Arginine methylation of CRTC2 is critical in the transcriptional control of hepatic glucose metabolism.

RESEARCH ARTICLE METABOLISM

Arginine Methylation of CRTC2 Is Critical in the Transcriptional Control of Hepatic Glucose Metabolism Hye-Sook Han,1 Chang-Yun Jung,2 Young-Sil Yoon,1 Seri Choi,1 Dahee Choi,1,2 Geon Kang,1 Keun-Gyu Park,3 Seong-Tae Kim,2 Seung-Hoi Koo1*

INTRODUCTION

Under fasting conditions, pancreatic hormone glucagon triggers activation of adenosine 3′,5′-monophosphate (cAMP)–dependent protein kinase (PKA) signaling in the liver, thus promoting increased hepatic glucose production to maintain glucose homeostasis in mammals (1, 2). CREB (cAMP response element–binding protein) and its coactivator CRTC2 (CREB-regulated transcriptional coactivator 2) are critical in this process, and cAMP-dependent activation of this transcriptional machinery promotes gluconeogenic program in the liver by up-regulation of key enzyme genes such as PEPCK (phosphoenolpyruvate carboxykinase) and G6Pase (glucose-6-phosphatase catalytic subunit) (3–8). In the liver, cAMP signaling activates CRTC2 activity through dephosphorylation of Ser171 by serine/threonine protein phosphatases 3 CA or protein phosphatase 4, resulting in its nuclear localization and increased association with CREB on the promoters of gluconeogenic genes (9, 10). Insulin or antidiabetic drug metformin inactivates this coactivator by promoting its phosphorylation through serine/threonine protein kinases including salt-inducible kinases and AMP-activated protein kinases (6, 11, 12). CRTC2 activity is further modulated by various posttranslational modifications including O-GlcNAcylation (O-linked N-acetylglucosamination) on Ser171 and acetylation on Lys628, suggesting that the fine-tuning of the activity of this factor might be critical in maintaining glucose homeostasis (13, 14). There are 11 mammalian PRMTs (protein arginine methyltransferases) (15). PRMTs 1, 3, 4, 6, and 8 are type I PRMTs, which catalyze asymmetric dimethylaton reaction on arginine residues of their substrates, whereas type 1 Division of Life Sciences, Korea University, 145 Anam-Ro, Seongbuk-Gu, Seoul 136-713, Korea. 2Division of Biochemistry and Molecular Biology, Department of Molecular Cell Biology and Samsung Biomedical Institute, Sungkyunkwan University School of Medicine, 300 Chunchun-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746, Korea. 3Department of Internal Medicine, Kyungpook National University School of Medicine, Daegu 700-721, Korea. *Corresponding author. E-mail: [email protected]

II PRMTs such as PRMTs 5, 7, and 9 generate symmetrically dimethylated arginine residues. The enzymatic functions of other PRMTs have not been well characterized, although PRMT2 may function in conjunction with other PRMTs to promote arginine methylation (16). PRMT1 and PRMT4 (also known as CARM1) are involved in hepatic glucose metabolism and adipogenesis (17–19). In addition, PRMT5, a type II PRMT, plays a role in the regulation of CREB-dependent glucose metabolism in the liver (20). These data underscore a potential importance of PRMTs in the regulation of energy homeostasis in mammals. By mass spectrometry (MS) analysis, we showed that PRMT6 was associated with CRTC2. PRMT6-dependent arginine methylation of CRTC2 was critical in its interaction with CREB and other coactivators on the promoters of gluconeogenic enzyme–encoding genes, thus contributing to the enhanced gluconeogenic potential through a transcriptional mechanism. The expression of PRMT6 was increased in the livers of high-fat diet–fed mice or in genetic mouse models of obesity and insulin resistance, and knockdown of PRMT6 in the liver restored euglycemia in these mice. We suggest that PRMT6 is a crucial component of CRTC2-dependent regulation of hepatic gluconeogenesis both in the physiological and pathological settings. RESULTS

PRMT6 potentiates the transcriptional activity of CRTC2 To delineate additional mechanisms of regulating CRTC2, we performed liquid chromatography–tandem MS (LC-MS/MS) analysis on CRTC2 immunoprecipitates, which identified PRMT6 as a protein that interacts with CRTC2 (table S1). We tested whether CRTC2 interacted with other PRMTs. We detected a strong interaction between CRTC2 and PRMTs 1, 2, 4, and 6 by coimmunoprecipitation assay (Fig. 1A and fig. S1A). To verify the functional importance of these interactions, we performed a reporter assay in cells transfected with a luciferase construct harboring multiple

www.SCIENCESIGNALING.org

25 February 2014

Vol 7 Issue 314 ra19

1

Downloaded from http://stke.sciencemag.org/ on December 4, 2015

Fasting glucose homeostasis is maintained in part through cAMP (adenosine 3′,5′-monophosphate)– dependent transcriptional control of hepatic gluconeogenesis by the transcription factor CREB (cAMP response element–binding protein) and its coactivator CRTC2 (CREB-regulated transcriptional coactivator 2). We showed that PRMT6 (protein arginine methyltransferase 6) promotes fasting-induced transcriptional activation of the gluconeogenic program involving CRTC2. Mass spectrometric analysis indicated that PRMT6 associated with CRTC2. In cells, PRMT6 mediated asymmetric dimethylation of multiple arginine residues of CRTC2, which enhanced the association of CRTC2 with CREB on the promoters of gluconeogenic enzyme–encoding genes. In mice, ectopic expression of PRMT6 promoted higher blood glucose concentrations, which were associated with increased expression of genes encoding gluconeogenic factors, whereas knockdown of hepatic PRMT6 decreased fasting glycemia and improved pyruvate tolerance. The abundance of hepatic PRMT6 was increased in mouse models of obesity and insulin resistance, and adenovirus-mediated depletion of PRMT6 restored euglycemia in these mice. We propose that PRMT6 is involved in the regulation of hepatic glucose metabolism in a CRTC2-dependent manner.

RESEARCH ARTICLE

Fig. 1. PRMT6 activates CRTC2 by promoting its arginine methylation. (A) Coimmunoprecipitation assay showing the interaction between CRTC2 and PRMTs. n = 3 independent experiments. (B) Reporter assay was performed in 293T cells to determine the effects of PRMTs on CRTC2-dependent CRE luciferase activity. n = 4 independent experiments in triplicate. (C) GST pulldown assay was performed using GST-PRMT6 with Flag-CRTC2 (top). n = 3 independent experiments. PRMT6 immunoprecipitates were blotted with an antibody against CRTC2 (bottom). n = 3 independent experiments. (D) Mapping of PRMT6interacting domains in CRTC2. Flag immunoprecipitates from 293T cells expressing deletion mutants of Flag-CRTC2 (right) and HA-PRMT6 were blotted with antibody against hemagglutinin (HA) or Flag (left). n = 4 independent experiments. CBD, CREB-binding domain; TAD, transactivation domain. (E) ASYM24 immunoprecipitates from 293T cells coexpressing Flag-CRTC2 and/or HA-PRMT6 were blotted with Flag antibody (left). n = 4 independent experiments. The effect of the PRMT6 mutant (middle) or a PRMT inhibitor cocktail (left) on CRTC2-dependent CRE luciferase activity was analyzed in 293T cells. n = 5 independent experiments in triplicate. Data in (B) and (E) represent means ± SD (*P < 0.05, Mann-Whitney test).

copies of cAMP response element (CRE), together with expression vectors for CRTC2 or CRTC2-interacting PRMTs. Of the PRMTs that interact with CRTC2, only PRMT6 significantly enhanced CRTC2-dependent CRE activity (4.5-fold), suggesting a specific role of this protein in the regulation

Arginine dimethylation of CRTC2 is critical in cAMP-dependent transcription

To map the arginine residues of CRTC2 that are targeted by PRMT6, we performed MS analysis to identify peptides containing dimethylated arginine residues. We identified six candidate sites on CRTC2 that are conserved among paralogs or between species (Fig. 2A and figs. S2 and S3, A and B), suggesting that these arginine residues might be common targets for the PRMT6-dependent regulatory pathway. Indeed, PRMT6 potentiated the transcriptional activity of all three CRTCs as assessed by the reporter assay, although PRMT6-dependent coactivation of CRTC3mediated transcription was not statistically significant (Fig. 2B). Forms of CRTC2 in which the conserved arginine residues were replaced with lysine residues in the N terminus (Arg51, Arg99, Arg120, and Arg123; 4RK) or near Ser171 (Arg161 and Arg168; 2RK) showed reduced arginine dimethylation as detected by an antibody that specifically detects asymmetrically dimethylated


25 February 2014


2


of CRTC2 (Fig. 1B and fig. S1B). In addition, PRMT5 (which does not interact with CRTC2) also increased CRTC2-dependent CRE activity about twofold, in line with a role for this PRMT isotype in CREBdependent transcription (20). Coexpression of PRMT5 and PRMT6 enhanced CRTC2-dependent CRE activity in an additive fashion (7-fold), suggesting that these PRMTs might function independently in the regulation of CRTC2-CREB– dependent transcription (fig. S1C). We confirmed a direct interaction between CRTC2 and PRMT6 with a glutathione S-transferase (GST) pulldown assay (Fig. 1C, top). Furthermore, endogenous CRTC2 and PRMT6 interacted in primary hepatocytes, presumably through the N-terminal CREB-binding domain of CRTC2 [Fig. 1, C (bottom) and D], which promoted an increase in the asymmetric arginine dimethylation of CRTC2 (Fig. 1E, left). The methyltransferase activity of PRMT6 seemed to be critical in enhancing CRTC2-dependent transcription because a catalytically inactive form of PRMT6 did not increase CRE activity to a similar extent as did the wild type (Fig. 1E, middle). Treatment with the PRMT inhibitors 5′-methylthioadenosine and adenosine dialdehyde (MTA/Adox) almost completely repressed the ability of PRMT6 to enhance CRTC2-dependent transcriptional activity (Fig. 1E, right), further corroborating the idea that CRTC2 might serve as a substrate for PRMT6.

RESEARCH ARTICLE

of CRTC2 mutations on CREB binding activity. Flag immunoprecipitates from 293T cells expressing Flag-CRTC2 (WT, 2RK, or 4RK) and/or HA-CREB were blotted with antibody against HA or Flag. n = 4 independent experiments. (F) Chromatin immunoprecipitation (ChIP) experiments showing the effect of arginine mutations on CRTC2 occupancy on the PEPCK promoter. A representative experiment of three biological replicates is shown. DMSO, dimethyl sulfoxide. (G) Quantitative polymerase chain reaction (qPCR) analysis showing the effects of CRTC2 mutations on genes encoding glucogenic enzymes in primary hepatocytes (n = 3 sets of cells per group). (H) The effects of arginine mutations on glucose production were shown by glucose output assay in primary hepatocytes (n = 3 sets of cells per group). Data in (B) and (F) to (H) represent means ± SD (*P < 0.05, Mann-Whitney test).

arginine (ASYM24) or by a cellular methylation assay (Fig. 2, C and D). However, substitutions of arginine to lysine did not affect the cAMP agonist forskolin-mediated dephosphorylation of CRTC2 at Ser171 (Fig. 2C), suggesting that these two posttranslational modifications could occur independently. Arg51, Arg99, Arg120, and Arg123 appeared to be most critical in PRMT6-dependent activation of CRTC2 because the 2RK CRTC2 mutant enhanced CRE activity to a similar extent as did wild-type CRTC2, whereas the 4RK CRTC2 mutant increased CRE activity only 1.6-fold (fig. S3C). In addition, the interaction of the 4RK mutant with CREB or p300 was not enhanced by forskolin treatment (Fig. 2E and fig. S3D), and the chromatin occupancy of the 4RK mutant at the PEPCK promoter was 3.8-fold lower compared with that of control (Fig. 2F). Furthermore, the 4RK mutant was impaired in its ability to induce expression of genes encoding the gluconeogenic factors G6Pase and PEPCK compared with wild type, suggesting that PRMT6-dependent dimethylation of N-terminal arginine residues might be critical for the CREB-CRTC2 interaction and subsequent activation of transcription of gluconeogenic factors in hepatocytes (Fig. 2G and fig. S4A). In line with this result, hepatocytes infected with adenovirus expressing the 4RK mutant of CRTC2 produced less glucose than did hepatocytes expressing wild-type CRTC2, confirming the role of arginine methylation of CRTC2 in hepatic glucose metabolism (Fig. 2H).

addition, CRTC2-dependent expression of gluconeogenic genes in primary hepatocytes was significantly enhanced by ectopic expression of wildtype PRMT6, but not that of catalytically inactive PRMT6 (Fig. 3A and fig. S4C). Methylation of CRTC2 by PRMT6 may not directly affect the nuclear localization of CRTC2 because overexpression of PRMT6 did not affect subcellular location of CRTC2 in the absence or presence of forskolin (fig. S4D). PRMT6 activated GAL4-CREB–meditated transcription only in the presence of CRTC2, thereby excluding a potential overall increase in transcription by overexpression of this protein (fig. S5A, left). Furthermore, wild-type PRMT6 enhanced CRE activity driven by CRTC2S171A, a mutant form of CRTC2 that is basally localized in the nucleus (6, 21), suggesting that PRMT6-dependent modification of CRTC2 might not be directly involved in the regulation of its subcellular localization (fig. S5A, right). Adenoviral delivery of PRMT6 in the liver resulted in higher blood glucose concentrations in mice after overnight fasting (Fig. 3B). We also noticed a more pronounced increase in blood glucose concentrations in PRMT6-expressing mice compared with control mice after challenge with intraperitoneally delivered pyruvate, a gluconeogenic precursor, suggesting that gluconeogenesis could be enhanced upon PRMT6 expression in the liver (Fig. 3C). Consistent with this idea, expression of CRTC2 target genes such as G6Pase, PEPCK, and PGC-1a was enhanced at least 1.5fold in response to a mild overexpression of PRMT6 (4-fold) in the liver (Fig. 3D). To address whether PRMT6-mediated regulation of hepatic gluconeogenesis depended on CRTC2, we tested the effect of PRMT6 expression

PRMT6 promotes activation of the gluconeogenic program in the liver Adenovirus-mediated expression of PRMT6 significantly enhanced CRTC2-dependent CRE activity in primary hepatocytes (fig. S4B). In


25 February 2014


3


Fig. 2. Conserved arginine residues in CRTC2 are critical in the PRMT6CRTC2 interaction. (A) Schematic diagram showing the dimethylated arginine residues in CRTC2. 4RK: Arg51, Arg99, Arg120, and Arg123 to Lys mutant. 2RK: Arg161 and Arg168 to Lys mutant. (B) Reporter assay showing the effects of PRMT6 on CRTC-dependent CRE luciferase activity. A representative experiment of three biological replicates is shown. (C) Mapping of dimethylated arginine residues in CRTC2. Flag immunoprecipitates from 293T cells expressing Flag-CRTC2 [wild type (WT), 4RK, or 2RK] and HA-PRMT6 were blotted with Flag, pSer171, and ASYM24 antibodies. n = 2 independent experiments. FSK, forskolin. (D) Cellular methylation assays were performed using 293T cells expressing HA-PRMT6 and Flag-CRTC2 (WT, 4RK, or 2RK). Total amounts of Flag-PRMTs are shown by Ponceau S staining. n = 3 independent experiments. (E) Effect

RESEARCH ARTICLE glucose concentrations (Fig. 4A). In addition, the PRMT6-mediated increase in hepatic gluconeogenesis was lost in mice that were depleted of CRTC2, as evidenced by the pyruvate challenge test (Fig. 4B). Furthermore, acute knockdown of CRTC2 largely blunted the effect of PRMT6dependent increase in PEPCK and G6Pase mRNA abundance in mouse liver, further supporting our finding that the effect of PRMT6 on hepatic gluconeogenesis is mediated by CRTC2-dependent transcriptional control (Fig. 4, C and D).

To test the functional consequences of PRMT6 depletion on gluconeogenic potential in the liver, we generated adenovirus expressing short hairpin RNA directed against PRMT6. Although both PRMT6 RNAi adenoviruses (1069i and 1005i) effectively reduced the expression of gluconeogenic enzyme–coding genes in primary hepatocytes, we used 1005i for the subsequent studies because it more effectively knocked down the expression of PRMT6 (fig. S5D). Knockdown of PRMT6 reduced the expression of genes encoding gluconeogenic factors and decreased glucose output in primary hepatocytes (Fig. 5, A and B). Knockdown of PRMT6 greatly reduced the asymmetric dimethylation of Fig. 3. PRMT6 promotes CRTC2-dependent transcription of gluconeogenic enzyme–encoding genes in CRTC2 and the CREB-CRTC2 interaction the liver. (A) qPCR analysis showing the effects of PRMT6 on the expression of genes encoding gluco- (Fig. 5C). PRMT6 did not appear to interfere genic enzymes in primary hepatocytes (n = 3 sets of cells per group). (B) Sixteen-hour fasting glucose with the phosphorylation status of Ser171 in (GLU) concentrations from C57BL/6 male mice infected with Ad-GFP (n = 6 mice) or Ad-PRMT6 adeno- CRTC2 (Fig. 5C). The PEPCK promoter virus (n = 5 mice). ON, overnight. (C) Pyruvate tolerance test showing the effect of PRMT6 expression on occupancy of the CREB coactivators CRTC2, hepatic glucose metabolism (n = 6 mice for Ad-GFP and n = 5 mice for Ad-PRMT6) (left). PRMT6 expres- p300, and CREB-binding protein (CBP) sion upon adenoviral infection was shown by Western blot analysis (right). Each lane represents a was significantly diminished upon depletion separate mouse. (D) qPCR analysis showing the effects on hepatic expression of gluconeogenic genes of PRMT6 (Fig. 5D). These data further by Ad-GFP or Ad-PRMT6 infection in mice (n = 4 mice for Ad-GFP and n = 5 mice for Ad-PRMT6). Data in corroborated the idea that PRMT6 could (A) and (D) represent means ± SD (*P < 0.05, **P < 0.01, Mann-Whitney test), and data in (B) and (C) affect hepatic glucose metabolism at the represent means ± SEM (*P < 0.05, **P < 0.01, t test). transcriptional level. Accordingly, hepatic knockdown of PRMT6 in mice reduced fasting blood glucose concentrations after upon CRTC2 knockdown. Knockdown of CRTC2 abrogated the PRMT6- both a 6-hour and an overnight fast, with concomitant reduction in plasma dependent enhancement of G6Pase expression in primary hepatocytes insulin concentrations (Fig. 5E). Depletion of PRMT6 in the liver also (fig. S5B). Furthermore, the PRMT6-mediated increase in glucose pro- decreased hepatic gluconeogenic potential, as evidenced by the enhanced duction was abolished upon knockdown of CRTC2 in primary hepato- pyruvate tolerance that was associated with decreased expression of cytes, corroborating the hypothesis that CRTC2 is required for the action genes encoding the gluconeogenic enzymes PEPCK and G6Pase (Fig. 5, of PRMT6 on glucose metabolism (fig. S5C). To further verify our hy- F and G). pothesis, we injected mice with adenoviruses that encoded green fluorescent protein (GFP) or PRMT6, as well as those that encoded a nonspecific Knockdown of PRMT6 restores euglycemia in RNA interference (RNAi) control or RNAi directed against CRTC2. insulin-resistant mice Mice injected with PRMT6 adenovirus displayed higher blood glucose In animal models of obesity and insulin resistance, increased gluconeoconcentrations compared with control mice. However, knockdown of genesis is often associated with higher glucose concentrations. Thus, we CRTC2 largely blunted the effect of PRMT6 overexpression on blood wanted to investigate whether the hepatic abundance of PRMT6 might be


25 February 2014


4


Knockdown of PRMT6 disrupts the formation of a cAMPmediated transcription complex in hepatocytes

RESEARCH ARTICLE

enhanced in this setting. The protein and mRNA abundance for PRMT6 in the liver was increased by fasting or after diet-induced insulin resistance in mice and in ob/ob and db/db mice, both of which are genetic mouse models of insulin resistance and type 2 diabetes (Fig. 6A and fig. S6A). In accordance with these results, we observed that the association between PRMT6 and CRTC2 tended to be stronger in livers of fasted mice than in livers of fed mice (fig. S6B), and in livers of high-fat diet–fed mice than in livers from mice fed a normal chow diet (Fig. 6B). On the basis of our knockdown experiments in mice on a normal chow diet, we expected that glucose metabolism in insulin-resistant mice would be improved upon knockdown of PRMT6. Indeed, knockdown of PRMT6 in high-fat diet–fed mice resulted in euglycemia and improved pyruvate tolerance, which was associated with reduced expression of genes encoding gluconeogenic enzymes (Fig. 6, C to E). Furthermore, hepatic depletion of PRMT6 in diabetic db/db mice improved both fasting hyperglycemia and pyruvate-induced glucose concentrations (fig. S6C). Again, the expression of genes encoding gluconeogenic factors was reduced upon PRMT6 knockdown, underscoring the potential benefit in inactivating this enzyme to relieve hyperglycemia in disease conditions (fig. S6D). We have also reported a role for PRMT1 in the regulation of FoxO1adependent glucose metabolism (17, 22). Because CREB-CRTC2 and FoxO1a are involved in the regulation of different stages of hepatic gluconeogenesis in response to fasting signals, we wanted to test whether PRMT1 and PRMT6 could regulate the expression of gluconeogenic genes in different time frames (14). Unexpectedly, we failed to detect significant differences in PRMT1- and PRMT6-dependent enhancement of gluconeogenic gene expression in primary hepatocytes in response to forskolin treatment, which promotes cAMP signaling and thus mimics a fasting signal (fig. S7A). Overall, the peak for both PRMT1- and PRMT6-dependent transcriptional response occurred within 2 hours of forskolin treatment and declined afterward, although PRMT6 overexpression tended to enhance the expression of gluconeogenic enzyme–

encoding genes to a greater extent and for a longer duration than did PRMT1 overexpression. DISCUSSION

PRMTs were first identified as an epigenetic regulator of transcription that modifies specific arginine residues on histones (23). Indeed, PRMT4, a type I PRMT, was previously linked with hepatic gluconeogenesis because it enhances CREB-dependent transcription through increased asymmetric dimethylation of histone H3 (18). Here, we detected a decrease in interaction of CRTC2 and CREB upon knockdown of PRMT6 in primary hepatocytes, which resulted in reduced recruitment of the CREB coactivators CRTC2, p300, and CBP onto the PEPCK promoter (Fig. 5, C and D), suggesting that arginine methylation of CRTC2 by PRMT6 is critical in maintaining CREB-CRTC2 interaction on the gluconeogenic promoters. Direct posttranslational modification of a transcription activator or coactivator by epigenetic regulators is not unprecedented. Indeed, we and others showed that PRMT1 modulates asymmetric dimethylation of arginine residues on FoxO1, without affecting chromatin structures around the promoter of target genes (17, 24, 25). PRMT6 can increase the transcriptional activity of all three CRTCs to varying extents as assessed by a reporter assay (Fig. 2B). Although we did not directly assess the modification of arginine residues on CRTC1 or CRTC3 by MS, we note that the arginine residues that are asymmetrically dimethylated in CRTC2 are conserved in the other CRTC isoforms (fig. S3A). Given the varying predominance of other CRTC proteins in certain tissues (for example, CRTC1 in the brain and CRTC3 in the adipocytes) (26, 27), it will be interesting to investigate whether PRMT6-dependent modification of CRTCs might play a role in those settings. Alternatively, the involvement of other PRMT isoforms in the general regulation of cAMP-dependent transcription could be worthy of further consideration, given that a role for PRMT5 in CREB-dependent transcription has been


25 February 2014


5


Fig. 4. PRMT6 targets CRTC2 to regulate hepatic gluconeogenesis. (A) Sixteen-hour fasting glucose concentrations from C57BL/6 male mice infected with Ad-US + Ad-GFP (US + GFP; n = 5), Ad-US + Ad-PRMT6 (US + PRMT6; n = 5), Ad-CRTC2 RNAi + Ad-GFP (CRTC2i + GFP; n = 5), or Ad-CRTC2 RNAi + Ad-PRMT6 adenovirus (CRTC2i + PRMT6; n = 4). (B) Pyruvate tolerance test showing the effects of PRMT6 expression on CRTC2-dependent hepatic glucose metabolism (US + GFP, n = 5 mice; US + PRMT6, n = 5 mice; CRTC2i + GFP, n = 5 mice; and CRTC2i + PRMT6, n = 4 mice). (C) Western blot analysis showing PRMT6 and CRTC2 expression upon adenoviral infection. Each lane represents a separate mouse. (D) qPCR analysis showing the effects of PRMT6 expression on CRTC2-dependent regulation of gluconeogenic enzyme–encoding genes (n = 3 mice per group). Data in (A) and (B) represent means ± SEM (*P < 0.05, **P < 0.01, t test), and data in (C) represent means ± SD (*P < 0.05, **P < 0.01, Mann-Whitney test).

RESEARCH ARTICLE

cates is shown. (E) Six-hour fasting glucose concentrations (left), 16-hour fasting glucose concentrations (middle), and 16-hour fasting insulin concentrations (right) from mice infected with Ad-US (n = 8 mice) or Ad-PRMT6 RNAi (1005i) (n = 7 mice). (F) Pyruvate tolerance test showing the effects of PRMT6 knockdown (by 1005i) on hepatic glucose metabolism (n = 8 mice per group) (top). PRMT6 knockdown was shown by Western blot analysis (bottom). Each lane represents a separate mouse. (G) Effects of PRMT6 knockdown (by 1005i) on the expression of gluconeogenic enzyme–encoding genes in mice. n = 4 mice per group. Data in (A), (B), (D), and (G) represent means ± SD (*P < 0.05, **P < 0.01, Mann-Whitney test), and data in (E) and (F) represent means ± SEM (*P < 0.05, **P < 0.01, t test).

described (20). We observed an additive activation of CRTC2-dependent CRE activity by PRMT5 and PRMT6 (fig. S1C), suggesting that these two PRMTs might function independently. The mRNA and protein abundance of hepatic PRMT6 was enhanced under fasting conditions, as well as in diet-induced or genetic mouse models

of insulin resistance (Fig. 6A). Because the regulation occurs at the mRNA level, it is possible that the transcriptional activators that are induced under these conditions might be involved in controlling the expression of PRMT6. We did not observe changes in the mRNA abundance of PRMT6 upon CRTC2 knockdown in primary hepatocytes, suggesting a lack of a


25 February 2014


6


Fig. 5. Depletion of hepatic PRMT6 lowers blood glucose concentrations. (A) Effects of PRMT6 knockdown (by 1005i) on gluconeogenic enzyme–encoding genes in primary hepatocytes (n = 4 sets of cells). US, unspecific RNAi. (B) The effects of PRMT6 knockdown (by 1005i) on glucose production were shown by glucose output assay in primary hepatocytes (n = 3 sets of cells). (C) Effects of PRMT6 knockdown (by 1005i) on asymmetric dimethylation, phosphorylation, and CREB-interacting potential of CRTC2. Flag immunoprecipitates were blotted with Flag, p-CRTC2, CREB, and ASYM24 antibodies. n = 3 independent experiments. (D) ChIP experiments showing the effects of PRMT6 knockdown (by 1005i) on CRTC2, p300, or CBP occupancy over the PEPCK promoter in hepatocytes. A representative experiment of three biological repli-

RESEARCH ARTICLE

MATERIALS AND METHODS

Plasmids The CRTC2 arginine-to-lysine mutants 4RK (R51K, R99K, R120K, R123K) and 2RK (R161K, R168K) and the PRMT6 (V86K/D88A) mutant were generated by site-directed mutagenesis with a QuikChange kit according to the manufacturer’s protocol (Stratagene). All constructs were confirmed by sequencing.

Culture of primary hepatocytes

Fig. 6. Knockdown of PRMT6 restores euglycemia in insulin-resistant mice. (A) Abundance of PRMT6 protein (left) and mRNA (right) in the insulin-resistant state or under fasting conditions (n = 3 to 5 mice per condition). HSP90, heatshock protein 90. (B) CRTC2 immunoprecipitates were blotted with antibodies against CRTC2 and PRMT6 to show the different degrees of association between the two proteins in livers of normal chow diet (NCD)–fed mice and those of mice fed a high-fat diet (HFD) (n = 3 mice per condition; each lane represents a separate mouse). (C) Six-hour fasting glucose concentrations (top left) and body weight (bottom left) showing the effect of PRMT6 knockdown (by 1005i) in HFD-fed mice. n = 10 mice per group. PRMT6 abundance upon adenovirus-mediated knockdown was also shown by Western blot analysis (bottom right). Each lane represents a separate mouse. (D) Pyruvate tolerance test showing the effects of PRMT6 knockdown (by 1005i) on hepatic glucose metabolism in HFD-fed mice. n = 10 mice per group. (E) qPCR analysis showing the effects of PRMT6 knockdown (by 1005i) on hepatic expression of gluconeogenic enzyme–encoding genes in HFD-fed mice (n = 4 mice per group). Data in (A) and (E) represent means ± SD (*P < 0.05, **P < 0.01, Mann-Whitney test), and data in (C) and (D) represent means ± SEM (*P < 0.05, **P < 0.01, t test).


Primary hepatocytes were prepared from 8- to 10-week-old C57BL/6 mice by the collagenase perfusion method as described previously (28). Afterward, cells were maintained in medium 199 (Sigma) supplemented with 10% fetal bovine serum (FBS), penicillin (10 U/ml), streptomycin (10 mg/ml), and 10 nM dexamethasone. Adenoviral infection was carried out for 48 to 72 hours for most experiments unless otherwise stated in the figure legends. For the glucose output assay, cells were stimulated with 10 mM forskolin and 100 nM dexamethasone in Krebs-Ringer buffer containing gluconeogenic substrates (20 mM lactate and 2 mM pyruvate) for 8 hours (29). Glucose concentrations were measured with a Glucose Assay Kit (Cayman Chemical).

25 February 2014


7


cross-regulatory loop between the two proteins (fig. S5B). The mRNA abundance of PRMT2 was also pronounced in the livers of mice fed a high-fat diet (fig. S6A). Mammalian PRMT2 does not have an intrinsic enzyme activity, but may participate in the transfer of methyl group onto the arginine residue by forming a heterodimer with other enzymatically active PRMTs (16). Further study is necessary to explore the biological role of PRMT2, especially in the insulinresistant state. In summary, we identified PRMT6 as a specific regulator of CRTC2 activity that catalyzes the asymmetric dimethylation of arginine residues in its N terminus, thereby modulating CREB-CRTC2 interaction. Furthermore, we demonstrated that reducing PRMT6 abundance in the liver restored euglycemia in mouse models of insulin resistance (fig. S7B). Development of PRMT6-specific inhibitors might be potentially beneficial for the treatment of type 2 diabetes by relieving hyperglycemia.

RESEARCH ARTICLE Reporter assays

Immunoblotting

293T cells were plated onto 24-well plates and then maintained in Dulbecco’s modified Eagle’s medium (HyClone) supplemented with 10% FBS, penicillin (10 U/ml), and streptomycin (10 mg/ml). Each transfection was performed with 100 ng of 6xCRE luciferase, 50 ng of b-galactosidase, 10 ng of expression vector for CRTC2, and/or 50 ng of expression vector for various PRMTs using TransIT-LT1 reagent (Mirus) for 48 hours. Cells were treated with 10 mM forskolin for 4 hours before being harvested. Luciferase activity was determined with the Promega luciferase assay kit according to the manufacturer’s protocol and normalized by b-galactosidase activity.

Western blot analyses of whole-cell extracts were performed as described (33). PRMT6 antibody was from Bethyl Laboratories (A300-928A, 929A). Antibodies against HA or Flag were purchased from Sigma. ASYM24 (Millipore) was used to detect dimethylated arginine or immunoprecipitate proteins containing dimethylarginine residues. An antibody against heatshock protein 90 (Santa Cruz Biotechnology) was used to assess for equal loading.

Mass spectrometry

Purification of GST fusion proteins was performed according to the manufacturer’s protocol (Amersham Pharmacia Biotech). For pulldown assays, GST- or GST-PRMT6 proteins were bound to glutathione–Sepharose 4B and then incubated with Flag-CRTC2 in a reaction buffer [100 mM NaCl, 20 mM tris-Cl (pH 8.0), 1 mM phenylmethylsulfonyl fluoride] at 30°C for 1 hour. Samples were washed with PBS (phosphate-buffered saline) buffer three times, and the proteins were separated by SDS-PAGE. For coimmunoprecipitation, 293T cells were transfected with each expression plasmid and then treated with 10 mM forskolin for 30 min. Cell extracts were prepared in lysis buffer [20 mM tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100] supplemented with a protease inhibitor cocktail. The lysates were bound with Flag- or HA-agarose (Sigma) for 2 hours at 4°C, and then eluted by SDS sample buffer. The samples were detected by Western blot analysis.

Animal experiments Eight-week-old male C57BL/6 mice or diabetic db/db mice (Charles River Laboratories) were used for adenoviral infection as described previously (34). For pyruvate challenge, mice were fasted for 16 hours and then injected intraperitoneally with pyruvate (2 g/kg of body weight for wild-type lean mice and 1.5 g/kg for db/db or high-fat diet–fed mice). All procedures were performed according to the guidelines approved by the Sungkyunkwan University School of Medicine Institutional Animal Care and Use Committee.

Measurement of metabolites Blood glucose concentrations were measured from tail vein blood with an automatic glucose monitor (One Touch, LifeScan). Plasma insulin concentrations (ALPCO Diagnostics) were measured according to the manufacturer’s protocol.

Chromatin immunoprecipitation Mouse primary hepatocytes were infected with adenovirus for Flag-PRMT6 or Flag-CRTC2 for 48 hours. After treatment with 10 mM forskolin for 30 min, cells were cross-linked with 1% formaldehyde for 10 min at 37°C and stopped by the addition of glycine to a final concentration of 0.125 M. The ChIP assay was performed using a ChIP assay kit (Millipore) according to the manufacturer’s protocol, as described (21). Chromatin was immunoprecipitated by incubating with CRTC2 (Calbiochem), p300, and CBP (both from Santa Cruz Biotechnology) antibodies for 16 hours at 4°C. Precipitated DNA fragments were analyzed by PCR using primer sets that encompassed the proximal (−484 to −12) region of the mouse PEPCK promoter. For qPCR, total input was used as an internal control.

Adenovirus Wild-type CRTC2, CRTC2 RNAi (target sequence: TGGGTCTCTGCCCAATGTTAACC), unspecific RNAi that does not target any known mouse genes (GGCATTACAGTATCGATCAG), CRE luciferase, and RSV (Rous sarcoma virus)–b-gal adenoviruses have been described previously (6, 11, 31). Ad-PRMT6 RNAi was generated using a specific sequence within the coding region of mouse PRMT6 (1005i: ACAAGATACGGACATTTCC, 1069i: CGCATACTTCTGCGCTACAAA) as described previously (32).

Quantitative PCR Total RNAwas prepared, and mRNA abundance was measured as previously described (35). Complementary DNAs generated by amfiRivert reverse transcriptase (GenDEPOT) were analyzed by qPCR with an SYBR Green PCR kit and TP800 Thermal Cycler Dice Real Time System (Takara). All data were normalized to ribosomal L32 expression.

Statistical analyses Results are represented as either mean ± SEM (for metabolites) or mean ± SD (for qPCR and luciferase assay). Comparison of different groups was carried out using two-tailed unpaired Student’s t test or the Mann-Whitney test as indicated in the figure legends. Differences were considered statistically significant at P < 0.05.

SUPPLEMENTARY MATERIALS www.sciencesignaling.org/cgi/content/full/7/314/ra19/DC1 Fig. S1. PRMT6 enhances CRTC2-dependent transcription. Fig. S2. Six arginine residues in CRTC2 are dimethylated. Fig. S3. PRMT6 targets conserved arginine residues of CRTC families.


25 February 2014


8


To isolate the CRTC2-associated protein complex, nuclear extracts were prepared from 293T cells treated with 5 mM forskolin for 2 hours by Dignam’s method (30). Nuclear extracts were incubated with anti-CRTC2 (10 mg/ml; Bethyl Laboratories), shaken gently for 4 hours at 4°C, and centrifuged at 20,000g for 30 min at 4°C. Supernatants were incubated with protein A beads (Sigma) and gently shaken for 1 hour at 4°C. Beads were collected, washed with NETN buffer [20 mM tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA, and 0.5% NP-40], and separated by SDS–polyacrylamide gel electrophoresis (SDS-PAGE). Protein bands were cut out of the gel vertically and incubated on a shaker with destaining solution (40% methanol, 50 mM NaHCO3 in water) and then with water for 1 day. Gel bands were equilibrated in 50 mM NH4HCO3 and digested by trypsin (1 ml, 25 mg/200 ml) at 37°C for 4 hours. To extract the protein, acetonitrile solution (100% acetonitrile) was added to the digested gel and shaken at high speed for 5 min. The supernatants were dried in a speed vacuum system for 1 hour at high temperature. Tryptic peptides were analyzed by LC-MS/MS. For the analysis of dimethylated arginine residues on CRTC2, pcDNA3Flag-CRTC2 and pcDNA3-HA-PRMT6 constructs were transiently transfected into 293T cells for 48 hours. After treatment with 10 mM forskolin for 2 hours, Flag-CRTC2 was isolated by immunoprecipitation with anti-Flag agarose and analyzed by SDS-PAGE. The protein band corresponding to CRTC2 was excised and subjected to in-gel digestion with trypsin. Nano– LC-MS/MS analysis was performed using an LTQ ABI Q-STAR mass spectrometer (Agilent). The modified peptides were analyzed using the Mascot algorithm (Matrix Science). The experiment was performed in Yonsei Proteomics Research Center, Seoul, Korea.

GST pulldown and coimmunoprecipitation assays

RESEARCH ARTICLE Fig. S4. PRMT6 is critical for CRTC2-dependent regulation of gluconeogenic genes in hepatocytes. Fig. S5. CRTC2 is crucial in mediating PRMT6-dependent control of hepatic glucose metabolism in hepatocytes. Fig. S6. Knockdown of PRMT6 reduces the expression of gluconeogenic genes in insulinresistant state. Fig. S7. PRMT6 is critical in mediating the fasting response to CRTC2-dependent gluconeogenesis. Table S1. Identification of CRTC2-interacting proteins.

REFERENCES AND NOTES

Acknowledgments: We thank S. M. Park for technical assistance. Funding: This work was supported by the National Research Foundation of Korea (grant nos. NRF-2010-0015098 and NRF-2012M3A9B6055345), funded by the Ministry of Science and Technology, Republic of Korea, and a grant from the Korea Health Technology R&D Project (grant no. A111345), Ministry of Health and Welfare, Republic of Korea. H.-S.H. is supported by a Korea University grant. Author contributions: The project was conceived by S.-H.K. Experiments were designed and performed by H.-S.H., C.-Y.J., S.C., Y.-S.Y., D.C., G.K., S.-T.K., and S.-H.K. and were analyzed by H.-S.H., S.-T.K., and K.-G.P.; S.-H.K., H.-S.H., and S.-H.K. wrote the paper. Data and materials availability: The raw image files for the MS data can be accessed at the following Web site: http://biomed.skku.edu/CRTC2.htm. Competing interests: The authors declare that they have no competing interests. Submitted 2 July 2013 Accepted 5 February 2014 Final Publication 25 February 2014 10.1126/scisignal.2004479 Citation: H.-S. Han, C.-Y. Jung, Y.-S. Yoon, S. Choi, D. Choi, G. Kang, K.-G. Park, S.-T. Kim, S.-H. Koo, Arginine methylation of CRTC2 is critical in the transcriptional control of hepatic glucose metabolism. Sci. Signal. 7, ra19 (2014).


25 February 2014


9


1. S. J. Pilkis, T. H. Claus, Hepatic gluconeogenesis/glycolysis: Regulation and structure/ function relationships of substrate cycle enzymes. Annu. Rev. Nutr. 11, 465–515 (1991). 2. S. J. Pilkis, T. H. Claus, M. R. el-Maghrabi, The role of cyclic AMP in rapid and longterm regulation of gluconeogenesis and glycolysis. Adv. Second Messenger Phosphoprotein Res. 22, 175–191 (1988). 3. G. A. Gonzalez, M. R. Montminy, Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59, 675–680 (1989). 4. R. W. Hanson, L. Reshef, Regulation of phosphoenolpyruvate carboxykinase (GTP) gene expression. Annu. Rev. Biochem. 66, 581–611 (1997). 5. S. Herzig, F. Long, U. S. Jhala, S. Hedrick, R. Quinn, A. Bauer, D. Rudolph, G. Schutz, C. Yoon, P. Puigserver, B. Spiegelman, M. Montminy, CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 413, 179–183 (2001). 6. S. H. Koo, L. Flechner, L. Qi, X. Zhang, R. A. Screaton, S. Jeffries, S. Hedrick, W. Xu, F. Boussouar, P. Brindle, H. Takemori, M. Montminy, The CREB coactivator TORC2 is a key regulator of fasting glucose metabolism. Nature 437, 1109–1111 (2005). 7. M. Montminy, S. H. Koo, X. Zhang, The CREB family: Key regulators of hepatic metabolism. Ann. Endocrinol. 65, 73–75 (2004). 8. P. G. Quinn, D. K. Granner, Cyclic AMP-dependent protein kinase regulates transcription of the phosphoenolpyruvate carboxykinase gene but not binding of nuclear factors to the cyclic AMP regulatory element. Mol. Cell. Biol. 10, 3357–3364 (1990). 9. Y. Wang, G. Li, J. Goode, J. C. Paz, K. Ouyang, R. Screaton, W. H. Fischer, J. Chen, I. Tabas, M. Montminy, Inositol-1,4,5-trisphosphate receptor regulates hepatic gluconeogenesis in fasting and diabetes. Nature 485, 128–132 (2012). 10. Y. S. Yoon, M. W. Lee, D. Ryu, J. H. Kim, H. Ma, W. Y. Seo, Y. N. Kim, S. S. Kim, C. H. Lee, T. Hunter, C. S. Choi, M. R. Montminy, S. H. Koo, Suppressor of MEK null (SMEK)/protein phosphatase 4 catalytic subunit (PP4C) is a key regulator of hepatic gluconeogenesis. Proc. Natl. Acad. Sci. U.S.A. 107, 17704–17709 (2010). 11. R. Dentin, Y. Liu, S. H. Koo, S. Hedrick, T. Vargas, J. Heredia, J. Yates III, M. Montminy, Insulin modulates gluconeogenesis by inhibition of the coactivator TORC2. Nature 449, 366–369 (2007). 12. R. J. Shaw, K. A. Lamia, D. Vasquez, S. H. Koo, N. Bardeesy, R. A. Depinho, M. Montminy, L. C. Cantley, The kinase LKB1 mediates glucose homeostasis in liver and therapeutic effects of metformin. Science 310, 1642–1646 (2005). 13. R. Dentin, S. Hedrick, J. Xie, J. Yates III, M. Montminy, Hepatic glucose sensing via the CREB coactivator CRTC2. Science 319, 1402–1405 (2008). 14. Y. Liu, R. Dentin, D. Chen, S. Hedrick, K. Ravnskjaer, S. Schenk, J. Milne, D. J. Meyers, P. Cole, J. Yates III, J. Olefsky, L. Guarente, M. Montminy, A fasting inducible switch modulates gluconeogenesis via activator/coactivator exchange. Nature 456, 269–273 (2008). 15. M. T. Bedford, S. G. Clarke, Protein arginine methylation in mammals: Who, what, and why. Mol. Cell 33, 1–13 (2009). 16. M. L. Pak, T. M. Lakowski, D. Thomas, M. I. Vhuiyan, K. Hüsecken, A. Frankel, A protein arginine N-methyltransferase 1 (PRMT1) and 2 heteromeric interaction increases PRMT1 enzymatic activity. Biochemistry 50, 8226–8240 (2011). 17. D. Choi, K. J. Oh, H. S. Han, Y. S. Yoon, C. Y. Jung, S. T. Kim, S. H. Koo, Protein arginine methyltransferase 1 regulates hepatic glucose production in a FoxO1-dependent manner. Hepatology 56, 1546–1556 (2012). 18. A. Krones-Herzig, A. Mesaros, D. Metzger, A. Ziegler, U. Lemke, J. C. Brüning, S. Herzig, Signal-dependent control of gluconeogenic key enzyme genes through coactivatorassociated arginine methyltransferase 1. J. Biol. Chem. 281, 3025–3029 (2006). 19. N. Yadav, D. Cheng, S. Richard, M. Morel, V. R. Iyer, C. M. Aldaz, M. T. Bedford, CARM1 promotes adipocyte differentiation by coactivating PPARg. EMBO Rep. 9, 193–198 (2008). 20. W. W. Tsai, S. Niessen, N. Goebel, J. R. Yates III, E. Guccione, M. Montminy, PRMT5 modulates the metabolic response to fasting signals. Proc. Natl. Acad. Sci. U.S.A. 110, 8870–8875 (2013).

21. R. A. Screaton, M. D. Conkright, Y. Katoh, J. L. Best, G. Canettieri, S. Jeffries, E. Guzman, S. Niessen, J. R. Yates III, H. Takemori, M. Okamoto, M. Montminy, The CREB coactivator TORC2 functions as a calcium- and cAMP-sensitive coincidence detector. Cell 119, 61–74 (2004). 22. D. Choi, K. J. Oh, S. H. Koo, Protein arginine methylation in hepatic glucose metabolism regulation: Histone or nonhistone? That is the question: Reply. Hepatology 57, 2091 (2013). 23. H. Wang, Z. Q. Huang, L. Xia, Q. Feng, H. Erdjument-Bromage, B. D. Strahl, S. D. Briggs, C. D. Allis, J. Wong, P. Tempst, Y. Zhang, Methylation of histone H4 at arginine 3 facilitating transcriptional activation by nuclear hormone receptor. Science 293, 853–857 (2001). 24. Y. Takahashi, H. Daitoku, K. Hirota, H. Tamiya, A. Yokoyama, K. Kako, Y. Nagashima, A. Nakamura, T. Shimada, S. Watanabe, K. Yamagata, K. Yasuda, N. Ishii, A. Fukamizu, Asymmetric arginine dimethylation determines life span in C. elegans by regulating forkhead transcription factor DAF-16. Cell Metab. 13, 505–516 (2011). 25. K. Yamagata, H. Daitoku, Y. Takahashi, K. Namiki, K. Hisatake, K. Kako, H. Mukai, Y. Kasuya, A. Fukamizu, Arginine methylation of FOXO transcription factors inhibits their phosphorylation by Akt. Mol. Cell 32, 221–231 (2008). 26. J. Y. Altarejos, N. Goebel, M. D. Conkright, H. Inoue, J. Xie, C. M. Arias, P. E. Sawchenko, M. Montminy, The Creb1 coactivator Crtc1 is required for energy balance and fertility. Nat. Med. 14, 1112–1117 (2008). 27. Y. Song, J. Altarejos, M. O. Goodarzi, H. Inoue, X. Guo, R. Berdeaux, J. H. Kim, J. Goode, M. Igata, J. C. Paz, M. F. Hogan, P. K. Singh, N. Goebel, L. Vera, N. Miller, J. Cui, M. R. Jones; CHARGE Consortium; GIANT Consortium; Y. D. Chen, K. D. Taylor, W. A. Hsueh, J. I. Rotter, M. Montminy, CRTC3 links catecholamine signalling to energy balance. Nature 468, 933–939 (2010). 28. Y. S. Yoon, W. Y. Seo, M. W. Lee, S. T. Kim, S. H. Koo, Salt-inducible kinase regulates hepatic lipogenesis by controlling SREBP-1c phosphorylation. J. Biol. Chem. 284, 10446–10452 (2009). 29. K. J. Oh, J. Park, S. S. Kim, H. Oh, C. S. Choi, S. H. Koo, TCF7L2 modulates glucose homeostasis by regulating CREB- and FoxO1-dependent transcriptional pathway in the liver. PLOS Genet. 8, e1002986 (2012). 30. M. F. Carey, C. L. Peterson, S. T. Smale, Dignam and Roeder nuclear extract preparation. Cold Spring Harb. Protoc. 2009, pdb prot5330 (2009). 31. S. Herzig, S. Hedrick, I. Morantte, S. H. Koo, F. Galimi, M. Montminy, CREB controls hepatic lipid metabolism through nuclear hormone receptor PPAR-g. Nature 426, 190–193 (2003). 32. T. C. He, S. Zhou, L. T. da Costa, J. Yu, K. W. Kinzler, B. Vogelstein, A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. U.S.A. 95, 2509–2514 (1998). 33. Y. S. Yoon, D. Ryu, M. W. Lee, S. Hong, S. H. Koo, Adiponectin and thiazolidinedione targets CRTC2 to regulate hepatic gluconeogenesis. Exp. Mol. Med. 41, 577–583 (2009). 34. D. Ryu, W. Y. Seo, Y. S. Yoon, Y. N. Kim, S. S. Kim, H. J. Kim, T. S. Park, C. S. Choi, S. H. Koo, Endoplasmic reticulum stress promotes LIPIN2-dependent hepatic insulin resistance. Diabetes 60, 1072–1081 (2011). 35. K. J. Oh, J. Park, S. Y. Lee, I. Hwang, J. B. Kim, T. S. Park, H. J. Lee, S. H. Koo, Atypical antipsychotic drugs perturb AMPK-dependent regulation of hepatic lipid metabolism. Am. J. Physiol. Endocrinol. Metab. 300, E624–E632 (2011).

Arginine Methylation of CRTC2 Is Critical in the Transcriptional Control of Hepatic Glucose Metabolism Hye-Sook Han, Chang-Yun Jung, Young-Sil Yoon, Seri Choi, Dahee Choi, Geon Kang, Keun-Gyu Park, Seong-Tae Kim and Seung-Hoi Koo (February 25, 2014) Science Signaling 7 (314), ra19. [doi: 10.1126/scisignal.2004479]

The following resources related to this article are available online at http://stke.sciencemag.org. This information is current as of December 4, 2015.

Visit the online version of this article to access the personalization and article tools: http://stke.sciencemag.org/content/7/314/ra19

Supplemental Materials

"Supplementary Materials" http://stke.sciencemag.org/content/suppl/2014/02/21/7.314.ra19.DC1

Related Content

References Permissions

The editors suggest related resources on Science's sites: http://stke.sciencemag.org/content/sigtrans/6/304/ra104.full http://stke.sciencemag.org/content/sigtrans/4/190/ra58.full http://stke.sciencemag.org/content/sigtrans/6/259/ra4.full http://stke.sciencemag.org/content http://stke.sciencemag.org/content http://stke.sciencemag.org/content This article cites 35 articles, 12 of which you can access for free at: http://stke.sciencemag.org/content/7/314/ra19#BIBL Obtain information about reproducing this article: http://www.sciencemag.org/about/permissions.dtl

Science Signaling (ISSN 1937-9145) is published weekly, except the last December, by the American Association for the Advancement of Science, 1200 New York Avenue, NW, Washington, DC 20005. Copyright 2015 by the American Association for the Advancement of Science; all rights reserved.


Article Tools

Transcriptional control of hepatic lipid metabolism by SREBP and ChREBP.

Control of hepatic glucose metabolism by islet and brain.

Roles of protein arginine methyltransferases in the control of glucose metabolism.

Glucose control in critical care.

Influence of arginine on splanchnic glucose metabolism in man.

Metabolism: Mechanisms of hepatic glucose production revealed.

The Methionine Transamination Pathway Controls Hepatic Glucose Metabolism through Regulation of the GCN5 Acetyltransferase and the PGC-1α Transcriptional Coactivator.

Compartmentation and control of arginine metabolism in Neurospora.

Insulin control of hepatic glucose production.

Transcriptional control of the rat hepatic CYP2E1 gene.

Dynamic control of hepatic glucose metabolism: Studies by experiment and computer simulation.

Role of Mig-6 in hepatic glucose metabolism.

Hepatic metabolism of glucose and glycogen in fed rats.

Arginine hydroxamate-resistant mutants of Bacillus subtilis with altered control of arginine metabolism.

Kruppel-like factor 4 is critical for transcriptional control of cardiac mitochondrial homeostasis.

KSRP is critical in governing hepatic lipid metabolism through controlling Per2 expression.

Effect of starvation on hepatic glycogen metabolism and glucose homeostasis.

CRTC2 signaling cascade regulates hepatic BMAL1 protein.

Hepatic heme metabolism and its control.

L-Arginine Availability and Metabolism Is Altered in Ulcerative Colitis.

Hepatic Insulin Resistance Following Chronic Activation of the CREB Coactivator CRTC2.

Transcriptional control of the B3GALT5 gene by a retroviral promoter and methylation of distant regulatory elements.

In vitro methylation assay to study protein arginine methylation.

Dietary iron controls circadian hepatic glucose metabolism through heme synthesis.