Reprod Dom Anim 50, 168–171 (2015); doi: 10.1111/rda.12459 ISSN 0936–6768
Short Communication Association Between ETFA Genotype and Activity of Superoxide Dismutase, Catalase and Glutathione Peroxidase in Cryopreserved Sperm of Holstein–Friesian Bulls DM Hering1, M Lecewicz2, W Kordan2 and S Kaminski1 1 Department of Animal Genetics, University of Warmia and Mazury, Olsztyn, Poland; 2Department of Animal Biochemistry and Biotechnology, University of Warmia and Mazury, Olsztyn, Poland
Contents The aim of this study was to determine whether C/T missense mutation within the ETFA gene is associated with sperm antioxidant enzymatic activity. One hundred and twenty Holstein–Friesian bulls were genotyped by the PCR-RFLP technique (MwoI). Commercial straws of frozen-thawed semen were used to evaluate the activity of three antioxidant enzymes: superoxide dismutase, catalase and glutathione peroxidase. Among all bulls investigated, genotype CT was the most frequent (44.2%), in comparison with CC (42.5%) and TT (13.3%). Significant differences in glutathione peroxidase activity were observed between homozygous individuals (CC vs TT) with heterozygous CT having intermediate values. Dismutase activity was significantly associated with ETFA genotype, although only bulls with the CT genotype were significantly different from bulls carrying the CC genotype. The activity of catalase showed a similar trend (but was not statistically significant). In conclusion, we found that bulls with the ETFA TT genotype produce sperm with the highest glutathione peroxidase activity and can therefore be more efficiently protected from reactive oxygen. The mechanism of this interaction needs to be elucidated in future research.
Introduction The genetic background of semen traits in Holstein– Friesian bulls has rarely been investigated. The hypothesis that semen traits have genetic variation was confirmed by Druet et al. (2009), who reported heritability indices for basic semen traits recorded during production at an AI (artificial insemination) station. The QTLs database contains only a few records of bull semen traits (Hu et al. 2013). To determine which specific genes might be involved in semen quality traits, a GWAS (genomewide association study) analysis was performed for Brahman bulls (Fortes et al. 2012, 2013) and for Holstein bulls by our group (Hering et al. 2014), mostly for semen production traits. One of our additional GWAS showed significant markers in the close neighbourhood of the bovine ETFA locus (ElectronTransfer-Flavoprotein, Alpha polypeptide), suggesting that this gene could be involved in sperm quality (DM Hering, K Olenski and S Kaminski, unpublished data). The major function of ETFA is to shuttle electrons between primary flavoprotein dehydrogenases and the
membrane-bound electron-transfer flavoprotein ubiquinone oxidoreductase (Schiff et al. 2006), and it is therefore involved in the production of reactive oxygen species (ROS) – a substrate for antioxidant enzymes. ROS produced by mitochondrial enzymes plays a fundamental role in the progression of dysfunctional states as well as in cellular signalling (Rodrigues and Gomes 2012). The activity of ETFA in somatic cells is related to ROS production. The mechanism of superoxide formation by ETFA remains uncertain, but is probably connected with electron transport in the respiratory chain (Watmough and Frerman 2010). It has been demonstrated that the process of cryopreservation caused a significant decrease in antioxidant enzyme activity in semen, mainly superoxide dismutase and glutathione peroxidase (Bilodeau et al. 2000). Within the ETFA gene, at position 32044474 (based on the UMD 3.1 bovine genome build, Zimin et al. 2009) missense mutation occurs where cytosine is replaced by thymine. This nucleotide substitution causes an exchange of amino acid alanine by threonine and is registered under the number rs133272980 in dbSNP (www.ncbi.nlm.nih.gov/SNP). As no previous physiological observation was associated with missense mutation within the ETFA gene, we attempted to correlate different ETFA genotypes with the activity of three antioxidant enzymes.
Material and Methods Animals The analysed data set originates from the Polish Holstein–Friesian dairy cattle population and consisted of 120 bulls from one AI station. The bulls included in the analysis were at a similar age (12–18 months) and were kept in uniform feeding and housing conditions. All bulls underwent routine testicle evaluations, and none showed clinical symptoms affecting semen production. Identification of ETFA polymorphism Genomic DNA was isolated from the half volume of one commercial semen straw using the Wizard Plus © 2014 Blackwell Verlag GmbH
ETFA Polymorphism and Antioxidant Enzymes
Megapreps DNA Purification System (Promega, Madison, WI, USA). DNA was then used to genotype each bull by the PCR-RFLP technique. PCR was carried out in 25 ll of mix containing: 209 PCR buffer, dNTP mix (0.2 mM each), 10 pmol of each primer, 2.5 mM MgCl2, 109 enhancer, 0,7 U Tfl DNA Polymerase (Epicentre, San Diego, CA, USA), 200 ng DNA and H2O ad 25.0 ll. A 500-bp fragment of the EFTA gene was amplified with primers: forward 50 TTAATGCACCCCACCCTTAC 30 and reverse 50 TTCAATGTTACAGTCCTTTCCCTA 30 using MJ Research Thermocycler PTC-200 and an annealing temp. of 55°C. The amplicons obtained from 10 bulls were sequenced for forward and reverse strands, and polymorphic sites were identified by comparison to a reference sequence (GeneBank no AC_000178.1). Genotyping of the ETFA C/T missense mutation was performed using the MwoI restriction enzyme (New England BioLabs, Ipswich, MA, USA). Evaluation of semen quality Sperm motility was assessed using a computer-assisted semen analysis (CASA) system (VideoTesT Sperm 2.1; St. Petersburg, Russia). Sperm plasma membrane integrity was evaluated using dual fluorescent staining, SYBR-14 and PI (Live/Dead Sperm Viability Kit; Molecular Probes, Eugene, OR, USA), as described by Garner and Johnson (1995). The sperm mitochondrial function was assessed according to a previously described method (Thomas et al. 1998), with some modifications (Dzieko nska et al. 2009). ATP content was measured in the supernatants using a Bioluminescence Assay Kit CLSII (Roche Diagnostics, GmbH, Basel, Switzerland), according to the manufacturer’s protocol. Sperm antioxidant enzymatic activity Sperm samples were prepared according to the method of Koziorowska-Gilun et al. (2013). Twenty commercial straws of frozen-thawed semen (180 9 106 spermatozoa) collected from each bull were used to measure antioxidant enzyme activity. Straws were produced in weekly intervals. Semen from each sample was centrifuged at 800 g for 5 min, sperm pellets were separated, and washed by resuspending in 1 ml 0.85% NaCl and recentrifuging. After the centrifugation, 1 ml 0.85% NaCl was added to spermatozoa (180 9 106), and they were snap-frozen in LN2 for 5 min. The samples were centrifuged at 20 000 g for 10 min, and supernatant was stored at 20°C until further analysis. The results of antioxidant enzymatic activity in spermatozoa were calculated for 109 sperm cells. Superoxide dismutase (SOD) activity was assayed using a commercial reagent kit (Randox Laboratories, Crumlin, UK), according to the manufacturer’s instructions. The role of SOD is to accelerate the dismutation of the superoxide anion. This assay employs xanthine– xanthine oxidase (XOD) to generate the superoxide © 2014 Blackwell Verlag GmbH
169
anion radicals, which react with 2-(4-iodophenyl)-3-(4nitrophenol)-5-phenyltetrazolium chloride (INT) to form a red formazan. The activity of SOD was monitored at 505 nm, using a Beckman Coulter DU 800 spectrophotometer (Beckman Coulter Inc., Fullerton, CA, USA). One unit of SOD is that which causes a 50% inhibition of the rate of reduction of INT under the assay conditions (37°C, pH 7.0). A commercial kit was used to determine catalase (CAT) activity (Sigma-Aldrich Chemicals Company, St Louis, MO, USA), according to the manufacturer’s instructions. The activity of CAT was based on the measurements of H2O2, remaining after the action of the enzyme. The quinoneimine dye coupling product, which correlated with the amount of remaining H2O2 in the reaction mixture, was measured spectrophotometrically at 520 nm (Beckman Coulter DU 800 spectrophotometer). One unit of CAT represents the amount of the enzyme that decomposes 1 lM H2O2 per minute at a substrate concentration of 50 mM H2O2 at 25°C (pH 7.0). Glutathione peroxidase (GPx) activity was measured using a Ransel kit (Randox Laboratories Ltd.), according to the manufacturer’s instructions. In this assay, GPx catalyses the oxidation of glutathione (GSH) by cumene hydroperoxide. In the presence of glutathione reductase (GR) and NADPH, oxidized glutathione (GSSG) is converted to GSH with a concomitant oxidation of NADPH to NADP+. This reaction was measured spectrophotometrically at 340 nm. One unit of GPx was defined as the amount of the enzyme that catalyses the oxidation of 1 lm NADPH per minute at 37°C (pH 7.2). Statistical analysis A Kruskal–Wallis (STATISTICA v 10.0; Statsoft, Tulsa, OK, USA) test was used to find associations between
Fig. 1. Genotyping of ETFA C/T missense mutation by MwoI restriction enzyme. A: lines 4, 5 – TT genotype; lines 6, 7 – CC genotype; lines 2, 3 – CT genotype; lines 1, 8 – DNA size marker ØX174 DNA/HaeIII
170
DM Hering, M Lecewicz, W Kordan and S Kami nski
Table 1. Means and standard error (SE) for antioxidant enzyme activity of sperm, sperm kinetic parameters, membrane integrity and ATP content of sperms from bulls with particular ETFA genotypes. SOD – superoxide dismutase, CAT – catalase, GPx – glutathione peroxidase, MOT – total motility, VAP – average path velocity, VSL – straight velocity, VCL – curvilinear velocity, ALH – amplitude of lateral head displacment, BCF – beat cross frequency, STR – straightness, LIN – linearity, SYBR-14/PI – sperm membrane integrity, JC-1/PI – sperm mitochondrial function, ATP – ATP content Bulls with genotypes CC = 51
All bulls (120) Sperm parameters SOD CAT GPx MOT VAP VSL VCL ALH BCF STR LIN SYBR-14/PI JC-1/PI ATP
CT = 53
TT = 16
x
SE
x
SE
x
SE
x
SE
p-value
5.31 494.3 2847.8 62.51 30.60 27.92 55.46 1.21 7.62 88.64 49.51 72.21 71.32 15.58
0.09 12.64 38.39 0.63 0.47 0.45 0.61 0.01 0.02 0.32 0.26 0.24 0.17 0.19
5.13 a 476.2 2798.5 a 62.70 30.30 27.85 56.49 1.19 7.58 88.46 49.67 72.10 71.18 15.79
0.14 17.91 71.73 0.88 0.55 0.56 0.92 0.02 0.03 0.51 0.36 0.36 0.27 0.30
5.47 b 489.9 2836.9 62.46 30.74 28.14 54.85 1.21 7.65 88.54 49.65 72.68 71.56 15.45
0.14 16.96 49.65 1.09 0.77 0.73 0.93 0.02 0.03 0.49 0.44 0.39 0.25 0.31
5.36 b 566.7 3041.1 b 62.03 31.07 27.45 54.22 1.19 7.68 89.57 48.56 71.06 70.94 15.34
0.25 48.78 41.11 1.46 1.76 1.69 1.82 0.03 0.07 0.78 0.63 0.62 0.41 0.46
0.02 0.21 0.04 0.94 0.94 0.83 0.34 0.88 0.22 0.46 0.28 0.12 0.48 0.76
Means with different letter differ at p < 0.05.
ETFA genotypes and the activity of 3 antioxidant enzymes. Multiple comparisons between average ranks for each pair of genotyping groups were calculated. For each comparison, the likelihoods of post hoc (unadjusted for the number of comparisons) double-sided significance tests were estimated. The relatedness (Identity by Decent) for 120 bulls was 0.0403 (SD = 0.058). Taking into account the similar bull age, standardized semen collection procedures, similar feeding and welfare conditions as well as no seasonal effect (data not shown), the models used did not require any corrections for additional fixed or random effects.
Results Genotyping of ETFA C/T missense mutation is illustrated on Fig. 1. In the population of 120 Holstein– Friesian bulls, three genotypes were identified: TT (500 bp), CC (258, 242 bp) and CT (500, 258, 242 bp). The genotypes of ten randomly chosen samples were confirmed by sequencing (Figure S1). Among all bulls investigated, heterozygous animals (CT) were the most frequent (44.2%), in comparison with CC (42.5%) and TT (13.3%) (Table 1). Sperm originating from ETFA CC bulls had the lowest value for all 3 enzymes of antioxidative activity (Table 1). Among all semen quality traits, only the activity of two antioxidant enzymes showed differences between three ETFA genotypes. Significant differences in GPx activity were observed between homozygous individuals (CC vs TT) with heterozygous ones (CT) having intermediate values. The activity of catalase showed a similar trend (but not statistically significant).
Dismutase activity was associated with the ETFA genotype; however, only heterozygous bulls (CT) were significantly different from homozygous ones (CC).
Discussion In general, our results suggest a functional link between ETFA variants and the activity of two antioxidant enzymes (GPx and SOD). In the literature on ETFA, there are no reports on how this protein may affect bull sperm functions. To explain our observation, we first have to consider whether the change of amino acid in ETFA may affect its activity. This assumption may be supported by Henriques et al. (2011) who showed that an exchange of isoleucine by threonine at human ETFA-171 affects the kinetic behaviour upon thermal stress and that the ETFA-T171 variant is kinetically destabilized. Considering a link between ETFA activity and the antioxidant enzymes, we have to look at this protein as a potential source of ROS (Rodrigues and Gomes 2012). As ROS production is related to the activity of antioxidant enzymes (Schiff et al. 2006), it can be assumed that ROS generated by ETFA, as small molecules, may reach the plasma membrane and influence the activity of antioxidant enzymes. The most significant effect of this link is typical for glutathione peroxidase, which was reported (Arai et al. 1999) as the main mitochondrial antioxidant enzyme. The results of the present investigation show that GPx and SOD play a key role in the antioxidant defence system in cryopreserved bull semen. The concentration of ROS above toxic thresholds is metabolized by a highly © 2014 Blackwell Verlag GmbH
ETFA Polymorphism and Antioxidant Enzymes
efficient antioxidant mechanism, including an enzymatic mechanism (Andreyev et al. 2005). As the highest antioxidant activity of studied enzymes was observed in ETFA homozygotes TT, we therefore assume that sperm from bulls carrying this genotype may have the highest production of ROS. The mechanism of this interaction needs to be elucidated in future research. In the current breeding programs, bulls are preselected based on their genomic value at a very early age (even as newborn calves). Because at this age, we have no way to assess their semen, SNPs, like ETFA C/T missense mutation, can be used in the selection of young bulls to improve semen quality.
Conclusion Our results show that sperm from bulls with the ETFA TT genotype have the highest activity of glutathione peroxidase and superoxide dismutase. This suggests that such spermatozoa can be more efficiently protected from reactive oxygen.
171 thankful to SHiUZ AI Center for access to SNP genotypes of bulls and for the delivery of semen samples.
Conflict of interest All authors of the submitted paper disclose any actual or potential conflict of interest including any financial, personal or other relationships with other people or organizations that could inappropriately influence, or be perceived to influence, their work described in the submitted paper.
Author contributions Dorota Hering designed the PCR-RFLP method, genotyped animals and made primary statistical analysis. Marek Lecewicz – evaluated semen quality. Wladyslaw Kordan – analysed semen quality data and participated in drafting the manuscript. Stanislaw Kaminski – designed the experiment, edited the final manuscript and revised it critically.
Supporting Information Additional Supporting Information may be found in the online version of this article: Figure S1 Detection of missense C/T mutation within ETFA gene by sequencing. A: homozygote TT; B: homozygote CC; C: heterozygote CT (Y).
Acknowledgements This work was financially supported by the National Center of Scientific Research, grant no N N311 524940. The authors are
References Andreyev AY, Kushnareva YE, Starkov AA, 2005: Mitochondrial metabolism of reactive oxygen species. Biochemistry 70, 200–214. Arai M, Imai H, Koumura T, Yoshida M, Emoto K, Umeda M, 1999: Mitochondrial phospholipid hydroperoxidase glutathione peroxidase plays a major role in preventing oxidative injury to cells. J Biol Chem 274, 4924–4933. Bilodeau JF, Chatterjee S, Sirard MA, Gagnon C, 2000: Levels of antioxidant defenses are decreased in bovine spermatozoa after a cycle of freezing and thawing. Mol Reprod Dev 55, 282–288. Druet T, Fritz S, Sellem S, Basso B, Ge O, Salas-Cortes L, Humblot P, Druart X, Eggen A, 2009: Estimation of genetic parameters and genome scan for 15 semen characteristics traits of Holstein bulls. J Anim Breed Genet 126, 269–277. Dzieko nska A, Fraser L, Strze_zek J, 2009: Effect of different storage temperatures on the metabolic activity of spermatozoa following liquid storage. J Anim Feed Sci 18, 638–649. Fortes MRS, Reverter A, Hawken RJ, Bolormaa S, Lehnert SA, 2012: Candidate gene associated with testicular development, sperm quality and hormone levels of inhibin, luteinizing hormone, and insulin-like growth factor 1 in Brahman bulls. Biol Reprod 87, 58, 1–8.
© 2014 Blackwell Verlag GmbH
Fortes MRS, Reverter A, Kelly M, McCulloch R, Lehnert SA, 2013: Genome-wide association study for inhibin, luteinizing hormone, insulin-like growth factor 1, testicular size and semen traits in bovine species. Andrology 1, 644–650. Garner DL, Johnson LA, 1995: Viability assessment of mammalian sperm using SYBR-14 and propidium iodide. Biol Reprod 53, 276–284. Henriques BJ, Fisher MT, Bross P, Gomes CM, 2011: A polymorphic position in electron transfer flavoprotein modulates kinetic stability as evidenced by thermal stress. FEBS Lett 585, 505–510. Hering DM, Olenski K, Kaminski S, 2014: Genome-wide association study for poor sperm motility in Holstein-Friesian bulls. Anim Reprod Sci 146, 89–97. Hu Z-L, Park CA, Wu X-L, Reecy JM, 2013: Animal QTLdb: an improved database tool for livestock animal QTL/ association data dissemination in the post-genome era. Nucleic Acids Res 41, D871–D879. Koziorowska-Gilun M, Gilun P, Fraser L, Koziorowski M, Kordan W, Stefanczyk-Krzymowska S, 2013: Antioxidant enzyme activity and mRNA expression in reproductive tract of adult male European bison (Bison bonasus, Linnaeus 1758). Reprod Domest Anim 48, 7–14. Rodrigues JV, Gomes CM, 2012: Mechanism of superoxide and hydrogen peroxide generation by human electron-transfer
flavoprotein and pathological variants. Free Radic Biol Med 53, 12–19. Schiff M, Froissart R, Olsen RK, Acquaviva C, Vianey-Saban C, 2006: Electron transfer flavoprotein deficiency: functional and molecular aspects. Mol Genet Metab 88, 153–158. Thomas CA, Garner DL, DeJarnette JM, Marshall CE, 1998: Effect of cryopreservation on bovine sperm organelle function and viability as determined by flow cytometry. Biol Reprod 58, 786– 793. Watmough NJ, Frerman FE, 2010: The electron transfer flavoprotein: ubiquinone oxidoreductases. Biochim Biophys Acta 1797, 1910–1916. Zimin AV, Delcher AL, Florea L, Kelley DR, Schatz MC, Puiu D, Hanrahan F, Pertea G, Van Tassell CP, Sonstegard TS, Marcßais G, Roberts M, Subramanian P, Yorke JA, Salzberg SL, 2009: A whole-genome assembly of the domestic cow Bos taurus. Genome Biol 10, R42.
Submitted: 21 Aug 2014; Accepted: 28 Oct 2014 Author’s address (for correspondence): Stanisaw Kami nski, Department of Animal Genetics, University of Warmia and Mazury, 10–718 Olsztyn, ul. M. Oczapowskiego 5, Poland. E-mail: [email protected]
Copyright of Reproduction in Domestic Animals is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
Short Communication Association Between ETFA Genotype and Activity of Superoxide Dismutase, Catalase and Glutathione Peroxidase in Cryopreserved Sperm of Holstein–Friesian Bulls DM Hering1, M Lecewicz2, W Kordan2 and S Kaminski1 1 Department of Animal Genetics, University of Warmia and Mazury, Olsztyn, Poland; 2Department of Animal Biochemistry and Biotechnology, University of Warmia and Mazury, Olsztyn, Poland
Contents The aim of this study was to determine whether C/T missense mutation within the ETFA gene is associated with sperm antioxidant enzymatic activity. One hundred and twenty Holstein–Friesian bulls were genotyped by the PCR-RFLP technique (MwoI). Commercial straws of frozen-thawed semen were used to evaluate the activity of three antioxidant enzymes: superoxide dismutase, catalase and glutathione peroxidase. Among all bulls investigated, genotype CT was the most frequent (44.2%), in comparison with CC (42.5%) and TT (13.3%). Significant differences in glutathione peroxidase activity were observed between homozygous individuals (CC vs TT) with heterozygous CT having intermediate values. Dismutase activity was significantly associated with ETFA genotype, although only bulls with the CT genotype were significantly different from bulls carrying the CC genotype. The activity of catalase showed a similar trend (but was not statistically significant). In conclusion, we found that bulls with the ETFA TT genotype produce sperm with the highest glutathione peroxidase activity and can therefore be more efficiently protected from reactive oxygen. The mechanism of this interaction needs to be elucidated in future research.
Introduction The genetic background of semen traits in Holstein– Friesian bulls has rarely been investigated. The hypothesis that semen traits have genetic variation was confirmed by Druet et al. (2009), who reported heritability indices for basic semen traits recorded during production at an AI (artificial insemination) station. The QTLs database contains only a few records of bull semen traits (Hu et al. 2013). To determine which specific genes might be involved in semen quality traits, a GWAS (genomewide association study) analysis was performed for Brahman bulls (Fortes et al. 2012, 2013) and for Holstein bulls by our group (Hering et al. 2014), mostly for semen production traits. One of our additional GWAS showed significant markers in the close neighbourhood of the bovine ETFA locus (ElectronTransfer-Flavoprotein, Alpha polypeptide), suggesting that this gene could be involved in sperm quality (DM Hering, K Olenski and S Kaminski, unpublished data). The major function of ETFA is to shuttle electrons between primary flavoprotein dehydrogenases and the
membrane-bound electron-transfer flavoprotein ubiquinone oxidoreductase (Schiff et al. 2006), and it is therefore involved in the production of reactive oxygen species (ROS) – a substrate for antioxidant enzymes. ROS produced by mitochondrial enzymes plays a fundamental role in the progression of dysfunctional states as well as in cellular signalling (Rodrigues and Gomes 2012). The activity of ETFA in somatic cells is related to ROS production. The mechanism of superoxide formation by ETFA remains uncertain, but is probably connected with electron transport in the respiratory chain (Watmough and Frerman 2010). It has been demonstrated that the process of cryopreservation caused a significant decrease in antioxidant enzyme activity in semen, mainly superoxide dismutase and glutathione peroxidase (Bilodeau et al. 2000). Within the ETFA gene, at position 32044474 (based on the UMD 3.1 bovine genome build, Zimin et al. 2009) missense mutation occurs where cytosine is replaced by thymine. This nucleotide substitution causes an exchange of amino acid alanine by threonine and is registered under the number rs133272980 in dbSNP (www.ncbi.nlm.nih.gov/SNP). As no previous physiological observation was associated with missense mutation within the ETFA gene, we attempted to correlate different ETFA genotypes with the activity of three antioxidant enzymes.
Material and Methods Animals The analysed data set originates from the Polish Holstein–Friesian dairy cattle population and consisted of 120 bulls from one AI station. The bulls included in the analysis were at a similar age (12–18 months) and were kept in uniform feeding and housing conditions. All bulls underwent routine testicle evaluations, and none showed clinical symptoms affecting semen production. Identification of ETFA polymorphism Genomic DNA was isolated from the half volume of one commercial semen straw using the Wizard Plus © 2014 Blackwell Verlag GmbH
ETFA Polymorphism and Antioxidant Enzymes
Megapreps DNA Purification System (Promega, Madison, WI, USA). DNA was then used to genotype each bull by the PCR-RFLP technique. PCR was carried out in 25 ll of mix containing: 209 PCR buffer, dNTP mix (0.2 mM each), 10 pmol of each primer, 2.5 mM MgCl2, 109 enhancer, 0,7 U Tfl DNA Polymerase (Epicentre, San Diego, CA, USA), 200 ng DNA and H2O ad 25.0 ll. A 500-bp fragment of the EFTA gene was amplified with primers: forward 50 TTAATGCACCCCACCCTTAC 30 and reverse 50 TTCAATGTTACAGTCCTTTCCCTA 30 using MJ Research Thermocycler PTC-200 and an annealing temp. of 55°C. The amplicons obtained from 10 bulls were sequenced for forward and reverse strands, and polymorphic sites were identified by comparison to a reference sequence (GeneBank no AC_000178.1). Genotyping of the ETFA C/T missense mutation was performed using the MwoI restriction enzyme (New England BioLabs, Ipswich, MA, USA). Evaluation of semen quality Sperm motility was assessed using a computer-assisted semen analysis (CASA) system (VideoTesT Sperm 2.1; St. Petersburg, Russia). Sperm plasma membrane integrity was evaluated using dual fluorescent staining, SYBR-14 and PI (Live/Dead Sperm Viability Kit; Molecular Probes, Eugene, OR, USA), as described by Garner and Johnson (1995). The sperm mitochondrial function was assessed according to a previously described method (Thomas et al. 1998), with some modifications (Dzieko nska et al. 2009). ATP content was measured in the supernatants using a Bioluminescence Assay Kit CLSII (Roche Diagnostics, GmbH, Basel, Switzerland), according to the manufacturer’s protocol. Sperm antioxidant enzymatic activity Sperm samples were prepared according to the method of Koziorowska-Gilun et al. (2013). Twenty commercial straws of frozen-thawed semen (180 9 106 spermatozoa) collected from each bull were used to measure antioxidant enzyme activity. Straws were produced in weekly intervals. Semen from each sample was centrifuged at 800 g for 5 min, sperm pellets were separated, and washed by resuspending in 1 ml 0.85% NaCl and recentrifuging. After the centrifugation, 1 ml 0.85% NaCl was added to spermatozoa (180 9 106), and they were snap-frozen in LN2 for 5 min. The samples were centrifuged at 20 000 g for 10 min, and supernatant was stored at 20°C until further analysis. The results of antioxidant enzymatic activity in spermatozoa were calculated for 109 sperm cells. Superoxide dismutase (SOD) activity was assayed using a commercial reagent kit (Randox Laboratories, Crumlin, UK), according to the manufacturer’s instructions. The role of SOD is to accelerate the dismutation of the superoxide anion. This assay employs xanthine– xanthine oxidase (XOD) to generate the superoxide © 2014 Blackwell Verlag GmbH
169
anion radicals, which react with 2-(4-iodophenyl)-3-(4nitrophenol)-5-phenyltetrazolium chloride (INT) to form a red formazan. The activity of SOD was monitored at 505 nm, using a Beckman Coulter DU 800 spectrophotometer (Beckman Coulter Inc., Fullerton, CA, USA). One unit of SOD is that which causes a 50% inhibition of the rate of reduction of INT under the assay conditions (37°C, pH 7.0). A commercial kit was used to determine catalase (CAT) activity (Sigma-Aldrich Chemicals Company, St Louis, MO, USA), according to the manufacturer’s instructions. The activity of CAT was based on the measurements of H2O2, remaining after the action of the enzyme. The quinoneimine dye coupling product, which correlated with the amount of remaining H2O2 in the reaction mixture, was measured spectrophotometrically at 520 nm (Beckman Coulter DU 800 spectrophotometer). One unit of CAT represents the amount of the enzyme that decomposes 1 lM H2O2 per minute at a substrate concentration of 50 mM H2O2 at 25°C (pH 7.0). Glutathione peroxidase (GPx) activity was measured using a Ransel kit (Randox Laboratories Ltd.), according to the manufacturer’s instructions. In this assay, GPx catalyses the oxidation of glutathione (GSH) by cumene hydroperoxide. In the presence of glutathione reductase (GR) and NADPH, oxidized glutathione (GSSG) is converted to GSH with a concomitant oxidation of NADPH to NADP+. This reaction was measured spectrophotometrically at 340 nm. One unit of GPx was defined as the amount of the enzyme that catalyses the oxidation of 1 lm NADPH per minute at 37°C (pH 7.2). Statistical analysis A Kruskal–Wallis (STATISTICA v 10.0; Statsoft, Tulsa, OK, USA) test was used to find associations between
Fig. 1. Genotyping of ETFA C/T missense mutation by MwoI restriction enzyme. A: lines 4, 5 – TT genotype; lines 6, 7 – CC genotype; lines 2, 3 – CT genotype; lines 1, 8 – DNA size marker ØX174 DNA/HaeIII
170
DM Hering, M Lecewicz, W Kordan and S Kami nski
Table 1. Means and standard error (SE) for antioxidant enzyme activity of sperm, sperm kinetic parameters, membrane integrity and ATP content of sperms from bulls with particular ETFA genotypes. SOD – superoxide dismutase, CAT – catalase, GPx – glutathione peroxidase, MOT – total motility, VAP – average path velocity, VSL – straight velocity, VCL – curvilinear velocity, ALH – amplitude of lateral head displacment, BCF – beat cross frequency, STR – straightness, LIN – linearity, SYBR-14/PI – sperm membrane integrity, JC-1/PI – sperm mitochondrial function, ATP – ATP content Bulls with genotypes CC = 51
All bulls (120) Sperm parameters SOD CAT GPx MOT VAP VSL VCL ALH BCF STR LIN SYBR-14/PI JC-1/PI ATP
CT = 53
TT = 16
x
SE
x
SE
x
SE
x
SE
p-value
5.31 494.3 2847.8 62.51 30.60 27.92 55.46 1.21 7.62 88.64 49.51 72.21 71.32 15.58
0.09 12.64 38.39 0.63 0.47 0.45 0.61 0.01 0.02 0.32 0.26 0.24 0.17 0.19
5.13 a 476.2 2798.5 a 62.70 30.30 27.85 56.49 1.19 7.58 88.46 49.67 72.10 71.18 15.79
0.14 17.91 71.73 0.88 0.55 0.56 0.92 0.02 0.03 0.51 0.36 0.36 0.27 0.30
5.47 b 489.9 2836.9 62.46 30.74 28.14 54.85 1.21 7.65 88.54 49.65 72.68 71.56 15.45
0.14 16.96 49.65 1.09 0.77 0.73 0.93 0.02 0.03 0.49 0.44 0.39 0.25 0.31
5.36 b 566.7 3041.1 b 62.03 31.07 27.45 54.22 1.19 7.68 89.57 48.56 71.06 70.94 15.34
0.25 48.78 41.11 1.46 1.76 1.69 1.82 0.03 0.07 0.78 0.63 0.62 0.41 0.46
0.02 0.21 0.04 0.94 0.94 0.83 0.34 0.88 0.22 0.46 0.28 0.12 0.48 0.76
Means with different letter differ at p < 0.05.
ETFA genotypes and the activity of 3 antioxidant enzymes. Multiple comparisons between average ranks for each pair of genotyping groups were calculated. For each comparison, the likelihoods of post hoc (unadjusted for the number of comparisons) double-sided significance tests were estimated. The relatedness (Identity by Decent) for 120 bulls was 0.0403 (SD = 0.058). Taking into account the similar bull age, standardized semen collection procedures, similar feeding and welfare conditions as well as no seasonal effect (data not shown), the models used did not require any corrections for additional fixed or random effects.
Results Genotyping of ETFA C/T missense mutation is illustrated on Fig. 1. In the population of 120 Holstein– Friesian bulls, three genotypes were identified: TT (500 bp), CC (258, 242 bp) and CT (500, 258, 242 bp). The genotypes of ten randomly chosen samples were confirmed by sequencing (Figure S1). Among all bulls investigated, heterozygous animals (CT) were the most frequent (44.2%), in comparison with CC (42.5%) and TT (13.3%) (Table 1). Sperm originating from ETFA CC bulls had the lowest value for all 3 enzymes of antioxidative activity (Table 1). Among all semen quality traits, only the activity of two antioxidant enzymes showed differences between three ETFA genotypes. Significant differences in GPx activity were observed between homozygous individuals (CC vs TT) with heterozygous ones (CT) having intermediate values. The activity of catalase showed a similar trend (but not statistically significant).
Dismutase activity was associated with the ETFA genotype; however, only heterozygous bulls (CT) were significantly different from homozygous ones (CC).
Discussion In general, our results suggest a functional link between ETFA variants and the activity of two antioxidant enzymes (GPx and SOD). In the literature on ETFA, there are no reports on how this protein may affect bull sperm functions. To explain our observation, we first have to consider whether the change of amino acid in ETFA may affect its activity. This assumption may be supported by Henriques et al. (2011) who showed that an exchange of isoleucine by threonine at human ETFA-171 affects the kinetic behaviour upon thermal stress and that the ETFA-T171 variant is kinetically destabilized. Considering a link between ETFA activity and the antioxidant enzymes, we have to look at this protein as a potential source of ROS (Rodrigues and Gomes 2012). As ROS production is related to the activity of antioxidant enzymes (Schiff et al. 2006), it can be assumed that ROS generated by ETFA, as small molecules, may reach the plasma membrane and influence the activity of antioxidant enzymes. The most significant effect of this link is typical for glutathione peroxidase, which was reported (Arai et al. 1999) as the main mitochondrial antioxidant enzyme. The results of the present investigation show that GPx and SOD play a key role in the antioxidant defence system in cryopreserved bull semen. The concentration of ROS above toxic thresholds is metabolized by a highly © 2014 Blackwell Verlag GmbH
ETFA Polymorphism and Antioxidant Enzymes
efficient antioxidant mechanism, including an enzymatic mechanism (Andreyev et al. 2005). As the highest antioxidant activity of studied enzymes was observed in ETFA homozygotes TT, we therefore assume that sperm from bulls carrying this genotype may have the highest production of ROS. The mechanism of this interaction needs to be elucidated in future research. In the current breeding programs, bulls are preselected based on their genomic value at a very early age (even as newborn calves). Because at this age, we have no way to assess their semen, SNPs, like ETFA C/T missense mutation, can be used in the selection of young bulls to improve semen quality.
Conclusion Our results show that sperm from bulls with the ETFA TT genotype have the highest activity of glutathione peroxidase and superoxide dismutase. This suggests that such spermatozoa can be more efficiently protected from reactive oxygen.
171 thankful to SHiUZ AI Center for access to SNP genotypes of bulls and for the delivery of semen samples.
Conflict of interest All authors of the submitted paper disclose any actual or potential conflict of interest including any financial, personal or other relationships with other people or organizations that could inappropriately influence, or be perceived to influence, their work described in the submitted paper.
Author contributions Dorota Hering designed the PCR-RFLP method, genotyped animals and made primary statistical analysis. Marek Lecewicz – evaluated semen quality. Wladyslaw Kordan – analysed semen quality data and participated in drafting the manuscript. Stanislaw Kaminski – designed the experiment, edited the final manuscript and revised it critically.
Supporting Information Additional Supporting Information may be found in the online version of this article: Figure S1 Detection of missense C/T mutation within ETFA gene by sequencing. A: homozygote TT; B: homozygote CC; C: heterozygote CT (Y).
Acknowledgements This work was financially supported by the National Center of Scientific Research, grant no N N311 524940. The authors are
References Andreyev AY, Kushnareva YE, Starkov AA, 2005: Mitochondrial metabolism of reactive oxygen species. Biochemistry 70, 200–214. Arai M, Imai H, Koumura T, Yoshida M, Emoto K, Umeda M, 1999: Mitochondrial phospholipid hydroperoxidase glutathione peroxidase plays a major role in preventing oxidative injury to cells. J Biol Chem 274, 4924–4933. Bilodeau JF, Chatterjee S, Sirard MA, Gagnon C, 2000: Levels of antioxidant defenses are decreased in bovine spermatozoa after a cycle of freezing and thawing. Mol Reprod Dev 55, 282–288. Druet T, Fritz S, Sellem S, Basso B, Ge O, Salas-Cortes L, Humblot P, Druart X, Eggen A, 2009: Estimation of genetic parameters and genome scan for 15 semen characteristics traits of Holstein bulls. J Anim Breed Genet 126, 269–277. Dzieko nska A, Fraser L, Strze_zek J, 2009: Effect of different storage temperatures on the metabolic activity of spermatozoa following liquid storage. J Anim Feed Sci 18, 638–649. Fortes MRS, Reverter A, Hawken RJ, Bolormaa S, Lehnert SA, 2012: Candidate gene associated with testicular development, sperm quality and hormone levels of inhibin, luteinizing hormone, and insulin-like growth factor 1 in Brahman bulls. Biol Reprod 87, 58, 1–8.
© 2014 Blackwell Verlag GmbH
Fortes MRS, Reverter A, Kelly M, McCulloch R, Lehnert SA, 2013: Genome-wide association study for inhibin, luteinizing hormone, insulin-like growth factor 1, testicular size and semen traits in bovine species. Andrology 1, 644–650. Garner DL, Johnson LA, 1995: Viability assessment of mammalian sperm using SYBR-14 and propidium iodide. Biol Reprod 53, 276–284. Henriques BJ, Fisher MT, Bross P, Gomes CM, 2011: A polymorphic position in electron transfer flavoprotein modulates kinetic stability as evidenced by thermal stress. FEBS Lett 585, 505–510. Hering DM, Olenski K, Kaminski S, 2014: Genome-wide association study for poor sperm motility in Holstein-Friesian bulls. Anim Reprod Sci 146, 89–97. Hu Z-L, Park CA, Wu X-L, Reecy JM, 2013: Animal QTLdb: an improved database tool for livestock animal QTL/ association data dissemination in the post-genome era. Nucleic Acids Res 41, D871–D879. Koziorowska-Gilun M, Gilun P, Fraser L, Koziorowski M, Kordan W, Stefanczyk-Krzymowska S, 2013: Antioxidant enzyme activity and mRNA expression in reproductive tract of adult male European bison (Bison bonasus, Linnaeus 1758). Reprod Domest Anim 48, 7–14. Rodrigues JV, Gomes CM, 2012: Mechanism of superoxide and hydrogen peroxide generation by human electron-transfer
flavoprotein and pathological variants. Free Radic Biol Med 53, 12–19. Schiff M, Froissart R, Olsen RK, Acquaviva C, Vianey-Saban C, 2006: Electron transfer flavoprotein deficiency: functional and molecular aspects. Mol Genet Metab 88, 153–158. Thomas CA, Garner DL, DeJarnette JM, Marshall CE, 1998: Effect of cryopreservation on bovine sperm organelle function and viability as determined by flow cytometry. Biol Reprod 58, 786– 793. Watmough NJ, Frerman FE, 2010: The electron transfer flavoprotein: ubiquinone oxidoreductases. Biochim Biophys Acta 1797, 1910–1916. Zimin AV, Delcher AL, Florea L, Kelley DR, Schatz MC, Puiu D, Hanrahan F, Pertea G, Van Tassell CP, Sonstegard TS, Marcßais G, Roberts M, Subramanian P, Yorke JA, Salzberg SL, 2009: A whole-genome assembly of the domestic cow Bos taurus. Genome Biol 10, R42.
Submitted: 21 Aug 2014; Accepted: 28 Oct 2014 Author’s address (for correspondence): Stanisaw Kami nski, Department of Animal Genetics, University of Warmia and Mazury, 10–718 Olsztyn, ul. M. Oczapowskiego 5, Poland. E-mail: [email protected]
Copyright of Reproduction in Domestic Animals is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
