11.2 %) than in cases (2.8 %) and was associated with high lung cancer risk (OR = 5.82, 95 %CI = 2.63–12.86). This result confirms the high lung cancer risk associated to the ApaI A alleles (Table 4). The simultaneous analysis of VDR haplotype frequencies of FokI (C/T), BsmI (A/G), ApaI (A/C) and TaqI (T/ C), revealed high prevalence of C-G-C-T or F-b-aT (16.24 %) and C-A-A-C or F-B-A-t (16.21 %) haplotypes in cases and controls. The frequencies of most haplotypes having C or F allele (C-G-C-T, C-A-A-C and C-G-A-
T) were higher in lung cancer cases compared to controls (Supplementary Table 1). Genotype distributions and allele frequencies of VDR FokI and ApaI polymorphisms according to gender, age and tobacco smoking status The stratification of our population according to gender status indicated that, F allele was significantly associated with higher risk among women subjects (OR = 4.29, CI = 1.39–13.18, P = 0.007) than men subjects (OR = 1.44, CI = 1.44–1.93, P = 0.012). For ApaI polymorphism, the men subjects with one copy or two copies of A allele had a 2.51 and 2.96 fold increased risk to develop lung cancer (Padj = 0.004 and Padj = 0.001), respectively. When we stratified our population by age and smoking status, we found that the oldest age-subjects with two copies
123
Mol Biol Rep
Genotype distributions and allele frequencies of VDR FokI and ApaI polymorphisms according to histological types and tumor stages
Fig. 1 Pairwise linkage analysis of 4 SNPs in the VDR gene as measured by D0 . The number on each cell indicates the Log of Odds (LOD) score of Linkage disequilibrium LD (D0 9 10-2) between the respective pairs and strength is depicted by progression of grayscale intensity (min = 0 = white; max = 1.0 = dark grey). The darkest colour represents strongest linkage disequilibium. The chromosome positions of each SNP taken as reference
of F allele had a higher risk to develop lung cancer (OR = 3.96, CI = 1.38–11.33, PAdj = 0.010) than healthy subjects. In contradiction, the youngest age-subjects with two copies of A allele had an increased risk to develop lung cancer (OR = 3.91, CI = 1.53–9.99, PAdj = 0.004) than healthy individuals. The stratification related to smoking status indicated that the F allele was associated (P = 0.0047) with increased lung cancer risk with the non-smokers subjects (OR = 3.45, CI = 1.32–9.50). Inversely, the smokers subjects with one or two copies of A allele were 2.52 and 2.62 times as likely to develop lung cancer, (Padj = 0.007, Padj = 0.007), respectively (Supplementary Table 2–4).
Table 4 Analysis of VDR haplotype frequencies with the risk of lung cancer
Stratification by histologic cell types indicated a difference in allelic and genotypic distribution of VDR polymorphisms among the histological lung cancer groups. For FokI polymorphism, the subjects carrying FF genotype were 2.43 times as likely to develop an adenocarcinoma (AD) of the lung (OR = 2.43, 95 % CI = 1.04–5.64; PAdj = 0.039). For ApaI polymorphism, the subjects with Aa or aa genotype were twice and a half as likely to develop an AD of the lung (OR = 2.57, 95 % CI = 1.21–5.46; PAdj = 0.014). In addition, the subjects with Aa genotype had 3.17 fold increased risk to develop an epidemoide carcinoma of the lung (OR = 3.17, 95 % CI = 1.09–9.20; PAdj = 0.014). After stratification by tumor stage, our results suggested that, the subjects with two copies of F allele had a 3.26 fold high risk to reach an advanced stage of the lung (OR = 3.26, 95 % CI = 1.44–7.36; PAdj = 0.004). Furthermore, the subjects carrying the homozygous AA or Aa genotype had a 2.78 and 2.26 fold increased risk to reach an advanced stage of the lung (PAdj = 0.003; PAdj = 0.014) (Supplementary Table 6, 7). Gene-environment interactions between VDR FokI, ApaI polymorphisms and smoking For the gene-environment interaction study between VDR polymorphisms and tobacco smoking, we combined subjects, with at least one FokI F or ApaI A allele copies, in one group. Smokers with at least one copy of the F or A allele had a higher risk to develop lung cancer than those with the homozygous ff or aa genotype. The multiplicative interaction measures were not significant for the FokI (PAdj = 0.261) and ApaI (PAdj = 0.472) polymorphisms. Additionally, the additive interactions between VDR SNPs and smoking were examined (Table 5). The estimated SI (SIadj = 2.78, 95 %
Haplotype BsmIApaI-TaqI
Total frequency
Case frequency
Control frequency
Haplotype effect OR (95 % CI)
P value
Pc value
G-A-T/b-A-T
0.228
0.283
0.171
1.00a
–
–
A-A-C/B-A-t
0.223
0.271
0.165
1.15 (0.75–1.77)
0.53
4.24
G-C-T/b-a-T
0.222
0.236
0.204
1.43 (0.90–2.26)
0.13
1.04
A-A-T/B-A-T
0.093
0.073
0.122
2.21 (1.16–4.20)
0.016
0.128
Pc value with Bonferroni correction
G-A-C/b-A-t
0.083
0.038
0.137
4.48 (2.18–9.20)
1.10-4
8.10-4
A-C-T/B-a-T
0.070
0.028
0.112
5.82 (2.63–12.86) \0.0001 \0.0008
N number, CI confidence interval, OR odds ratio
A-C-C/B-a-t
0.043
0.056
0.032
0.95 (0.38–2.39)
0.92
7.36
G-C-C/b-a-t
0.035
0.012
0.054
5.78 (1.86–17.98)
0.0026
0.0508
a
The reference group
123
Mol Biol Rep Table 5 Interaction of VDR ApaI polymorphism and cigarette smoking VDR SNPs
Genotypes
ApaI
aa
Smoking
N of cases/ controls
Crude
Adjusted
Never
2/15
1.00c
AA ? Aa
Never
19/107
G
1.33 (0.27–12.91)
1.000
0.88 (0.17–4.63)
1.00
aa AA ? Aa
Ever Ever
19/31 200/127
E EG
4.59 (0.94–22.63) 11.81 (2.65–52.51)
0.059 110-3
5.38 (0.96–30.13) 11.67 (2.48–45.7)
0.05 210-3
1.92 (0.36–10.25)
0.441
1.88 (0.33–10.51)
0.47
OR (95 % CI)
Multiplicative interaction measure
a
Pb value
OR (95 % CI)
P value
1.00c
Additive interaction measure
Additive interaction values
(95 % CI)
Additive interaction values
(95 % CI)
Relative excess risk due to interaction (RERI)
6.88
(-2.58–16.35)
7.04
(-2.95–17.04)
Attributable proportion due to interaction (AP)
0.58
(0.30–0.85)
0.58
(0.30–0.87)
Synergy index for interaction (SI)
2.75
(1.05–7.14)
2.78
(1.04–7.47)
Estimate values of RERI, AP and SI CI confidence interval, OR odds ratio, SNP single-nucleotide polymorphism, N number, G the genetic factor, E the environmental factor a
The P value for v2 test or fisher’s exact tests
b
Adjusted for age and sex status Subject non-smoker with [aa] is the reference group
c
CI = 1.04–7.47) and AP (APadj = 0.58, 95 % CI = 0.30–0.87) measures for the ApaI polymorphism were statistically significant, though RERI was not (Table 5). The additive interaction between ApaI polymorphism and smoking was significant. For the FokI polymorphism, the different measures for the additive interaction were not significant (Supplementary Table 5).
Discussion Lung cancer is a complex disease for which underlying causes remain unclear. There is growing evidence of a malignancy role for vitamin D and VDR in lung cancer. The objective of this case–control study was to evaluate the association between VDR gene polymorphisms and the risk for lung cancer among Tunisian patients. Our results revealed a significant association between VDR FokI (Padj = 0.004), ApaI (Padj = 0.029) polymorphisms and lung cancer risk. Our study showed that the FokI FF genotype (ORadj = 2.45, 95 % CI = 1.10–5.18) and ApaI AA genotype (ORadj = 2.64, 95 % CI = 1.37–5.07) were associated with higher increased lung cancer risk compared with the ff and aa genotypes, respectively. No significant difference was found in the distribution of genotypes and allele frequencies between patients and healthy controls for BsmI (P = 0.97) and TaqI (P = 0.79) polymorphisms. The BsmI and TaqI polymorphisms were not associated with lung cancer risk. Furthermore, we did not report any multiplicative
interactions between VDR polymorphisms and tobacco smoking. However, we found an additive interaction between ApaI but not FokI polymorphism, and tobacco smoking on the risk of lung cancer among Tunisians. The genotypes distribution of FokI and ApaI polymorphisms vary considerably across ethnic groups. The high frequencies of the FF and AA genotypes in control subjects, reported in the current study, were similar to those observed in Turkish, German and Italian populations [9, 13, 14]. This similarity in genotypes distribution suggested an ancestral common origin. The association of FokI F and ApaI A alleles with increased lung cancer risk in our study, was not reported before in Tunisian population. The FokI polymorphism results were also in concordance with the reported findings by Turna et al. [10]. The F allele in TTFF combined genotype of VDR gene was associated with worse survival in resected NSCLC patients [10]. In contrast, Heist et al. [18] reported that Fok F and BsmI B alleles were associated with improved survival in the advanced NSCLC population. For ApaI and TaqI polymorphisms located in the 30 UTR of the VDR gene, our results were different from previous findings of Dogan et al. [9] in Turkish population, in which TaqI polymorphism was associated with lung cancer risk while ApaI variant was not. Morover, Xiong et al. [5] demonstrated, in the Chinese population, that aa genotype carriers of ApaI polymorphism had a longer mean overall survival (OS) compared with AA carriers in patients with NSCLC.
123
Mol Biol Rep
The VDR FokI and ApaI polymorphisms were also investigated for their association with cancer risk. Our findings were concordant to reported results of Turna et al., Huang et al., Guy et al., Mittal et al., and Park et al. [10, 12, 16, 28, 33], with significant malignancy role of FokI F alleles in the development of lung, breast, bladder, colorectal and prostate cancers. Similarities were also observed for the implication of ApaI polymorphism in breast, renal and ovarian cancer studies [11, 37, 44]. The ApaI and two other VDR polymorphisms, BsmI and TaqI do not alter the amino acid sequence of the VDR protein [36]. They might yield important results when evaluated together with a haplotype analysis. The most frequent haplotypes in the 30 UTR of VDR gene are B-A-t and b-a-T [36]. Moreover, Thakkinstian et al. [4] indicated that the most common haplotype for the VDR gene, regardless of ethnicity, is B-A-t and b-A-T in Caucasians. In our study, the most frequent haplotype were G-A-T/b-AT (22.8 %) and A-A-C/B-A-t (22.3 %). The distribution of haplotypes in our population was consistent with the report of Thakkinstian et al. [4].Our results were similar to those observed in Caucasian ethnicity. The mechanisms through which VDR gene polymorphisms might modulate the susceptibility to lung cancer are still unclear. The findings regarding functional significance of VDR FokI polymorphism have been inconsistent [15, 19, 43]. It has been reported that the short 424-amino-acid VDR protein variant (C allele or F allele) is less effective than the long 427-amino-acid variant (T allele or f allele) in transactivation of the vitamin D (1, 25(OH) 2D3) signal [15]. Consequently, the potential beneficial effects of vitamin D such as anti-angiogenic, anti-invasive anti and proliferative properties [29, 31], were low in patients carrying the FokI F allele. These effects may be explained by the association between Fok F allele and high lung cancer risk observed in our population. The current study indicated that the patients with VDR FF, AA or Aa genotype had increased risk to develop an adenocarcinoma of the lung (AD). It has been reported that the increased VDR expression in lung AD patients was correlated with improved survival subjects. This correlation was due to a low proliferative status and G1 arrest in high VDR-expressing tumors [21]. Our findings suggested that the FokI and ApaI polymorphisms might be considered as potential biomarkers in the etiology of lung cancer, particularly the AD forms in the Tunisian population. Because smoking is an established cause of lung cancer, we evaluated whether a gene-environment interaction existed between the FokI or ApaI polymorphisms and smoking (Table 5). We did not detect any multiplicative interaction between VDR polymorphisms and tobacco smoking.Our results were in concordance to reported geneenvironment studies among Japanese and Caucasian
123
population [22, 23, 39]. Moreover, our findings suggested the presence of additive interaction between ApaI polymorphisms and tobacco smoking, which affects the risk of lung cancer development. In previously cited studies that had investigated VDR SNPs and lung cancer risk, geneenvironment interactions were not examined [5, 9, 18, 30]. To the best of our knowledge, no Tunisian studies on the ApaI and FokI polymorphisms SNP and tobacco smoking interaction with the risk of lung cancer were previously reported. Our data reported significant genetic association of VDR polymorphisms with lung cancer risk in the Tunisian population. VDR polymorphisms, contribute to better understanding the role of VDR in lung cancer development. In addition, investigation of the gene–gene and gene– environment interactions of the VDR gene, in association with lung cancer risk, may help to elucidate the molecular pathways in human lung cancer. Acknowledgments The authors thank all the and patients who participated in this study. The Tunisian ministry of high education and research supported this work. Many thanks to Professor Agnes Hamzaoui, head of Unit Research. UR/12-SP-15, Homeostasis and Cell Dysfunction. A. Mami Hospital of Pneumology, Ariana. Tunisia. Conflict of Interest
None.
References 1. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D (2011) Global cancer statistics. CA Cancer J Clin 61(2):69–90 2. Alberg AJ, Brock MV, Samet JM (2005) Epidemiology of lung cancer: looking to the future. J Clin Oncol 23(14):3175–3185 3. Andersson T, Alfredsson L, Kallberg H, Zdravkovic S, Ahlbom A (2005) Calculating measures of biological interaction. Eur J Epidemiol 20(7):575–579 4. Thakkinstian A, D’Este C, Attia J (2004) Haplotype analysis of VDR gene polymorphisms: a meta-analysis. Osteoporos Int 15(9):729–734 5. Xiong L, Cheng J, Gao J, Wang J, Liu X, Wang L (2013) Vitamin D receptor genetic variants are associated with chemotherapy response and prognosis in patients with advanced non-small-cell lung cancer. Clin Lung Cancer 14(4):433–439 6. Baker AR, McDonnell DP, Hughes M, Crisp TM, Mangelsdorf DJ, Haussler MR, Pike JW, Shine J, O’Malley BW (1988) Cloning and expression of full-length cDNA encoding human vitamin D receptor. Proc Natl Acad Sci USA 85(10):3294–3298 7. Barrett JC, Fry B, Maller J, Daly MJ (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21(2):263–265 8. Danaei G, Vander Hoorn S, Lopez AD, Murray CJ, Ezzati M; Comparative Risk Assessment collaborating group (Cancers) (2005) Causes of cancer in the world: comparative risk assessment of nine behavioural and environmental risk factors. Lancet 366(9499):1784–1793 9. Dogan I, Onen HI, Yurdaku AS, Konac E, Ozturk C, Varol A, Ekmekci A (2009) Polymorphisms in the vitamin D receptor gene and risk of lung cancer. Med Sci Monit 15(8):BR232–242 10. Turna A, Pekc¸olaklar A, Metin M, Yaylim I, Gurses A (2012) The effect of season of operation on the survival of patients with
Mol Biol Rep
11.
12.
13.
14.
15.
16.
17.
18.
19.
20. 21.
22.
23.
24.
25.
resected non-small cell lung cancer. Interact CardioVasc Thorac Surg 14(2):151–155 Hou MF, Tien YC, Lin GT, Chen CJ, Liu SY, Huang TJ (2002) Association of vitamin D receptor gene polymorphism with sporadic breast cancer in Taiwanese patients. Breast Cancer Res Treat 74(1):1–7 Huang SP, Huang CY, Wu WJ, Pu YS, Chen J, Chen YY, Yu CC, Wu TT, Wang JS, Lee YH, Huang JK, Huang CH, Wu MT (2006) Association of vitamin D receptor FokI polymorphism with prostate cancer risk, clinicopathological features and recurrence of prostate specific antigen after radical prostatectomy. Int J Cancer 119(8):1902–1907 Falleti E, Bitetto D, Fabris C, Cussigh A, Fontanini E, Fornasiere E, Fumolo E, Bignulin S, Cmet S, Minisini R, Pirisi M, Toniutto P (2010) Vitamin D receptor gene polymorphisms and hepatocellular carcinoma in alcoholic cirrhosis. World J Gastroenterol 16(24):3016–3024 Flu¨gge J, Krusekopf S, Goldammer M, Osswald E, Terhalle W, Malzahn U, Roots I (2007) Vitamin D receptor haplotypes protect against development of colorectal cancer. Eur J Clin Pharmacol 63(11):997–1005 Gross C, Krishnan AV, Malloy PJ, Eccleshall TR, Zhao XY, Feldman D (1998) The vitamin D receptor gene starts codon polymorphism: a functional analysis of FokI variants. J Bone Miner Res 13(11):1691–1699 Guy M, Lowe LC, Bretherton-Watt D, Mansi JL, Peckitt C, Bliss J, Given Wilson R, Thomas V, Colston KW (2004) Vitamin D receptor gene polymorphisms and breast cancer risk. Clin Cancer Res 10(16):5472–5481 Haussler MR, Whitfield GK, Haussler CA, Hsieh JC, Thompson PD, Selznick SH, Dominguez CE, Jurutka PW (1998) The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. J Bone Miner Res 13(3):325–349 Heist RS, Zhou W, Wang Z, Liu G, Neuberg D, Asomaning LSuK, Hollis BW, Lynch TJ, Wain JC, Giovannucci E, Christiani DC (2008) Circulating 25-Hydroxyvitamin D, VDR polymorphisms, and survival in advanced non-small cell lung cancer. J Clin Oncol 26(34):5596–5602 Jurutka PW, Remus LS, Whitfield GK, Thompson PD, Hsieh JC, Zitzer H, Tavakkoli P, Galligan MA, Dang HT, Haussler CA, Haussler MR (2000) The polymorphic N terminus in human vitamin D receptor isoforms influences transcriptional activity by modulating interaction with transcription factor IIB. Mol Endocrinol 14(3):401–420 Kalilani L, Atashili J (2006) Measuring additive interaction using odds ratios. Epidemiol Perspect Innov 18(3):5 Kim SH, Chen G, King AN, Jeon CK, Christensen PJ, Zhao L, Simpson RU, Thomas DG, Giordano TJ, Brenner DE, Hollis B, Beer DG, Ramnath N (2012) Characterization of vitamin D receptor (VDR) in lung adenocarcinoma. Lung Cancer 77(2):265–271 Kiyohara C, Takayama k, Nakanishi Y (2010) Lung cancer susceptibility and hOGG1 Ser326Cys Polymorphism: a meta-analysis. Cancers 2(4):1813–1829 Kiyohara C, Horiuchi T, Takayama K, Nakanishi Y (2010) IL1B rs1143634 polymorphism, cigarette smoking, alcohol use, and lung cancer risk in a Japanese population. J Thorac Oncol 5(3):299–304 Knol MJ, VanderWeele TJ, Groenwold RH, Klungel OH, Rovers MM, Grobbee DE (2011) Estimating measures of interaction on an additive scale for preventive exposures. Eur J Epidemiol 26(6):433–438 Ko¨stner K, Denzer N, Mu¨ller CS, Klein R, Tilgen W, Reichrath J (2009) The relevance of vitamin D receptor (VDR) gene polymorphisms for cancer: a review of the literature. Anticancer Res 29(9):3511–3536
26. Li C, Liu Z, Zhang Z, Strom SS, Gershenwald JE, Prieto VG, Lee JE, Ross MI, Mansfield PF, Cormier JN, Duvic M, Grimm EA, Wei Q (2007) Genetic variants of the vitamin D receptor gene alter risk of cutaneous melanoma. J Invest Dermatol 127(2):276–280 27. Miller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure for extractin DNA from human nucleated cells. Nucleic Acids Res 16(3):1215 28. Mittal RD, Manchanda PK, Bhat S, Hk Bid (2007) Association of vitamin-D receptor (Fok-I) gene polymorphism with bladder cancer in an Indian population. B J U Int 99(4):933–937 29. Nakagawa k, Sasaki Y, Kato S, Kubodera N, Okano T (2005) 22-Oxa-1a, 25- dihydroxyvitamin D3 inhibits metastasis and angiogenesis in lung cancer. Carcinogenesis 26(6):1044–1054 30. Zhou W, Heist R, Liu G, Neuberg D, Asomaning K, Su L, Wain JC, Lynch TJ, Giovannucci E, Christiani DC (2006) Polymorphisms of vitamin D receptor and survival in early-stage nonsmall cell lung cancer patients. Cancer Epidemiol Biomarkers Prev 15(11):2239–2245 31. Ordonez MP, Larriba MJ, Pendas-Franco N, Aguilera O, Gonzalez-Sancho JM, Munoz A (2005) Vitamin D and cancer: an update of in vitro and in vivo data. Front Biosci 1(10):2723–2749 32. Pani MA, Knapp M, Donner H, Braun J, Baur MP, Usadel KH, Badenhoop K (2000) Vitamin D receptor allele combinations influence genetic susceptibility to type 1 diabetes in germans. Diabetes 49(3):504–507 33. Park k, Woo M, Nam JH, Kim JC (2006) Start codon polymorphisms in the vitamin D receptor and colorectal cancer risk. Cancer Lett 237(2):199–206 34. Raimondi S, Johansson H, Maisonneuve P, andini S (2009) Review and meta-analysis on vitamin D receptor polymorphisms and cancer risk. Carcinogenesis 30(7):1170–1180 35. Risch A, Plass C (2008) Lung cancer epigenetics and genetics. Int J Cancer 123(1):1–7 36. Morrison NA, Qi JC, Tokita A, Kelly PJ, Crofts L, Nguyen TV (1994) Prediction of bone density from vitamin D receptor alleles. Nature 367(6460):284–287 37. Obara W, Suzuki Y, Kato K, Tanji S, Konda R, Fujioka T (2007) Vitamin D receptor gene polymorphisms are associated with increased risk and progression of renal cell carcinoma in a Japanese population. Int J Urol 14(6):483–487 38. Yee YK, Chintalacharuvu SR, Nagpal LJ (2005) Vitamin D receptor modulators for inflammation and cancer. Mini Rev Med Chem 5(8):761–778 39. Ter-Minassian M, Zhai R, Asomaning K, Su L, Zhou W, Liu G, Heist RS, Lynch TJ, Wain JC, Lin X, De Vivo I, Christiani DC (2008) Apoptosis gene polymorphisms, age, smoking and the risk of non-small cell lung cancer. Carcinogenesis 29(11):2147–2152 40. Uitterlinden AG, Fang Y, Van Meurs JB, Pols HA, Van Leeuwen JP (2004) Genetics and biology of vitamin D receptor polymorphisms. Gene 338(2):143–156 41. Sole´ X, Guino´ E, Valls J, Iniesta R, Moreno V (2006) SNPStats: a web tool for the analysis of association studies. Bioinformatics 22(15):1928–1929 42. Wang TT, Tavera-Mendoza LE, Laperriere D, Libby E, MacLeod NB, Nagai Y, Bourdeau V, Konstorum A, Lallemant B, Zhang R, Mader S, White JH (2005) Large- scale in silico and microarraybased identification of direct 1,25-dihydroxyvitamin D3 target genes. Mol Endocrinol 19(11):2685–2695 43. Whitfield GK, Remus LS, Jurutka PW, Zitzer H, Oza AK, Dang HT, Haussler CA, Galligan MA, Thatcher ML, Encinas DC, Haussler MR (2001) Functionally relevant polymorphisms in the human nuclear vitamin D receptor gene. Mol Cell Endocrinol 177(1–2):145–159 44. Lurie G, Wilkens LR, Thompson PJ, McDuffie KE, Carney ME, Terada KY, Goodman MT (2007) Vitamin D receptor gene polymorphisms and epithelial ovarian cancer risk. Cancer Epidemiol Biomarkers Prev 16(12):2566–2571
123
