Accepted Manuscript Title: Characterization of DNA substrate specificities of apurinic/apyrimidinic endonucleases from Mycobacterium tuberculosis Author: Sailau Abeldenov Ibtissam Talhaoui Dmitry O. Zharkov Alexander A. Ishchenko Erlan Ramanculov Murat Saparbaev Bekbolat Khassenov PII: DOI: Reference:

S1568-7864(15)00129-9 http://dx.doi.org/doi:10.1016/j.dnarep.2015.05.007 DNAREP 2116

To appear in:

DNA Repair

Received date: Revised date: Accepted date:

19-12-2014 19-4-2015 18-5-2015

Please cite this article as: Sailau Abeldenov, Ibtissam Talhaoui, Dmitry O.Zharkov, Alexander A.Ishchenko, Erlan Ramanculov, Murat Saparbaev, Bekbolat Khassenov, Characterization of DNA substrate specificities of apurinic/apyrimidinic endonucleases from Mycobacterium tuberculosis, DNA Repair http://dx.doi.org/10.1016/j.dnarep.2015.05.007 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

1 Characterization of DNA substrate specificities of apurinic/apyrimidinic endonucleases from Mycobacterium tuberculosis Sailau Abeldenova, Ibtissam Talhaouib, Dmitry O. Zharkovc,d, Alexander A. Ishchenkob, Erlan Ramanculova, Murat Saparbaevb*[email protected], Bekbolat Khassenova*[email protected] a

National Center for Biotechnology, Astana 010000, Kazakhstan. Groupe «Réparation de l′ADN», Université Paris Sud, Laboratoire «Stabilité Génétique et Oncogenèse» CNRS, UMR 8200, Gustave Roussy, F-94805 Villejuif Cedex, France. c SB RAS Institute of Chemical Biology and Fundamental Medicine, Novosibirsk 630090, Russia d Novosibirsk State University, Novosibirsk 630090, Russia b

*

Corresponding authors. Tel: +33 142115405; fax: +33 142115008

2 Graphical Abstract

3 Highlights Mycobacterium AP endonucleases contain 3'-repair phosphodiesterase activities; Mycobacterium AP endonucleases have very weak AP site cleavage activity; Mycobacterium homologue of E. coli endonuclease IV contains NIR function; Both MtbXthA and MtbNfo have optimum activity at pH 6.5; Expression of MtbXthA and MtbNfo rescue drug sensitivity of E. coli xth nfo mutant.

4 Abbreviations ROS: reactive oxygen species IR: H2O2, hydrogen peroxide MMS: methylmethanesulfonate AP: apurinic/apyrimidinic site THF: 3-hydroxy-2-hydroxymethyltetrahydrofuran or tetrahydrofuran 3′-P: 3′-phosphate 3′-PA: 3′-phospho α,β-unsaturated aldehyde 3′-THF: 3′-terminal THF residue αdN: alpha-anomeric 2′-deoxynucleosides DHU: 5,6-dihydrouracil AP: apurinic/apyrimidinic site αdA: alpha-anomeric 2′-deoxyadenosine BER: base excision repair NIR: nucleotide incision repair Nfo: Escherichia coli endonuclease IV Xth: Escherichia coli exonuclease III MtbXthA: Mycobacterium tuberculosis homologue of E. coli exonuclease III MtbNfo: Mycobacterium tuberculosis homologue of E. coli endonuclease IV APE1: major human AP endonuclease 1 IPTG: isopropyl β-D-1-thiogalactopyranoside.

5 Abstract Apurinic/apyrimidinic (AP) endonucleases are key enzymes involved in the repair of abasic sites and DNA strand breaks. Pathogenic bacteria Mycobacterium tuberculosis contains two AP endonucleases: MtbXthA and MtbNfo, members of the exonuclease III and endonuclease IV families, which are exemplified by Escherichia coli Xth and Nfo, respectively. It has been shown that both MtbXthA and MtbNfo contain AP endonuclease and 3′5′ exonuclease activities. However, it remains unclear whether these enzymes hold 3′-repair phosphodiesterase and nucleotide incision repair (NIR) activities. Here, we report that both mycobacterial enzymes have 3′-repair phosphodiesterase and 3′phosphatase, and MtbNfo contains in addition a very weak NIR activity. Interestingly, depending on pH, both enzymes require different concentrations of divalent cations: 0.5 mM MnCl2 at pH 7.6 and 10 mM at pH 6.5. MtbXthA requires a low ionic strength and 37°C, while MtbNfo requires high ionic strength (200 mM KCl) and has a temperature optimum at 60°C. Point mutation analysis showed that D180 and N182 in MtbXthA and H206 and E129 in MtbNfo are critical for enzymes activities. The steady-state kinetic parameters indicate that MtbXthA removes 3′-blocking sugar-phosphate and 3′phosphate moieties at DNA strand breaks with an extremely high efficiency (kcat/KM = 440 and 1280 M–1·min–1, respectively), while MtbNfo exhibits much lower 3′-repair activities (kcat/KM = 0.26 and 0.65 M–1·min–1, respectively). Surprisingly, both MtbXthA and MtbNfo exhibited very weak AP site cleavage activities, with kinetic parameters 100- and 300-fold lower, respectively, as compared with the results reported previously. Expression of MtbXthA and MtbNfo reduced the sensitivity of AP endonuclease-deficient E. coli xth nfo strain to methylmethanesulfonate and H2O2 to various degrees. Taken together, these data establish the DNA substrate specificity of M. tuberculosis AP endonucleases and suggest their possible role in the repair of oxidative DNA damage generated by endogenous and host-imposed factors.

Keywords oxidative DNA damage, Abasic sites, DNA repair, AP endonucleases, 3′-repair phosphodiesterases. Short title: Mycobacterium AP endonucleases

6

1. Introduction Cellular DNA encounters two types of endogenous injury: oxidative damage caused by reactive oxygen species (ROS), which comprises oxidized bases, sugars and DNA strand breaks, and spontaneous damage including abasic sites and deaminated bases [1]. Importantly, direct action of ROS on DNA causes strand breaks, which are a highly cytotoxic type of oxidative damage. Hydroxyl radicals abstract hydrogen atoms from the deoxyribose moiety of nucleotide units in DNA resulting in the release of a free base and an unstable oxidized sugar, which disintegrates with phosphodiester bond breakage. The resulting DNA strand breaks typically bear 5′-phosphate and 3′-blocking groups including 3′-phosphate (3′P) and 3′-phosphoglycolate (3′PGA). If unrepaired, these DNA lesions lead to replication fork collapse and transcription blockage, followed by genome rearrangements and/or cell death [2]. Non-bulky endogenous DNA base lesions and single-strand breaks containing 3′-blocking groups are substrates for two overlapping pathways: base excision repair (BER) and nucleotide incision repair (NIR) [3]. The classic BER pathway involves two sequential excision/incision steps: first, a DNA glycosylase hydrolyses the N-glycosydic bond between the damaged base and the sugar, leaving either an apurinic/apyrimidinic (AP) site or a single-stranded DNA break with a 1-nt gap flanked with a 3′-blocking group and a 5′-phosphate [4-5]. In the second step of BER, an AP endonuclease cleaves 5′ next to AP site leaving a single-stranded DNA break flanked with a 3′hydroxyl group and a 5′-deoxyribose phosphate moiety, or removes 3′-blocking groups in the 1-nt gap to generate proper 3′-hydroxyl termini. Alternatively, in the NIR pathway, an AP endonuclease makes an incision 5′ next to a damaged base and generates a single-strand break with a 5′-dangling modified nucleotide [6]. Non-ligatable DNA strand breaks, generated either directly by ROS or indirectly by oxidative-damage specific DNA glycosylase/AP lyases, are repaired by AP endonucleases that remove 3′-blocking groups by their 3′-repair phosphodiesterase functions to generate 3′-hydroxyl termini that can be used by DNA polymerases to initiate the repair synthesis, as well as by DNA ligases to seal the nicks [7-8]. AP endonucleases are thus the key proteins involved in BER, NIR and single-strand break repair (SSBR) pathways. AP endonucleases comprise two distinct families, exemplified by Escherichia coli exonuclease III (Xth, Mg2+-dependent) and endonuclease IV (Nfo, independent of external divalent cations) [9-10]. Both Xth and Nfo homologues are present in prokaryotes and eukaryotes, including Mycobacterium tuberculosis, Saccharomyces cerevisiae and Caenorhabditis elegans [10-11]. Interestingly, in mammals, homology search and immunodetection approaches fail to identify Nfo counterparts, and so far only the Xth family members APE1 and APE2 have been found [9-10]. BER, initiated by multiple DNA glycosylases, can handle the majority of oxidized bases [1213]. However, -anomers of 2′-deoxynucleosides (dN) including dA, T and dC, generated by free radicals under anoxic conditions, are not repaired by DNA glycosylases but rather by AP endonucleases via the NIR pathway [14-16]. Not all AP endonucleases contain the NIR function, in general, prokaryotic homologues of Nfo, but not of Xth possess the damage-specific nucleotide incision activity. Importantly, DNA substrate specificities of the BER and NIR pathways overlap since oxidized pyrimidines including 5-hydroxycytosine (5ohC) and 5,6-dihydrouridine (DHU) are substrates for both pathways [6, 16]. The NIR pathway is evolutionarily conserved from E. coli to human cells where the Nfo and APE1 proteins, respectively, can incise duplex oligonucleotides containing DHU, 5ohC and dA residues. Previously, we have shown that expression of the NIRdeficient Nfo protein in an AP endonuclease-null strain of E. coli suppresses its hypersensitivity to alkylation but not to oxidative DNA damage, suggesting that the NIR pathway is essential for protecting cells from potentially lethal oxidative DNA lesions [17]. Mycobacterium tuberculosis (Mtb), a pathogenic Gram-positive bacterium, is the main causative agent of tuberculosis in humans. Human infection by Mtb is characterized by several distinct stages. During the first step, the bacteria enter pulmonary alveoli in the lung and are phagocytized by alveolar macrophages and dendritic cells. This in turn initiates an immune response in which lymphocytes and macrophages migrate to the site of infection and cluster together to form a granuloma [18]. The granuloma consists of macrophages inhabited by mycobacteria, which reside in phagosomes and prevent them from fusing with lysosomes; this state of dormancy may persist for decades. In the active phase of the disease, the infected macrophages undergo caseous necrosis, which leads to the breakage of the granuloma and reactivation of the disease. To fight the pathogen, host

7 macrophages generate ROS and reactive nitrogen species (RNS); therefore, inside the granuloma, mycobacteria are exposed to high level of oxidative stress, nutrient starvation, hypoxia and acidic pH. These extremely harsh conditions induce mycobacteria to downregulate its metabolism and switch to a dormant or non-replicative state to survive. To counteract the genotoxic effects of DNA damage induced by the host immune system, Mtb contains several overlapping DNA repair pathways common in prokaryotes, including BER, nucleotide excision repair (NER), direct damage reversal, homologous recombination (HR) and translesion DNA synthesis. In addition, Mtb contain proteins of the non-homologous end-joining (NHEJ) pathway for DNA double-strand break repair, common in eukaryotes. Neither Mtb nor other mycobacteria encode homologs of the post-replicative mismatch repair (MMR) pathway. It should be noted that MMR deficiency in the majority of species, including E. coli, yeast and mammalian cells, results in 100 to 1000-fold elevated spontaneous mutation rates and overall genome instability. However, the lack of MMR system in Mtb does not seem to induce genome instability, and BER and NER pathways were proposed to provide a back-up to correct DNA replication errors. An analysis of the Mtb genome reveals the presence of two sequences, MtbXthA and MtbNfo (also referred as MtbEnd) homologous to E. coli Xth and Nfo, respectively [19]. Recently, Puri and co-workers have purified and characterized the recombinant MtbXthA and MtbEnd proteins in vitro showing that both enzymes contain AP site cleavage and 3′5′ exonuclease activities dependent on the presence of Mg2+ and Ca2+ [20]. Based on the results, they proposed that MtbNfo contains a more efficient AP endonuclease activity compared to MtbXthA. In the following work by these authors, M. tuberculosis mutants deficient either for one (Mtbend or MtbxthA) or both AP endonucleases (MtbendxthA) have been constructed and characterized for drug sensitivity [21]. The results showed that in culture, the double mutant MtbendxthA exhibits marked hypersensitivity to methyl methanesulfonate (MMS), an alkylating agent, and to hydrogen peroxide as compared to the wild type Mtb and single mutants (Mtbend and MtbxthA), suggesting that both AP endonucleases are required to repair AP sites and oxidative DNA damage. In agreement with this observation, the double mutant MtbendxthA also exhibited markedly reduced growth in the human THP-1 monocytes differentiated to macrophages before infection, as compared to wild type and single mutants [21]. Surprisingly, when the pathogenicity of Mtb has been tested in the guinea pig infection model, no significant differences between wild-type Mtb and AP endonuclease mutants in the bacterial load and damage to different organs were observed after 4 and 10 weeks post-infection [21]. To explain these apparent differences between the in vitro and in vivo results, the authors propose that Mtb may induce alternative AP endonuclease-independent DNA repair pathways during the host infection, but not in vitro nor in the cultured human macrophages. In the present work, the sequence homology between mycobacterial and E. coli AP endonucleases and the AP site cleavage activities of MtbXthA and MtbNfo prompted us to further examine the DNA substrate specificity of these enzymes. Here, we demonstrate that MtbXthA and MtbNfo possess 3′-repair phosphodiesterase and NIR activities. The steady-state kinetic parameters of mycobacterial AP endonuclease-catalyzed repair reactions have been measured and compared to those of E. coli Xth and Nfo. In agreement with the highly efficient 3′-cleansing functions of MtbXthA measured in vitro, we show that it can suppress the sensitivity of AP endonuclease-deficient E. coli strain to H2O2 exposure. The evolutionary conservation, structural basis and potential biological importance of the reported new specificity of MtbXthA and MtbNfo in the repair of spontaneous and host-induced damage to mycobacterial DNA are discussed.

8

2. Materials and methods 2.1. Bacterial strains, plasmids and reagents Restriction enzymes and T4 DNA ligase were purchased from Thermo Scientific (USA). The plasmids pET28c(+) (Novagen, UK) and pBluescript II SK+ were used to construct the expression vector. Enzyme Phusion High-Fidelity DNA Polymerase (Thermo Scientific, USA) was used for the amplification of the target gene. Methyl methanesulfonate (MMS) and H2O2 were purchased from Sigma-Aldrich Chimie S.a.r.l. (Lyon, France). E. coli strain BH110 (nfo::kanR [Δ(xthpncA)90X::Ƭn10]) was from the laboratory stock, and E. coli ArcticExpress (DE3) RP strain, from Novagen (Merck4Biosciences, France). E. coli BH110 was lysogenized with the helper phage (DE3) harboring a copy of the T7 RNA polymerase gene, using the DE3 lysogenization kit (Novagen, Merck4Biosciences, France). The resulting E. coli BH110(DE3) was transformed with pBluescript II SK+/MtbXthA and pBluescript II SK+/MtbNfo vectors encoding MtbXthA and MtbNfo, respectively, under the control of the T7 promoter. 2.2. Oligonucleotides All oligodeoxyribonucleotides containing modified residues and their complementary oligonucleotides were purchased from Eurogentec (Seraing, Belgium). They included the 30-mer XRT d(TGACTGCATAXGCATGTAGACGATGTGCAT) where X is either tetrahydrofuran (THF, a synthetic analog of an abasic site), uracil (U), -2′-deoxyadenosine (dA), 5-hydroxycytosine (5ohC) or 5,6-dihydrouracil (DHU), and complementary 30-mer oligonucleotides containing either dA, dG, dC or T opposite the lesion; 34-mer THF-MS d(AAATACATCGTCACCTGGGXCATGTTGCAGATCC) where X is THF and its complementary 34-mer JL-C oligonucleotide containing C opposite the lesion; 40-mer THF-DL d(AATTGCTATCTAGCTCCGCXCGCTGGTACCCATCTCATGA) where X is THF and its complementary 40-mer C40 oligonucleotide containing dC opposite the lesion. To obtain DNA substrates, complementary oligonucleotides were annealed; the resulting duplex oligonucleotides are referred to as X•C (G, A, T), respectively, where X is a modified residue. The DNA sequence contexts were previously used to study the DNA substrate specificities of bacterial, yeast and plant AP endonucleases [22-23]. Oligonucleotides were either 5′-end labeled either by T4 polynucleotide kinase (or by phosphatase minus mutant PNK) (New England Biolabs, OZYME France) in the presence of 32P]ATP (3,000 Ci•mmol–1) (PerkinElmer SAS, France), or 3′-end labeled by terminal transferase (New England Biolabs) in the presence of [32P]-3′-dATP (cordycepin 5′-triphosphate, 5,000 Ci•mmol–1) (PerkinElmer) as recommended by the manufacturers. The labelled oligonucleotides were annealed to their appropriate complementary oligonucleotides in a buffer containing 50 mM KCl and 20 mM HEPES–KOH (pH 7.5) at 65°C for 3 min and cooled down to room temperature over 2 h. The resulting duplex oligonucleotides are referred to as X•C (G, A, T), respectively, where X is a modified residue. The following oligonucleotides were used to measure the 3′5′ exonuclease, 3′-repair phosphodiesterase and 3′-phosphatase activities: 20-mer Exo20, d(GTGGCGCGGAGACTTAGAGA); 20-mer Exo20THF, d(GTGGCGCGGAGACTTAGAGAX), where X is a 3′-terminal THF; 20-mer Exo20P, d(GTGGCGCGGAGACTTAGAGAp), where p is 3′terminal phosphate; and complementary 40-mer Rex-T, d(GGAATTCCCCGCGCCAAATTTCTCTAAGTCTCCGCGCCAC) containing T opposite to THF. To detect the 3′-phosphatase activity, we prepared 20-mer Exo20 oligonucleotide containing 3′terminal 32P. Previously, we have shown that human tyrosyl-DNA phosphodiesterase 1 (Tdp1) can remove 3′-terminal cordycepin nucleosides producing an oligonucleotide fragment with a phosphate residue at the 3′ end [24]. In this work, the 20-mer Exo20 was 3′-end labelled using cordycepin [32P]3′-dATP to obtain a 21-mer Exo20-3′-dAM32P fragment, which was then treated with recombinant

9 Tdp1 (generously provided by Prof. Olga Lavrik, Novosibirsk, Russia). The resulting 20-mer Exo203′-32P fragment was annealed to the complementary Rex-T oligonucleotide and used together with non-labeled Exo20p•RexT duplex as a DNA substrate to measure the 3′-phosphatase activity. 2.3. Cloning and expression of Mycobacterium tuberculosis H37Rv genes end and xthA in E. coli and purification of their products the MtbXthA and MtbNfo proteins The PCR amplified target genes (Mycobacterium tuberculosis H37Rv, end (Rv0670) and xthA (Rv0427c)) were cloned into the pET-28c(+) vector at the NdeI/NotI and NcoI/NotI sites respectively resulting in the expression plasmids pET-28c-MtbNfo and pET-28c-MtbXthA. MtbNfo carries N- and C-terminal His-tag sequences, while MtbXthA carries only a C-terminal His-tag sequence. The plasmid inserts were sequenced and verified against the sequences from GenBank using Vector NTI software AdvanceTM v11.0 (Invitrogen, USA). Site-directed mutations within the MtbXthA and MtbNfo coding sequences in pET-28c-MtbXthA and pET-28c-MtbNfo were generated using the QuikChange site-directed mutagenesis kit (Quickchange® XL, Site-Directed Mutagenesis Kit, Stratagene). Designed oligonucleotide primers used to generate MtbXthA-D180N, MtbXthA-N182A, MtbNfo-E129Q and MtbNfo-H206N mutants are shown in Supplementary data Table S1. It should be noted in the present work we used tagged MtbXthA and MtbNfo proteins. The expression of the protein from pET-28c-MtbXthA produces a recombinant protein with 2 additional N-terminal amino acids residues (MA) and 11 additional C-terminal amino acids residues (AAALEHHHHHH) as compared to the native MtbXthA protein. This was at variance with the previous study by Puri and co-workers who isolated the recombinant MtbXthA protein that contained 5 additional N-terminal amino acids residues (MASGS) and 10 additional C-terminal amino acids residues (SAWSHPQFEK) as compared to the native MtbXthA. Concerning MtbNfo used in this work, the expression of the protein from pET-28c-MtbNfo produces the recombinant protein with 21 additional N-terminal amino acids residues (MGSSHHHHHHSSGLVPRGSHM) and 11 additional Cterminal amino acids residues (AAALEHHHHHH) as compared to the native MtbNfo. Puri and coworkers used the recombinant MtbNfo protein that contains 5 additional amino acids residues (MASEF) and lacks 3 amino acids residues (TGS) from C-terminus with an addition of 10 new amino acids residues (RQQRWSHPQFEK) as compared to the native MtbNfo. E. coli ArcticExpress(DE3) RP cells were electroporated with the plasmids and the resulting KnR transformants were cultured in LB media with kanamycin (50 g/L). In the middle of the logarithmic growth phase (OD600 = 0.6) isopropyl -D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM, and the incubation was continued at room temperature with shaking (100 rpm) for another 16 hours. The cells were collected by centrifugation at 6,000×g for 7 min at 4°C. All purification procedures were carried out at 4°C in buffers without EDTA. The bacterial pellet was resuspended in a buffer containing 20 mM NaCl, 40 mM HEPES–KOH (pH 7.5) supplemented with Complete Protease Inhibitor Cocktail (Roche Diagnostics, Switzerland). The cells were disrupted using a French press at 18,000 psi, and the resulting crude lysate was cleared by centrifugation at 40,000×g for 60 min at 4°C. The supernatant was then adjusted to 500 mM NaCl and 20 mM imidazole and loaded onto a 1-mL HiTrap Chelating HP column (GE Healthcare) charged with Ni2+. The bound proteins were eluted in a 20–500 mM imidazole gradient and the eluted fractions containing recombinant protein were pooled and loaded onto a 1-mL HiTrap-Heparin column (GE Healthcare). The bound proteins were eluted in a 50–600 mM KCl gradient, and the fractions containing homogenous protein were stored at –20°C in 50% glycerol. Owing to a high level of expression of MtbNfo in the ArcticExpress(DE3) RP strain, it was possible to purify this protein to homogeneity using only one chromatographic step on Ni2+-charged HiTrap Chelating HP column. The purified protein samples were stored at –20°C in 50% glycerol. The homogeneity of the preparations was assessed by 12% SDS-PAGE (Fig. S1). 2.4. DNA repair assays

10 The assay conditions for measuring DNA repair activities catalyzed by MtbXthA and MtbNfo varied depending on the DNA substrate used. The standard reaction buffer (20 L) for measuring the MtbXthA-catalyzed activities contained 10 nM 32P-labelled oligonucleotide substrate, 20 mM HEPES–KOH (pH 7.6), 2 mM MgCl2, 0.1 mg·mL–1 BSA, 0.01% NP-40 (NP-40) and varying amounts of the enzyme. The reaction mixture was incubated for varying periods of time at 37°C, unless specified otherwise. The standard reaction buffer (20 L) for measuring the MtbNfo-catalyzed activities contained 10 nM 32P-labelled oligonucleotide substrate, 20 mM HEPES–KOH (pH 7.6), 2 mM MgCl2, 0.1 mg·mL–1 BSA, 0.01% NP-40 and varying amounts of the enzyme. The reaction mixture was incubated for varying periods of time at 37°C. The standard reaction buffer (20 L) for measuring the MtbXthA-catalyzed AP site cleavage activity contained 10 nM 32P-labeled THF•С duplex oligonucleotide, 2 mM MgCl2, 20 mM HEPES– KOH (pH 7.6), 0.1 mg·mL–1 BSA and 20 nM enzyme at 37°C for 30 min, unless specified otherwise. The standard reaction buffer (20 L) for measuring the MtbNfo-catalyzed AP site cleavage activity contained 10 nM [32P]-labeled THF•С duplex oligonucleotide, 10 mM MnCl2, 20 mM HEPES–KOH (pH 6.5), 0.1 mg·mL–1 BSA and 20 nM enzyme at 37°C for 30 min, unless specified otherwise. To measure the kinetics parameters, 10–3000 nM of a duplex oligonucleotide substrate was incubated under the appropriate reaction conditions. The reaction products were quantified using a PhosphorImager after separation by denaturing PAGE. The kinetic constants were measured under initial velocity and KM and kcat values were determined by fitting the data to the one-site binding model using Prism 4 (GraphPad Software). The kinetic parameters for AP endonuclease-catalyzed 3′5′ exonuclease activity were determined by measuring the reaction products expressed as percentage of the total substrate. When exonuclease generated multiple DNA products, the value obtained for each degradation fragment was multiplied by the number of catalytic events required for its formation, and the total exonuclease activity was calculated as the sum of those products. All reactions were stopped by adding 10 µL of a solution containing 0.5% SDS and 20 mM EDTA and then desalted by passing through house-made spin-down columns filled with Sephadex G25 (GE Healthcare) equilibrated in 7.5 M urea. Desalted reaction products were separated by electrophoresis in denaturing 20% (w/v) polyacrylamide gel (7.5 M urea, 0.5×TBE). The gels were exposed to a Fuji Phosphor Screen, then scanned with Fuji FLA-9500 and analyzed using Image Gauge v4.0 software. At least three independent experiments were performed for all kinetic measurements. 2.5. Alkylation and oxidative DNA damage sensitivity Drug treatment was performed as previously described with some modifications [25]. In brief, overnight bacterial cultures were diluted 100-fold in LB broth containing 150 g/mL ampicillin and 0.05 mM IPTG and incubated at 28°C until mid-exponential phase (OD600 = 0.6). The cells were collected by centrifugation, washed once, and suspended in phosphate-buffered saline (PBS). Ten-fold serial dilutions were prepared in PBS as well. Alkylating agent MMS was added to 2.5 mL of molten soft agar (0.6% agar in LB) at 46°C containing 1 mM IPTG, followed immediately by 0.25 mL of each cell dilution, and the mixture was poured onto the surface of 1.5% solid LB agar (25 mL) plate. For oxidizing agent sensitivity test, each cell dilution was exposed to 10 mM H2O2 for different periods of time, and then cells were mixed with molten soft agar and poured onto LB plates. Colonies were scored after 1–2 days of incubation at 37°C. 2.6. Model building Structural models of MtbXthA and MtbNfo were built using SWISS-MODEL [26]. All sequence alignments were performed with Clustal Omega [27]. For MtbXthA, the modeling templates were the structures of free E. coli Xth (Protein Data Bank accession number 1AKO, [28]) and 3′phosphodiesterase/exonuclease from Neisseria meningitides (2JC4, [29]), and for MtbNfo, those of free E. coli Nfo (1QTW, [30]), E. coli Nfo bound to its cleaved DNA product (1QUM, [30]), and endonuclease IV from Geobacillus kaustophilus (3AAL, [31]). The mycobacterial sequences were aligned to the template sequences in PDB files. To avoid structural clashes from gaps in the alignment, the loops present in the mycobacterial sequences were deleted, and gaps were filled with dummy

11 sequences from the templates. All such occurrences in all pairs (except for one case discussed in the text) were at the protein surface remote from the DNA-binding face and the active site and are not expected to influence the functionally relevant parts of the models. Model quality was estimated using QMEAN4 Z-score [32], and the local perturbations around the metal-binding sites was assessed based on Anolea mean force potential [33], and GROMOS empirical force field energy [34]. pKa values and ionization states of active site residues were calculated using H++ [35]. Images were prepared with PyMol (Schrödinger, New York, NY).

12 3. Results 3.1. cDNA cloning and purification of the MtbXthA and MtbNfo proteins The cDNA coding for MtbXthA and MtbNfo were isolated by PCR using DNA from Mycobacterium tuberculosis strain H37Rv and oligonucleotide primers as described in Materials and Methods. The resulting 876 bp and 768 bp PCR fragments were ligated into pET-28c to form pET-28c-MtbXthA and pET-28c-MtbNfo recombinant constructs. The competent E. coli DH5 cells were transformed with the ligation product, and the plasmids isolated from the transformed colonies and the DNA sequence of inserts were verified by sequencing. The calculated molecular mass of His-tagged MtbXthA and MtbNfo are 33.6 kDa and 30.4 kDa, respectively. To characterize the DNA repair activities of MtbXthA and MtbNfo, we have affinity-purified the mycobacterial enzymes from E. coli ArcticExpress (DE3) RP strain expressing the C-terminal Histagged form of MtbXthA and doubly N- and C-terminal His-tagged form of MtbNfo. Coomassiestained gels revealed that the purified MtbXthA and MtbNfo proteins were > 99% pure, did not contain significant amount of contaminating proteins and migrated slightly below the 37-kDa and 35kDa size markers, respectively (Supplementary data Fig. S1). 3.2. The mycobacterial AP endonucleases cleave duplex DNA containing a synthetic AP site Previous studies demonstrated that MtbXthA and MtbNfo AP endonucleases could cleave with good efficiency a DNA duplex containing tetrahydrofuran (THF, an abasic site analogue). However, it was not known whether the mycobacterial enzymes contain NIR activity, which is characterized by cleavage of the DNA duplex containing -anomeric 2′-deoxyadenosine (dA), a classic substrate for NIR AP endonucleases. To examine this, we measured the incision activities of MtbXthA and MtbNfo on a 5′-32P-labelled 30-mer oligonucleotide duplexes THF•C and dA•T in absence of divalent metal cations under the reaction conditions described in the previous study by Puri et al. As shown in Fig. 1A, the purified MtbXthA protein exhibited a robust AP endonuclease activity only when used in an excess amount, 1000 nM (lane 5), whereas 10 and 100 nM enzymes cleaved only 5–10% of THF•C duplex (lanes 3 and 4). No detectable activity was observed on the dA•T duplex even at high concentrations of the MtbXthA protein (lanes 8–10). Surprisingly, the purified MtbNfo protein exhibited a very weak AP endonuclease activity on the THF•C duplex (Fig. 1B, lanes 3–7); only 10% of the THF•C duplex is cleaved even at 1000 nM of the protein (lane 7). Again, no activity was detected when MtbNfo was incubated with the dA•T duplex (lanes 10–14). It should be noted that in control reactions with human AP endonuclease 1, 10 nM APE1 cleaved more than 90% of THF•C and dA•T duplexes (Fig. 1, lanes 2, 7 and 9). 3.3. Dependence of MtbXthA and MtbNfo catalyzed AP endonuclease activities on divalent metal cations Earlier, it has been shown that both MtbXthA and MtbNfo enzymes require the presence of Mg2+ and, to lesser extent, Ca2+ and Mn2+ for their DNA repair activities [20]. Here, to characterise the AP site cleavage activity of mycobacterial AP endonucleases in more detail, we measured the MtbXthA and MtbNfo protein-mediated cleavage of 5′-32P-labelled 30-mer THF•C (in which THF residue is in position 11) in a buffer supplemented with the varying concentrations of divalent metal chlorides, including MgCl2, CaCl2, MnCl2, CoCl2, ZnCl2, NiCl2 and FeCl2 (Fig. 2 and Supplementary data Fig. S2). As shown in Fig. 2A, in the presence of varying concentrations of Mg2+ and Mn2+, the purified MtbXthA protein taken in an excess amount (100 nM) exhibited robust AP endonuclease activity by generating a typical 10-mer cleavage fragment (lanes 3–9). Interestingly, higher concentrations of Mg2+ and Mn2+ (10 mM) resulted in a strong decrease or complete inhibition of MtbXthA-catalyzed AP site cleavage (lanes 6 and 10). On the contrary, in the presence of 2 mM MgCl2 and 0.5 mM MnCl2 MtbXthA cleaved more than 90% of the THF•C duplex (lanes 5 and 8). It should be noted that

13 MtbXthA exhibits, in addition to the AP site cleavage, a robust concomitant 3′5′ exonuclease activity that displays an identical divalent cation dependency profile (lanes 3–18). Low concentrations of Ca2+ and Zn2+ (0.1–0.5 mM) very weakly stimulated the AP endonuclease and 3′→5′ exonuclease activities of MtbXthA, respectively (Fig. 2A, lanes 11–12 and 15–16 and Fig. 2B), while at higher concentrations (2–10 mM) these cations completely suppressed all enzyme’s activities (lanes 13–14 and 17–18). The presence of low amounts of Fe2+ (0.1–0.5 mM) weakly stimulated the AP endonuclease, whereas 2 mM FeCl2 stimulated the 3′5′ exonuclease activity of MtbXthA (Fig. 2B and Supplementary data Fig. S2). Low concentrations of Co2+ and Ni2+ (0.1–0.5 mM) greatly stimulated both AP site cleavage and 3′5′ exonuclease activities of MtbXthA, but higher concentrations of these metals (2–10 mM) strongly suppressed all enzymes activities (Supplementary data Fig. S2 and Fig. 2B). As shown in Fig. 3A, the presence of Mg2+ and Ca2+ stimulated the AP endonuclease activity of 100 nM purified MtbNfo on 5′-32P-labelled 30-mer THF•C (lanes 2–5 and 10–13). Furthermore, MtbNfo-catalyzed activity showed a linear dependence on MgCl2 and CaCl2 concentrations, exhibiting the highest AP site cleavage at 10 mM (Fig. 3B and Supplementary data Fig. S3). In contrast to other divalent cations, MtbNfo exhibited a non-linear dependence in the presence of Mn2+ and Co2+: its AP site cleavage activity increased from 0.1 to 0.5 mM and then dramatically decreased from 0.5 to 10 mM MnCl2 and CoCl2 (Fig. 3A,B and Supplementary data Fig. S3). The presence of Zn2+, Fe2+ and Ni2+ did not significantly stimulate AP endonuclease activity of MtbNfo (Fig. 3 and Supplementary data Fig. S3). It should be stressed that in contrast to MtbXthA, we did not observe short 29-mer–12mer fragments migrating below the 30-mer substrate, indicating that MtbNfo did not exhibit strong non-specific 3′5′ exonuclease activity when acting on the 30-mer THF•C duplex. Nevertheless, when having the maximum AP endonuclease activity, MtbNfo can exonucleolytically degrade 10-mer product and generate 9- and 8-mer fragments (Fig. 3A, lane 5). Taken together, these results suggest that under pH 7.6 optimal cation concentrations for MtbXthA-catalyzed activities are 2 mM MgCl2 and/or 0.5 mM MnCl2, while 10 mM MnCl2 is optimal for MtbNfo. 3.4. Effect of pH, temperature and ionic strength on mycobacterial AP endonuclease activities To further substantiate the biochemical properties of the mycobacterial enzymes MtbXthA and MtbNfo, we measured MtbXthA- and MtbNfo-catalyzed cleavage of the 30-mer THF•C duplex varying the ionic strength, pH and temperature. As shown in Fig. 4A,B, the pH and temperature dependence of the MtbXthA-catalyzed AP site cleavage was generally bell-shaped. MtbXthA exhibited the highest AP endonuclease activity at 37°C and pH 6.5 as compared to 30°C and pH 6.0 and 42°C and pH 7.0, respectively (Fig. 4A,B). Interestingly, the AP endonuclease was very sensitive to ionic strength and was inhibited even in the presence of 25 mM KCl, and 10-fold inhibition was observed at 100 mM KCl (Fig. 4C). As for the MtbNfo-catalyzed AP site cleavage, shown in Fig. 5, only the pH dependence was bell-shaped, with the highest activity observed under pH 6.0. Interestingly, similar to E. coli Nfo, MtbNfo was also a thermostable AP endonuclease with the temperature optimum at 60°C (Fig. 5B). In contrast to MtbXthA, the AP site cleavage by MtbNfo was hardly affected by ionic strength; the enzyme was weakly stimulated by 200 mM KCl (Fig. 5C). Since MtbXthA and MtbNfo preferred mildly acidic conditions (pH 6.0–6.5) and the divalent cation dependence of AP site cleavage was measured at pH 7.6, we decided to re-examine the metal dependence of these enzymes. The results revealed some differences in metal dependence measured under pH 7.6 as compared to pH 6.5. At pH 6.5, MtbXthA and MtbNfo AP endonuclease activities increased linearly with increasing MgCl2 and MnCl2 concentrations with the highest activity at 10 mM MnCl2, suggesting that both enzymes prefer Mn2+ (Supplementary data Figs S4 and S5). We also examined the effect of non-ionic detergent NP-40 on the AP endonuclease activities of the mycobacterial enzymes. The presence of 0.01% NP-40 slightly stimulated the AP site cleavage (Supplementary data Fig S6). Thus based on these observations, we established the following optimal reaction conditions: 10 mM MnCl2, pH 6.5, 0.01% NP-40 (or 2 mM MgCl2, pH 7.6, 0.01% NP-40) and 37°C for MtbXthA, and 10 mM MnCl2, pH 6.5, 200 mM KCl, 0.01% NP-40 and 60°C for MtbNfo (note that we used 37°C as a physiological temperature to measure enzyme kinetic).

14 To further substantiate the role of pH in metal ions requirements of the mycobacterial AP endonucleases, we measured cleavage of THF•C in the presence of 10 mM MnCl2 at pH range between 5.0 and 7.5 and varying enzyme concentrations (from 2 nM to 50 nM). As shown in Fig. 6, both MtbXthA and MtbNfo exhibited bell-shaped pH dependence, showing the highest AP site cleavage activity under pH 6.5 (lanes 5, 11 and 17) and the lowest activity at pH 5.0 and 7.5 (lanes 2 and 7, 8 and 13, 14 and 19, respectively). Importantly, at pH 7.5 the presence of 10 mM MnCl2 completely suppressed the AP endonuclease activity of both enzymes even when using a high (50 nM) enzyme concentration (Fig. 6A,B, lane 19). These results may suggest that, in vivo, the DNA repair functions of mycobacterial AP endonucleases are subject for tight regulation by pH and the nature of available metal cations. 3.5. Mycobacterial AP endonucleases possess 3′-repair phosphodiesterase, 3′-phosphatase and NIR activities Hydrolytic AP endonucleases, in addition to their AP site cleavage activity, possess a highly efficient function to remove 3′-blocking sugar-phosphates and 3′-terminal phosphate remnants from DNA strand breaks generated by ROS and DNA glycosylases/AP lyases. To examine whether MtbXthA and MtbNfo contain the 3′-repair phosphodiesterase activity, we prepared recessed Exo20THF•RexT, Exo20P•RexT and Exo20•RexT duplex oligonucleotides composed of a long 40-mer RexT template fragment and a short complementary 20-mer Exo20 fragment, containing a 3′-terminal THF or 3′-phosphate or 3′-hydroxyl residue, respectively. Exo20THF•RexT and Exo20•RexT duplexes with 5′-32P-labelled Exo20 were used to measure the 3′-repair phosphodiesterase and 3′5′ exonuclease activities, respectively. The Exo20P•RexT duplex with 3′-32P-labelled Exo20 was used to measure the 3′-phosphatase activity. As shown in Fig. 7A, MtbXthA cleaves the 5′-32P-labelled Exo20THF•RexT duplex generating a 20-mer DNA fragment that migrates faster then 20-mer Exo20THF substrate, indicating that the enzyme removes the 3′-terminal THF residue leaving a Exo20 fragment with 3′-OH (lanes 3–8). 0.2 nM MtbXthA removed the 3′-THF residue in more than 50% of Exo20THF•RexT duplex in 10 min (Fig. 7B), suggesting that the mycobacterial AP endonuclease contains a highly efficient 3′phosphodiesterase activity. In contrast, 30 min incubation of 100 nM MtbNfo with 10 nM 5′-32Plabelled Exo20THF•RexT duplex resulted in the removal of only 40% of 3′-THF residues (Fig. 7C,D) indicative of very low efficiency of the 3′-phosphodiesterase function of MtbNfo as compared to that of MtbXthA. When acting on the 3′-32P-labelled Exo20P•RexT duplex, MtbXthA and MtbNfo showed the same pattern of activities as on Exo20THF•RexT duplex, suggesting that MtbXthA contain a highly efficient 3′-phosphatase activity whereas MtbNfo is a poor 3′-phosphatase (Supplementary data Fig. S7). Taken together, these results suggest that both mycobacterial enzymes contain 3′-end cleansing activities and that MtbXthA is more efficient 3′-repair phosphodiesterase than AP endonuclease. We further examined the DNA substrate specificity of mycobacterial AP endonucleases by using 3′-32P-labelled 30-mer duplex oligonucleotides containing dA, or DHU or 5ohC. Notably, cleavage of DHU•G and 5ohC•G duplexes was detected when they were incubated with MtbNfo (Fig. 8, lanes 8 and 13), but not with MtbXthA (lanes 7 and 12). Only very weak MtbNfo-catalyzed incision activity was observed when using the αdA•T duplex, a canonical DNA substrate for the NIR pathway (lane 4). As expected, human APE1 incised the DNA duplexes 5′ to the base lesion in all DNA substrates used (lanes 2, 6 and 11). These results indicate that MtbNfo, but not MtbXthA, contain a limited NIR function under the experimental conditions tested, in contrast to its E. coli homologue Nfo that can cleave DNA duplexes containing dA with high efficiency [15]. To ensure that the observed DNA repair activities are not due to trace contamination by expression of host endonucleases, we have made site-directed mutants of MtbXthA and MtbNfo and purified them using the same scheme as for the wild-type M. tuberculosis proteins. In MtbXthA, we introduced the mutations D180N and N182A. In the Xth family enzymes, the residues homologous to D180 and N182 of MtbXthA coordinate the catalytic metal ion. In human APE1 protein, the corresponding mutations D210N and N212A reduce the enzyme activity ~10,000-fold [36], and the same is observed for the D146N mutant of NExo, the Neisseria homolog with exonuclease activity only [29]. For MtbNfo we chose E129Q and H206N mutations that disrupt metal coordination and

15 catalytic water activation; their counterparts in the E. coli Nfo decrease its activity >4,000-fold [37]. The purified MtbXthA D180N and N182A and MtbNfo E129Q and H206N mutant proteins were incubated with the 5′-32P-labelled THF•C and Exo20THF•RexT duplexes to measure AP site cleavage and 3'-phosphodiesterase activities, respectively. As shown in Fig. 9, mutant mycobacterial AP endonucleases, even when present in excess amounts, do not show any detectable DNA repair activities as compared to wild-type MtbXthA and MtbNfo. Importantly, MtbXthA D180N and N182A and MtbNfo E129Q and H206N mutants concomitantly lost their non-specific 3'-5' exonuclease activity on THF•C and Exo20THF•RexT duplexes, whereas WT enzymes exhibit DNA degrading activity under same reaction conditions (Fig. 9A, lanes 3-5 and 7-9 versus lane 1; Fig. 9B, lanes 7 and 10 versus lane 4). Altogether, these results indicate that D180 and N182 of MtbXthA and E129 and H206 of MtbNfo are essential for DNA repair activities of Mtb AP endonucleases and that the preparations of mycobacterial enzymes used in this study are not contaminated by host endonucleases. 3.6. Functionally relevant structural features of mycobacterial AP endonucleases revealed by homology modeling In an attempt to rationalize the reaction specificity and metal preferences of MtbXthA and MtbNfo, we resorted to homology modelling using the SWISS-MODEL program suite. At present, the Protein Data Bank holds the total of 25 structures of prokaryotic Xth-like proteins and their complexes from E. coli [28], Archaeoglobus fulgidus [38], Methanothermobacter thermautotrophicus [39] and unpublished submissions) and N. meningitides [29, 40], and the total of 12 prokaryotic Nfo structures representing free proteins and their complexes from E. coli [30, 37, 41], G. kaustophilus [31], Thermotoga maritima [42-43] Thermus thermophilus [31] and Bacillus anthracis (an unpublished submission). It should be specifically noted that whereas Nfo is a well-defined functional family of AP endonucleases within the large group of TIM barrel fold proteins, Xth belongs to a functionally more diverse group, the Exonuclease–Endonuclease–Phosphatase superfamily, which, in addition to several families of AP endonucleases, contains protein homologs with other nucleolytic activities, exonucleases, 3′-phosphodiesterases and 3′-phosphatases among them. Mycobacterial AP endonucleases were rather divergent from the sequences for which structural information is available. In fact, of all structurally characterized Xth-like proteins, the closest homolog of MtbXthA was NExo, a 3′-phosphodiesterase/exonuclease from N. meningitides (2JC4, [29]), a protein that lacks AP endonuclease activity. Due to this limited sequence homology, the quality of the models was not ideal: the QMEAN4 Z-score was around –3.5, just on the verge of the range experimentally observed in X-ray structures (Supplementary data Fig. S8). Nevertheless, the discordance was mostly observed at the periphery of the proteins while the metal-binding sites and the active sites demonstrated a very good overlap and much better quality scores (Fig. 10A,B). For MtbXthA, we have analyzed a model built on the template of its closest homolog, N. meningitides NExo (2JC4), and a series of models arising from the template of E. coli Xth (1AKO). The residues found to co-ordinate the catalytic metal ion, an activated water molecule, and the scissile phosphate in Xth-like proteins were all conserved in MtbXthA and well positioned structurally in all models. However, one important difference from Xth was evident. Based on the three resolved structures of: N. meningitides NExo, N. meningitides NApe - a functional AP endonuclease, and Xth, it has been reported that NExo lacks AP endonuclease activity due to the presence of His167 residue, which impairs entry of a restrained AP site to the enzyme′s active site cavity [29]. NApe and Xth have a small residue (Gly or Ser) at this position, and a substitution of either Gly or Ser for His167 in NExo rescues the AP endonuclease function. Strikingly, MtbXthA possesses a His residue at the corresponding position (Fig. 10A,B), which may explain its relatively low AP endonuclease activity in comparison with the 3′-repair activity. As in an alignment of MtbXthA and Xth the E. coli enzyme has a six-residue loop near this position, which lies closely to the entrance to the active site (Fig. 10A), we have constructed a series of models moving the alignment gap farther away from the active site but this did not improve the model quality. Overall, the modeling data support the view of MtbXthA as an enzyme, the main role of which is in processing of damaged 3′-termini. The closest structurally characterized homolog of MtbNfo is endonuclease IV from an extremophile G. kaustophilus (3AAL, [31]); however, very limited biochemical information is

16 available for this enzyme. Thus, we have modeled MtbNfo based on 3AAL and two structures of E. coli Nfo, a free protein and a complex with the cleaved DNA product (1QTW and 1QUM, [30]). Nfo uses three-metal catalysis, employing Zn2+ ions to polarize the phosphate–oxygen bonds and activate a catalytic water molecule. Accordingly, three M2+-binding sites are observed in the Nfo homologs, of which Zn1 and Zn2 sites seem to be optimized for Zn2+ binding while Zn3 is more promiscuous, allowing occupation by other divalent cations, especially Mn2+ [30, 37, 41, 44]. This raises the question why Mg2+, Ca2+ and Mn2+ support catalysis by MtbNfo much more efficiently than Zn2+. When the MtbNfo models are superimposed with their templates, their metal-coordinating residues overlap almost perfectly (Fig. 10D). Despite this geometry conservation, when we calculated the ionization states of metal-coordinating His residues, a dramatic difference between the models and their templates was observed in the Zn1 coordination shell (Supplementary data Fig. S9). pKa of His69 increased by 0.5–1 units of pH for 1QTW and 3AAL-based model but decreased by ~10 units of pH for the 1QUM-based model, whereas pKa of His109 decreased by 1.5–2 units of pH for 1QTW and 3AAL-based model and did changed little for the 1QUM-based model. This shows, first, that the environment at the Zn1 site becomes more polarizing, which would favor binding hard Lewis-acid ions, such as Mg2+ and Ca2+, over softer Zn2+ ions. Second, DNA binding and associated conformational changes also induce polarization of the Zn1 shell in the E. coli Nfo protein, fully consistent with quantum mechanical modeling of the Nfo active site during the course of bond cleavage [44], yet in the MtbNfo model the charge distribution in the His69–His109 couple seem to reverse the direction upon DNA binding. His231 in the Zn3 shell is also more basic in MtbNfo than in E. coli Nfo. Clearly, despite the conservation of the metal-coordinating residues, the metal-binding environment in MtbNfo is different from that in the E. coli enzyme, likely being less optimal for Zn2+ and better suited for Mg2+. Another difference to consider is the nature of residues intercalating into DNA upon the AP site binding to promote flipping of the target deoxyribose and the orphan nucleotide out of the helix. In E. coli Nfo, this is the function of Arg37, Tyr72, and Leu73. The latter two are conserved in MtbNfo, whereas Arg37 corresponds to Gln32 in the mycobacterial enzyme (Fig. 10C). The neutral side chain amide is expected to form weaker stacking than the +– interaction of the charged guanidinium moiety of arginine, perhaps also destabilizing the MtbNfo–substrate complex. 3.7. Steady-state kinetic parameters of the mycobacterial AP endonucleases-catalyzed DNA repair activities To further characterize the DNA substrate specificity of the recombinant MtbXthA and MtbNfo proteins, we measured steady-state kinetic parameters of the repair reactions and calculated the KM, kcat, and kcat/KM values for the cleavage of various DNA substrates (Table 1). The 30-mer THF•C and recessed Exo20THF•RexT, Exo20P•RexT and Exo20•RexT duplex oligonucleotides with 3′-THF, 3′-P and 3′-OH termini were used to measure AP endonuclease, 3′-phosphodiesterase, 3′-phosphatase and 3′5′ exonuclease activities, respectively. For comparison of the kinetic parameters, the 3′phosphodiesterase activity of E. coli Xth was also measured. The mycobacterial enzymes possessed a very weak AP endonuclease activity as compared to that of E. coli Xth and Nfo. Under the optimal reaction conditions and limited enzyme concentrations, MtbXthA and MtbNfo cleaved at most 17% and 12% of AP sites in 2 h at 37°C (Supplementary data Fig. S10). Importantly, further increase in the enzyme concentrations to a 10-fold molar excess over the substrate resulted in a complete cleavage of all THF•C, but in case of MtbXthA it also led to a concomitant increase in the non-specific 3′5′ exonucleolytic degradation of DNA (Fig. 2A, lane 5). As shown in Table 1, steady state kinetic parameters of MtbXthA and MtbNfo-catalyzed AP endonuclease reactions reveal that the mycobacterial enzymes cleave AP sites in duplex DNA extremely inefficiently. The kcat/KM values for AP endonuclease activity of MtbXthA and MtbNfo on the THF•C duplex were more than 1000-fold lower as compared to that of E. coli Xth and Nfo, respectively. In contrast to the AP site cleavage activity, the MtbXthA protein showed highly efficient 3′-phosphodiesterase and 3′-phosphatase activities exceeding those of E. coli Xth (Table 1). Interestingly, the kcat and kcat/KM values of MtbXthA for the 3′-phosphodiesterase activity (362 min–1 and 443 M–1·min–1, respectively) was 10-fold higher than that of its E. coli counterpart (32 min–1 and 44 M–1·min–1, respectively) suggesting that the mycobacterial enzyme removes 3′-blocking sugar-

17 phosphate moieties more efficiently than Xth does (Table 1 and Supplementary data Fig. S11). Furthermore, the MtbXthA protein is a highly efficient 3′-phosphatase with kcat value of 728 min–1 (Table 1 and Supplementary data Fig. S12). The kinetic parameters of the 3′-repair activities of MtbNfo (kcat/KM = 0.256 and 0.651 M–1·min–1, for 3′-phosphodiesterase and 3′-phosphatase, respectively) were very similar to that of MtbNfo-catalyzed AP endonuclease activity (Table 1), indicating that this mycobacterial enzyme plays a rather minor role in the repair of AP site and DNA strand breaks. Overall, these kinetic data suggest that the mycobacterial AP endonucleases MtbXthA and MtbNfo may not be important for AP site repair, but MtbXthA, similar to E. coli Xth, could be considered as a major mycobacterial enzyme that processes DNA glycosylase- and ROS-induced DNA strand breaks containing 3′-blocking groups in vivo. 3.8. Drug sensitivity of E. coli AP endonuclease-deficient strains expressing the mycobacterial AP endonucleases Previously, Puri and co-workers have shown that the deletion mutants of M. tuberculosis lacking MtbNfo (end) and both MtbNfo and MtbXthA (end, xthA) are sensitive to an alkylating agent (MMS) and oxidizing agents such as cumene hydroperoxide and H2O2, but not to DNA crosslinking agent mitomycin C [20-21]. However in the present work, we found that MtbXthA and MtbNfo are very weak AP endonucleases suggesting that their roles in the resistance to alkylating agents would be rather limited. On the other side, MtbXthA contains highly efficient 3′-repair activities and therefore should play an important role in the protection from DNA damage induced by H2O2. To address the physiological relevance of MtbNfo and MtbXthA-catalyzed DNA repair activities, we used the E. coli mutant phenotype rescue assay. We examined the MMS and H2O2 sensitivity of the AP endonucleasedeficient E. coli xth nfo BH110 strain harboring a plasmid coding for the E. coli Nfo or mycobacterial AP endonucleases MtbNfo and MtbXthA. MMS methylates DNA bases and this in turn results in appearance of AP sites in DNA when methylated purines are excised by DNA glycosylases in the BER pathway [45]. H2O2 causes oxidation of DNA bases as well as single-strand DNA breaks containing 3′-blocking sugar-phosphate groups [46]. The E. coli BH110 strain lacking both Xth and Nfo AP endonucleases is extremely sensitive to both agents [47]. In control experiments, the plasmid that directs the synthesis of E. coli Nfo conferred resistance to MMS and H2O2 on BH110 cells (Fig. 11). In agreement with our biochemical data, a plasmid encoding MtbXthA restored the resistance to H2O2 to the level close to that of plasmid harbouring E. coli Nfo, showing a 104- to 107-fold increase in the cell survival at different exposure times as compared to control plasmid (Fig. 11A). The plasmid encoding MtbNfo only weakly suppressed the sensitivity to H2O2, showing only a 10- to 1000-fold increase in the survival compared to an empty control plasmid (Fig. 11A). As expected from the weak AP site cleavage activities of the purified enzymes in vitro, the plasmids encoding MtbXthA and MtbNfo conferred only a slightly higher level of resistance to MMS, showing only a 100- and 10-fold increase in survival, respectively, as compared to an empty control plasmid (Fig. 11B). Interestingly, MtbXthA plasmid suppressed the sensitivity to MMS better than the MtbNfo plasmid although both enzymes have similar kinetic parameters for AP site cleavage activity (Table 1). Taken together, these results suggest that MtbXthA can efficiently repair DNA strand breaks in E. coli and that the very low AP endonuclease activity and possibly the requirement for specific reaction conditions may contribute to the inefficient rescue of E. coli xth nfo by both mycobacterial AP endonucleases grown on the media containing MMS.

18 4. Discussion In the present study, we have isolated cDNA encoding two mycobacterial AP endonucleases, referred here as MtbXthA and MtbNfo. Following expression and purification from E. coli we characterized their DNA substrate specificities. Our results show that purified MtbXthA and MtbNfo proteins contain 3′-repair phosphodiesterase and 3′-phosphatase functions in addition to their AP site cleavage and 3′-exonuclease activities. Importantly, MtbNfo, but not MtbXthA, contains a nucleotide incision repair (NIR) activity, which might be involved in the DNA glycosylase-independent removal of oxidized pyrimidines. In contrast to data described previously by Puri and co-workers, we found that both MtbXthA and MtbNfo have very weak AP endonuclease activity and cleave AP sites with similar efficiencies. At least in the case of MtbXthA this poor reactivity for AP sites may be explained by the presence of a His residue blocking the entrance of the uncleaved deoxyribose to the active site of the enzyme, as revealed by homology modelling. MtbNfo, on its part, possesses a Gln residue in place of Arg side chain of the intercalating triad of E. coli Nfo, which also may be less favourable for conformational changes in the substrate DNA. Metal ions effects. Our data show that in the absence of metal cofactors the mycobacterial AP endonucleases exhibit very low AP site cleavage activity. Addition of divalent cations greatly stimulates DNA repair activities indicating that MtbXthA and MtbNfo are divalent metal iondependent enzymes. However, requirements of two enzymes for divalent cations were quite different, MtbXthA-catalyzed AP endonuclease activity was stimulated by Mg2+, Mn2+ and Co2+ while MtbNfo activity, by Mg2+ and Ca2+ and to lesser extent by Mn2+ and Co2+ (Figs. 1 and 2). Homology modelling shows that MtbXthA, similar to other Xth homologs, possesses a quite open metal-binding site allowing for binding of different metals, whereas MtbNfo, unlike its E. coli counterpart, has metalbinding sites less optimal for Zn2+ utilization and better suited to bind harder ions, such as Mg2+ and Ca2+. Interestingly, titration of AP site cleavage activity of MtbXthA at pH 7.6 with MgCl2, MnCl2, CoCl2 and NiCl2 and of MtbNfo with MnCl2 and CoCl2 yielded bell-shaped profile with highest activity at intermediate divalent cations concentrations (Figs. 1B and 2B) suggesting the presence of more than one metal binding sites in each protein. It should be noted that, although we have used Histagged proteins, the termini of the polypeptide chain reside at the opposite side to the DNA- and metal-binding cleft in all structurally characterized Nfo and Xth, so metal binding by the His-tag are very unlikely to influence our results. Notably, titration of AP site cleavage activity of MtbXthA and MtbNfo at mild acidic pH 6.5 with divalent cations resulted in dramatically different profiles. At variance with results obtained at pH 7.6, activity of MtbXthA and MtbNfo at pH 6.5 increased linearly with concentration of MgCl2 and MnCl2 reaching a maximum at 10 mM (Supplementary data Figs. S4–S5). Furthermore, in the presence of 10 mM MnCl2 both enzymes exhibit the highest AP endonuclease activity at pH 6.5, whereas at pH 7.5, high concentration of Mn2+ completely inhibits MtbXthA and MtbNfo-catalyzed AP site cleavage (Fig. 6). These biochemical results support conclusions from ionization state modelling of MtbNfo active site, which suggested that pKa of the metal-binding His residues in the mycobacterial enzyme are different from those in other Nfo homologs. Remarkably, the presence of 0.1–0.5 mM ZnCl2 strongly inhibited AP site cleavage by both MtbXthA and MtbNfo (Figs. 1 and 2 and Supplementary data Figs. S4–S5) suggesting that Zn2+ ions could be used to thwart the mycobacterial enzymes. In fact, heavy metals such as zinc and copper are accumulated in phagosomes containing mycobacteria, and zinc accumulation increases upon macrophage activation by IFN- and TNF- mediated inflammatory signals [48]. Intriguingly, disruption of the CtpC, a gene encoding a putative zinc efflux pump P1-type ATPase, in Mtb makes the bacteria extremely sensitivea to physiological concentration of Zn2+ in the growth media and restricts their growth in human macrophages [49]. Taken together, these data suggest that AP endonuclease activity of the mycobacterial enzymes can be tightly regulated by pH and by the chemical nature and concentration of divalent cations in vivo; these properties could help the bacteria to adapt to changing conditions during different phases of host infection. Indeed, the phagosome of a macrophage acidifies by proton pumps to an acidic pH 4.5–5.0 [50], however Mtb can arrest this process at pH 6.4 [51]. It is tempting to speculate that inside of a phagosome the mycobacterial AP endonucleases may reach their maximum AP site cleavage activity. Temperature, pH and ionic strength dependence. MtbXthA-catalyzed AP site cleavage activity has an optimum in the range of pH 6.0–7.5, at very low ionic strength 0 mM KCl and 37°C

19 (Fig. 4); these conditions are similar to the optimum for E. coli Xth [52]. In a sharp contrast, MtbNfo is most active at mildly acidic pH 6.0, surprisingly broad ionic strength of 0–200 mM KCl, and very high incubation temperature, 60°C (Fig. 5). The high salt and heat resistances of MtbNfo resemble that of E. coli Nfo, however, the latter prefers mildly alkaline pH 8.0–8.5 and does not require metal cofactors. Test for NIR function and mutational analysis. MtbNfo possesses some NIR activities, since it can cleave DNA duplexes containing oxidized pyrimidine residues (Fig. 8). However, MtbNfo, in contrast to E. coli Nfo and the functional human counterpart APE1, incises dA containing DNA duplex with a very low efficiency, suggesting that this pathogenic microorganism may have partially lost its NIR functions. Both mycobacterial AP endonucleases, especially MtbXthA when used in excess amount, exhibit non-specific 3'→5' exonuclease activity towards non-damaged DNA duplexes (Figs. 2 and 3) raising the question whether this function is an intrinsic property of these enzymes. To address this question, we constructed and characterized catalytically inactive MtbXthA D180N and N182A and MtbNfo E129Q and H206N mutants. The results showed that all mutants lost their DNA repair functions (AP site cleavage and 3'-phosphodiesterase) concomitantly with 3'→5' exonuclease activity (Fig. 9). Based on these observations we suggest that the non-specific 3'→5' exonuclease function is an intrinsic property of MtbXthA and MtbNfo enzymes and this activity may have an important physiological role. Steady-state kinetics and 3′-repair activities. We have characterized the 3′-repair phosphodiesterase and 3′-phosphatase activities of MtbXthA and MtbNfo by measuring their kinetic constants. The analysis of kinetic parameters of the mycobacterial AP endonucleases revealed that MtbXthA possesses highly efficient 3′-repair phosphodiesterase and 3′-phosphatase activities with kcat and kcat/KM values superior to those of E. coli Xth (Fig. 7 and Table 1). On the contrary, the kinetic parameters of MtbNfo-catalyzed 3′-end repair activities were more than 103-fold lower as compared to that of MtbXthA and also its E. coli counterpart, Nfo [53]. Furthermore, both mycobacterial AP endonucleases are weakly active on oligonucleotide duplexes containing a synthetic AP site, exhibiting the kcat/KM values 0.446 and 0.507 M–1·min–1, which were 103-fold lower as compared to those of E. coli AP endonucleases (Table 1). While writing this paper, Khanam and colleagues showed that MtbXthA contains in addition to AP endonuclease, 3'-repair phosphodiesterase and phosphatase activities [54]. The authors have also identified several amino acids residues including E57, D251, Y237 and Y137 that participate in formation of enzyme-substrate complex and AP site incision. However, at difference with our kinetic data, this work showed that AP site cleavage activity of MtbXthA is more efficient as compared to 3'-cleansing activity. This discrepancy could be explained by differences in the reaction buffers used to measure DNA repair activities, Khanam et al., used buffer with 10 mM MgCl2 and pH 7.8, whereas in this study reaction buffer contained 10 mM MnCl2 and pH 6.5. E. coli mutant rescue assays. Highly efficient 3′-end repair functions of MtbXthA suggest that this mycobacterial AP endonuclease plays an important role in the repair of single-strand DNA breaks with 3′-blocking termini generated by ROS, RNS and DNA glycosylases/AP lyases. Consistent with these biochemical data, expression of MtbXthA in E. coli AP endonuclease-deficient BH110 strain conferred resistance to H2O2 to the level similar to that of plasmid encoding E. coli Nfo (Fig. 10A). Moreover, in agreement with the poor AP site cleavage activities of the mycobacterial enzymes, expression of MtbXthA and MtbNfo in E. coli BH110 strain conferred only weak resistance to MMS, as compared to the expression of E. coli Nfo (Fig. 10B). Taken together, these data suggest that MtbXthA is a major 3′-repair phosphodiesterase in M. tuberculosis and protects the bacteria from the genotoxic effects of ROS-induced DNA strand breaks. Furthermore, the highly efficient kinetics of MtbXthA-catalyzed 3′-end cleansing activities implies that mycobacteria are very well adapted to the harsh oxidative stress conditions inside the host macrophages. Indeed, when macrophages engulf bacteria and trapp them inside phagosomes, their oxygen consumption increases to produce ROS and RNS such as superoxide •O2–, hydrogen peroxide H2O2, and nitric oxide NO•. It is well documented that exposure of cells to H2O2 mainly induces DNA single-strand breaks containing 3′-blocking phosphoglycolaldehyde esters [46]. Therefore, one might presume that DNA of mycobacteria living inside the phagosome is constantly exposed to DNA strand breaks containing 3′-blocking moieties, which should be repaired before their conversion to double-strand breaks. Based on these observations, one may speculate that the constant generation of a large number of single-strand breaks

20 in the mycobacterial genome by the host immune system would disrupt the invader’s MMR system. Indeed, after a mismatched base pair is specifically bound by MutS, the parent DNA strand is distinguished from the nascent strand based on the presence of a single-strand break in the nascent DNA strand. Under oxidative stress conditions ROS-induced single-strand breaks in the genome of mycobacteria might be erroneously regarded as a discriminating signal for MMR and lead to mutation fixation if breaks occur in the parent strand. The present experimental results in the light of data from genetic screens for pathogen–host interactions. In their early studies, Sassetti and Rubin used high-density transposon-insertion mutant library of Mtb, introduced into mice by tail vein injection, to identify the genes required for mycobacterial growth in vivo [55]. The screen revealed that DNA repair proteins uracil-DNA glycosylase and MtbXthA involved in the BER pathway are required for bacterial growth at the 2week time point, whereas MtbNfo is required earlier at 1 week after infection [55]. However, later studies that used a more advanced technique such as transposon-insertion sequencing coupled to improved bioinformatic analysis did not confirm the essentiality of BER genes for Mtb growth in a mouse model of infection [56-57]. Recent work by Puri and co-workers have shown that aerosolinfected guinea pigs with either wild type or single or double AP endonuclease mutant strains of M. tuberculosis have a similar bacillary load and organ damage for all tested strains [21]. Based on these observations and our in vitro data we may hypothesize that (i) the animal models employed in the above studies may bias the identification of the Mtb genes essential for infection of humans; and/or (ii) Mtb AP endonucleases are dispensable during an in vivo infection because of the existence of not-yetidentified overlapping DNA repair pathways; and/or (iii) MtbXthA and MtbNfo are required only during the latency period of infection whereas in the animal models Mtb infection occured only in the active phase. Potential biological significance of the observed biochemical properties of mycobacterial AP endonucleases. Weak AP endonuclease activities observed in the present study may suggest an increased sensitivity of M. tuberculosis strains to alkylating agents. Indeed, it was shown that mitomycin C, a bifunctional alkylating agents, efficiently kills both growing and dormant Mycobacterium bovis strain at very low drug concentrations [58]. We propose that during the active phase of mycobacterial infection, the host environment does not efficiently induce AP sites in the genome of the pathogen and that intracellular pH of Mtb likely remains above pH 7.0. When mycobacteria are engulfed by macrophages in phagosomes, the pH becomes acidic thus activating the AP endonucleases MtbXthA and MtbNfo. Nevertheless, in the present study even under the optimal reaction conditions, AP sites are repaired slowly in Mtb, possibly in order to avoid generation of DNA strand breaks in addition to those generated by ROS of the macrophagal origin. Finally, taken together, our data show that both MtbXthA and MtbNfo are main enzymes that remove AP sites and 3′-blocking groups in mycobacteria and that the repair activities of these enzymes are subject for tight regulation. Conflict of interest The authors declare that they have no conflict of interest. The authors: Sailau Abeldenov, Ibtissam Talhaoui, Dmitry O. Zharkov, Alexander A. Ishchenko, Erlan Ramanculov, Murat Saparbaev and Bekbolat Khassenov of the manuscript entitled “”Characterization of DNA substrate specificities of apurinic/apyrimidinic endonucleases from Mycobacterium tuberculosis” declare that they have no conflict of interest. Author contributions S.A., I.T. and A.A.I. performed all of the biochemical experiments. A.A.I., E.R., M.S., and B.K. designed all experiments. D.O.Z. performed structural modelling. E.R., D.O.Z., M.S., and B.K. wrote the manuscript. All authors discussed the results and contributed to the writing of the manuscript. Acknowledgements

21 We wish to thank Dr Olga Lavrik for the recombinant Tdp1 protein. This work was supported by grants to B.K. from Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (http://www.nu.edu.kz), to MS. from Agence Nationale pour la Recherche (http://www.agence-nationale-recherche.fr) [ANR Blanc 2010 Projet ANR- 09-GENO-000] and Electricité de France RB 2014-26 (http://www.edf.fr), to A.A.I. from Fondation de France (http://www.fondationdefrance.org) [#2012 00029161 to A.A.I.]; and to D.O.Z. from the Russian Foundation for Basic Research (14-04-01879-a) and Presidium of the Russian Academy of Sciences (MKB 6.12). S.B. and I.T. were supported by PhD and postdoctoral fellowships from the Eurasian Unviersity, Kazakhstan and Fondation ARC, respectively.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version.

22 References [1] J. Cadet, T. Douki, D. Gasparutto, J.L. Ravanat, Oxidative damage to DNA: formation, measurement and biochemical features, Mutat. Res., 531 (2003) 5-23. [2] S. Bjelland, E. Seeberg, Mutagenicity, toxicity and repair of DNA base damage induced by oxidation, Mutat. Res., 531 (2003) 37-80. [3] A. Yasui, Alternative excision repair pathways, Cold Spring Harb. Perspect. Biol., 5 (2013). [4] L. Gros, M.K. Saparbaev, J. Laval, Enzymology of the repair of free radicals-induced DNA damage, Oncogene, 21 (2002) 8905-8925. [5] K. Hitomi, S. Iwai, J.A. Tainer, The intricate structural chemistry of base excision repair machinery: implications for DNA damage recognition, removal, and repair, DNA Repair (Amst), 6 (2007) 410-428. [6] A.A. Ischenko, M.K. Saparbaev, Alternative nucleotide incision repair pathway for oxidative DNA damage, Nature, 415 (2002) 183-187. [7] B. Demple, L. Harrison, Repair of oxidative damage to DNA: enzymology and biology, Annu. Rev. Biochem., 63 (1994) 915-948. [8] J.M. Daley, C. Zakaria, D. Ramotar, The endonuclease IV family of apurinic/apyrimidinic endonucleases, Mutat. Res., 705 (2010) 217-227. [9] B. Demple, L. Harrison, Repair of oxidative damage to DNA: enzymology and biology, Annu Rev Biochem, 63 (1994) 915-948. [10] J.M. Daley, C. Zakaria, D. Ramotar, The endonuclease IV family of apurinic/apyrimidinic endonucleases, Mutat Res, 705 (2010) 217-227. [11] G. Barzilay, I.D. Hickson, Structure and function of apurinic/apyrimidinic endonucleases, Bioessays, 17 (1995) 713-719. [12] J.C. Fromme, A. Banerjee, G.L. Verdine, DNA glycosylase recognition and catalysis, Curr. Opin. Struct. Biol., 14 (2004) 43-49. [13] D.O. Zharkov, Base excision DNA repair, Cell. Mol. Life Sci., 65 (2008) 1544-1565. [14] H. Ide, K. Tedzuka, H. Shimzu, Y. Kimura, A.A. Purmal, S.S. Wallace, Y.W. Kow, Alphadeoxyadenosine, a major anoxic radiolysis product of adenine in DNA, is a substrate for Escherichia coli endonuclease IV, Biochemistry, 33 (1994) 7842-7847. [15] A.A. Ishchenko, H. Ide, D. Ramotar, G. Nevinsky, M. Saparbaev, Alpha-anomeric deoxynucleotides, anoxic products of ionizing radiation, are substrates for the endonuclease IV-type AP endonucleases, Biochemistry, 43 (2004) 15210-15216. [16] L. Gros, A.A. Ishchenko, H. Ide, R.H. Elder, M.K. Saparbaev, The major human AP endonuclease (Ape1) is involved in the nucleotide incision repair pathway, Nucleic Acids Res., 32 (2004) 73-81. [17] A.A. Ishchenko, E. Deprez, A. Maksimenko, J.C. Brochon, P. Tauc, M.K. Saparbaev, Uncoupling of the base excision and nucleotide incision repair pathways reveals their respective biological roles, Proc. Natl. Acad. Sci. U. S. A., 103 (2006) 2564-2569. [18] V. Lazarevic, D. Nolt, J.L. Flynn, Long-term control of Mycobacterium tuberculosis infection is mediated by dynamic immune responses, J. Immunol., 175 (2005) 1107-1117. [19] V. Mizrahi, S.J. Andersen, DNA repair in Mycobacterium tuberculosis. What have we learnt from the genome sequence?, Mol. Microbiol., 29 (1998) 1331-1339. [20] R.V. Puri, N. Singh, R.K. Gupta, A.K. Tyagi, Endonuclease IV Is the major apurinic/apyrimidinic endonuclease in Mycobacterium tuberculosis and is important for protection against oxidative damage, PLoS One, 8 (2013) e71535. [21] R.V. Puri, P.V. Reddy, A.K. Tyagi, Apurinic/apyrimidinic endonucleases of Mycobacterium tuberculosis protect against DNA damage but are dispensable for the growth of the pathogen in guinea pigs, PLoS One, 9 (2014) e92035. [22] A.A. Ishchenko, G. Sanz, C.V. Privezentzev, A.V. Maksimenko, M. Saparbaev, Characterisation of new substrate specificities of Escherichia coli and Saccharomyces cerevisiae AP endonucleases, Nucleic Acids Res., 31 (2003) 6344-6353. [23] B. Joldybayeva, P. Prorok, I.R. Grin, D.O. Zharkov, A.A. Ishenko, B. Tudek, A.K. Bissenbaev, M. Saparbaev, Cloning and characterization of a wheat homologue of apurinic/apyrimidinic endonuclease Ape1L, PLoS One, 9 (2014) e92963.

23 [24] N.A. Lebedeva, N.I. Rechkunova, A.A. Ishchenko, M. Saparbaev, O.I. Lavrik, The mechanism of human tyrosyl-DNA phosphodiesterase 1 in the cleavage of AP site and its synthetic analogs, DNA Repair (Amst), 12 (2013) 1037-1042. [25] A. Gelin, M. Redrejo-Rodriguez, J. Laval, O.S. Fedorova, M. Saparbaev, A.A. Ishchenko, Genetic and biochemical characterization of human AP endonuclease 1 mutants deficient in nucleotide incision repair activity, PLoS One, 5 (2010) e12241. [26] M. Biasini, S. Bienert, A. Waterhouse, K. Arnold, G. Studer, T. Schmidt, F. Kiefer, T.G. Cassarino, M. Bertoni, L. Bordoli, T. Schwede, SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information, Nucleic Acids Res, 42 (2014) W252-258. [27] F. Sievers, A. Wilm, D. Dineen, T.J. Gibson, K. Karplus, W. Li, R. Lopez, H. McWilliam, M. Remmert, J. Soding, J.D. Thompson, D.G. Higgins, Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega, Mol Syst Biol, 7 (2011) 539. [28] C.D. Mol, C.F. Kuo, M.M. Thayer, R.P. Cunningham, J.A. Tainer, Structure and function of the multifunctional DNA-repair enzyme exonuclease III, Nature, 374 (1995) 381-386. [29] E.P. Carpenter, A. Corbett, H. Thomson, J. Adacha, K. Jensen, J. Bergeron, I. Kasampalidis, R. Exley, M. Winterbotham, C. Tang, G.S. Baldwin, P. Freemont, AP endonuclease paralogues with distinct activities in DNA repair and bacterial pathogenesis, Embo J, 26 (2007) 1363-1372. [30] D.J. Hosfield, Y. Guan, B.J. Haas, R.P. Cunningham, J.A. Tainer, Structure of the DNA repair enzyme endonuclease IV and its DNA complex: double-nucleotide flipping at abasic sites and threemetal-ion catalysis, Cell, 98 (1999) 397-408. [31] R. Asano, H. Ishikawa, S. Nakane, N. Nakagawa, S. Kuramitsu, R. Masui, An additional Cterminal loop in endonuclease IV, an apurinic/apyrimidinic endonuclease, controls binding affinity to DNA, Acta Crystallogr D Biol Crystallogr, 67 (2011) 149-155. [32] P. Benkert, M. Biasini, T. Schwede, Toward the estimation of the absolute quality of individual protein structure models, Bioinformatics, 27 (2011) 343-350. [33] F. Melo, E. Feytmans, Assessing protein structures with a non-local atomic interaction energy, J Mol Biol, 277 (1998) 1141-1152. [34] W.R.P. Scott, P.H. Hünenberger, I.G. Tironi, A.E. Mark, S.R. Billeter, J. Fennen, A.E. Torda, T. Huber, P. Krüger, W.F. van Gunsteren, The GROMOS Biomolecular Simulation Program Package, The Journal of Physical Chemistry A, 103 (1999) 3596-3607. [35] R. Anandakrishnan, B. Aguilar, A.V. Onufriev, H++ 3.0: automating pK prediction and the preparation of biomolecular structures for atomistic molecular modeling and simulations, Nucleic Acids Res, 40 (2012) W537-541. [36] S.E. Tsutakawa, D.S. Shin, C.D. Mol, T. Izumi, A.S. Arvai, A.K. Mantha, B. Szczesny, I.N. Ivanov, D.J. Hosfield, B. Maiti, M.E. Pique, K.A. Frankel, K. Hitomi, R.P. Cunningham, S. Mitra, J.A. Tainer, Conserved structural chemistry for incision activity in structurally non-homologous apurinic/apyrimidinic endonuclease APE1 and endonuclease IV DNA repair enzymes, J Biol Chem, 288 (2013) 8445-8455. [37] E.D. Garcin, D.J. Hosfield, S.A. Desai, B.J. Haas, M. Bjoras, R.P. Cunningham, J.A. Tainer, DNA apurinic-apyrimidinic site binding and excision by endonuclease IV, Nat. Struct. Mol. Biol., 15 (2008) 515-522. [38] R. Schmiedel, E.B. Kuettner, A. Keim, N. Strater, T. Greiner-Stoffele, Structure and function of the abasic site specificity pocket of an AP endonuclease from Archaeoglobus fulgidus, DNA Repair (Amst), 8 (2009) 219-231. [39] K. Lakomek, A. Dickmanns, E. Ciirdaeva, L. Schomacher, R. Ficner, Crystal structure analysis of DNA uridine endonuclease Mth212 bound to DNA, J Mol Biol, 399 (2010) 604-617. [40] D. Lu, J. Silhan, J.T. MacDonald, E.P. Carpenter, K. Jensen, C.M. Tang, G.S. Baldwin, P.S. Freemont, Structural basis for the recognition and cleavage of abasic DNA in Neisseria meningitidis, Proc Natl Acad Sci U S A, 109 (2012) 16852-16857. [41] A. Mazouzi, A. Vigouroux, B. Aikeshev, P.J. Brooks, M.K. Saparbaev, S. Morera, A.A. Ishchenko, Insight into mechanisms of 3'-5' exonuclease activity and removal of bulky 8,5'cyclopurine adducts by apurinic/apyrimidinic endonucleases, Proc. Natl. Acad. Sci. U. S. A., 110 (2013) E3071-3080.

24 [42] S.J. Tomanicek, R.C. Hughes, J.D. Ng, L. Coates, Structure of the endonuclease IV homologue from Thermotoga maritima in the presence of active-site divalent metal ions, Acta Crystallogr Sect F Struct Biol Cryst Commun, 66 (2010) 1003-1012. [43] S.E. Tsutakawa, D.S. Shin, C.D. Mol, T. Izumi, A.S. Arvai, A.K. Mantha, B. Szczesny, I.N. Ivanov, D.J. Hosfield, B. Maiti, M.E. Pique, K.A. Frankel, K. Hitomi, R.P. Cunningham, S. Mitra, J.A. Tainer, Conserved structural chemistry for incision activity in structurally non-homologous apurinic/apyrimidinic endonuclease APE1 and endonuclease IV DNA repair enzymes, J. Biol. Chem., 288 (2013) 8445-8455. [44] I. Ivanov, J.A. Tainer, J.A. McCammon, Unraveling the three-metal-ion catalytic mechanism of the DNA repair enzyme endonuclease IV, Proc. Natl. Acad. Sci. U. S. A., 104 (2007) 1465-1470. [45] M.D. Wyatt, J.M. Allan, A.Y. Lau, T.E. Ellenberger, L.D. Samson, 3-methyladenine DNA glycosylases: structure, function, and biological importance, Bioessays, 21 (1999) 668-676. [46] B. Demple, A. Johnson, D. Fung, Exonuclease III and endonuclease IV remove 3' blocks from DNA synthesis primers in H2O2-damaged Escherichia coli, Proc. Natl. Acad. Sci. U. S. A., 83 (1986) 7731-7735. [47] R.P. Cunningham, S.M. Saporito, S.G. Spitzer, B. Weiss, Endonuclease IV (nfo) mutant of Escherichia coli, J. Bacteriol., 168 (1986) 1120-1127. [48] D. Wagner, J. Maser, B. Lai, Z. Cai, C.E. Barry, 3rd, K. Honer Zu Bentrup, D.G. Russell, L.E. Bermudez, Elemental analysis of Mycobacterium avium-, Mycobacterium tuberculosis-, and Mycobacterium smegmatis-containing phagosomes indicates pathogen-induced microenvironments within the host cell's endosomal system, J Immunol, 174 (2005) 1491-1500. [49] H. Botella, P. Peyron, F. Levillain, R. Poincloux, Y. Poquet, I. Brandli, C. Wang, L. Tailleux, S. Tilleul, G.M. Charriere, S.J. Waddell, M. Foti, G. Lugo-Villarino, Q. Gao, I. Maridonneau-Parini, P.D. Butcher, P.R. Castagnoli, B. Gicquel, C. de Chastellier, O. Neyrolles, Mycobacterial p(1)-type ATPases mediate resistance to zinc poisoning in human macrophages, Cell Host Microbe, 10 (2011) 248-259. [50] R.M. Yates, A. Hermetter, D.G. Russell, The kinetics of phagosome maturation as a function of phagosome/lysosome fusion and acquisition of hydrolytic activity, Traffic, 6 (2005) 413-420. [51] S. Sturgill-Koszycki, P.H. Schlesinger, P. Chakraborty, P.L. Haddix, H.L. Collins, A.K. Fok, R.D. Allen, S.L. Gluck, J. Heuser, D.G. Russell, Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase, Science, 263 (1994) 678-681. [52] M. Takeuchi, R. Lillis, B. Demple, M. Takeshita, Interactions of Escherichia coli endonuclease IV and exonuclease III with abasic sites in DNA, J. Biol. Chem., 269 (1994) 21907-21914. [53] J.D. Levin, A.W. Johnson, B. Demple, Homogeneous Escherichia coli endonuclease IV. Characterization of an enzyme that recognizes oxidative damage in DNA, J. Biol. Chem., 263 (1988) 8066-8071. [54] T. Khanam, A. Shukla, N. Rai, R. Ramachandran, Critical determinants for substrate recognition and catalysis in the M. tuberculosis class II AP-endonuclease/3'-5' exonuclease III, Biochim. Biophys. Acta, 1854 (2015) 505-516. [55] C.M. Sassetti, E.J. Rubin, Genetic requirements for mycobacterial survival during infection, Proc. Natl. Acad. Sci. U. S. A., 100 (2003) 12989-12994. [56] Y.J. Zhang, T.R. Ioerger, C. Huttenhower, J.E. Long, C.M. Sassetti, J.C. Sacchettini, E.J. Rubin, Global assessment of genomic regions required for growth in Mycobacterium tuberculosis, PLoS Pathog, 8 (2012) e1002946. [57] J.R. Pritchard, M.C. Chao, S. Abel, B.M. Davis, C. Baranowski, Y.J. Zhang, E.J. Rubin, M.K. Waldor, ARTIST: High-Resolution Genome-Wide Assessment of Fitness Using Transposon-Insertion Sequencing, PLoS Genet, 10 (2014) e1004782. [58] H.L. Peh, A. Toh, B. Murugasu-Oei, T. Dick, In vitro activities of mitomycin C against growing and hypoxic dormant tubercle bacilli, Antimicrob Agents Chemother, 45 (2001) 2403-2404.

25 Figure legends Figure 1. DNA substrate specificity of the purified MtbXthA and MtbNfo proteins. 10 nM 5′-32Plabelled 30-mer THF•C or αdA•T duplexes were incubated in reaction buffer without divalent cations for 30 min at 37°C with varying concentrations of pure proteins. (A) Denaturing PAGE analysis of the products of MtbXthA-catalyzed activities. Lanes 1 and 6, control no enzyme; lanes 2 and 7, as 1 and 6 but 1 nM APE1 for 5 min at 37°C; lanes 3-5 and 8-10, 50, 200 and 1000 nM of MtbXthA in 10 mM Tris-HCl pH 8.0, 0.1 mg·mL-1 BSA. (B) Denaturing PAGE analysis of the products of MtbNfocatalyzed activities. Lanes 1 and 8, control no enzyme; lanes 2 and 9, as 1 and 8 but 1 nM APE1; lanes 3-7 and 10-14, 10, 50, 200 and 1000 nM of MtbNfo in 10 mM Tris-HCl pH 8.0, 0.1 mg·mL-1 BSA. For details, see Materials and Methods. Figure 2. Divalent metal ion dependence of MtbXthA-catalyzed AP site cleavage activity. 10 nM 5′-32P-labelled 30-mer THF•C duplex was incubated for 30 min at 37°C with 100 nM of MtbXthA in 20 mM Hepes-KOH, pH7.6, 0.1 mg·mL-1 BSA, 0.01 % NP-40 and varying concentration of divalent metal ions. (A) Denaturing PAGE analysis of the products of reaction. Lane 1, control THF•C; lanes 2, as lane 1 but 1 nM APE1 for 5 min at 37°C; lanes 3-6 as 1 but 100 nM MtbXthA and 0.1-10 mM MgCl2; lanes 7-10, as 3-6 but 0.1-10 mM MnCl2; lanes 11-14 as 3-6 but 0.1-10 mM CaCl2; lanes 1518 as 3-6 but 0.1-10 mM ZnCl2. For details, see Materials and Methods. (B) Graphical representation of data from panel A. Figure 3. Divalent metal ion dependence of MtbNfo-catalyzed AP site cleavage activity. 10 nM 5′32 P-labelled 30-mer THF•C duplex was incubated for 30 min at 37°C with 100 nM of MtbNfo in 20 mM Hepes-KOH, pH7.6, 0.1 mg·mL-1 BSA, 0.01 % NP-40 and varying concentration of divalent metal ions. (A) Denaturing PAGE analysis of the products of reaction. Lane 1, control THF•C; lanes 2-5 as 1 but 100 nM MtbNfo and 0.1-10 mM MgCl2; lanes 6-9, as 2-5 but 0.1-10 mM MnCl2; lanes 10-13 as 2-5 but 0.1-10 mM CaCl2; lanes 14-17 as 2-5 but 0.1-10 mM ZnCl2. For details, see Materials and Methods. (B) Graphical representation of data from panel A. Figure 4. Dependence of the MtbXthA-catalyzed AP site cleavage activity on reaction conditions. 10 nM 5′-32P-labelled 30-mer THF•C duplex was incubated with 20 nM of MtbXthA in 20 mM Hepes-KOH pH 4-9, 2 mM MgCl2, 0.1 mg·mL-1 BSA, 0.01 % NP-40, 0-200 mM KCl for 30 min at 20-42°C. For details, see Materials and Methods. (A) Graphical representation of pH dependence. (B) Graphical representation of temperature-dependence. (C) Graphical representation of ionic strength dependence. Figure 5. Dependence of the MtbNfo-catalyzed AP site cleavage activity on reaction conditions. 10 nM 5′-32P-labelled 30-mer THF•C duplex was incubated with 20 nM of MtbNfo in 20 mM HepesKOH pH 4-9, 10 mM MgCl2, 0.1 mg·mL-1 BSA, 0.01 % NP-40, 0-200 mM KCl for 30 min at 2060°C. For details, see Materials and Methods. (A) Graphical representation of pH dependence. (B) Graphical representation of temperature-dependence. (C) Graphical representation of ionic strength dependence. Figure 6. pH dependence of the mycobacterial AP endonuclease activities in the presence of 10 mM MnCl2. 10 nM 5′-32P-labelled 30 mer THF•C duplex was incubated with 2, 10 and 50 nM of protein in 20 mM Hepes-KOH pH 5.0-7.5, 0.1 mg/ml BSA, 0.01% NP-40, and 10 mM MnCl2 for 30 min at 37°C. (A) Denaturing PAGE analysis of the product of reaction of MtbXthA. Lane 1, control THF•C; lanes 2-7 as 1 but 2 nM MtbXthA; lanes 8-13 as 1 but 10 nM MtbXthA; lanes 14-19 as but 50 nM MtbXthA. (B) Denaturing PAGE analysis of the product of reaction of MtbNfo. Lane 1, control THF•C; lanes 2-7 as 1 but 2 nM MtbNfo; lanes 8-13 as 1 but 10 nM MtbNfo; lanes 14-19 as but 50 nM MtbNfo. For details, see Materials and Methods. Figure 7. 3′-repair phosphodiesterase activity of the MtbXthA and MtbNfo proteins. (A, B) MtbXthA-catalyzed 3′-phosphodiesterase activity. Time dependent cleavage of the 5’-32P-labelled Exo20THF•RexT oligonucleotide duplex by MtbXthA. 10 nM Exo20THF•RexT was incubated with 0.2 nM of MtbXthA in 20 mM Hepes-KOH pH 7.6, 0.1 mg·mL-1 BSA, 0.01% NP-40 and 2 mM MgCl2 at 37°C for varying periods of time. (A) Denaturing PAGE analysis of the products of reaction. (B) Graphical representation of data from panel A. (C, D) MtbNfo-catalyzed 3′-phosphodiesterase activity. Time dependent cleavage of the 5’-32P-labelled Exo20THF•RexT oligonucleotide duplex by MtbNfo. 10 nM Exo20THF•RexT was incubated with 100 nM of MtbNfo in 20 mM Hepes-KOH pH 6.5, 0.1 mg·mL-1 BSA, 0.01% NP-40 and 10 mM MnCl2 at 37°C for varying periods of time. (C)

26 Denaturing PAGE analysis of the products of reaction. (D) Graphical representation of data from panel A. For details, see Materials and Methods. Figure 8. Assay for nucleotide incision activity of MtbXthA and MtbNfo on 30-mer oligonucleotide duplexes containing modified bases. 10 nM 3′-32P-labelled 30-mer αdA•T, 5ohC•G, DHU•G duplexes were incubated with either 100 nM MtbXthA or 100 nM MtbNfo under optimal reaction conditions for each enzyme for 30 min at 37°C. Lane 1, control αdA•T; lane 2 as 1 but 5 nM human APE1, lane 3 as 1 but 100 nM MtbXthA, lane 4 as 1 but 100 nM MtbNfo; lane 5, control 5ohC•G duplex; lane 6 as 5 but 5 nM APE1; lane 7 as 5, but 100 nM MtbXthA; lane 8 as 5 but 100 nM MtbNfo; lane 9, control DHU•G; lanes 10 as 9 but 10 nM E. coli DNA glycosylase/AP lyase, Nth; lane 11 as 9 but 5 nM APE1; lane 12 as 9 but 100 nM MtbXthA; lane 13 as 9 but 100 nM MtbNfo. For details, see Materials and Methods. Figure 9. Comparison of DNA substrate specificities of the WT MtbXthA and MtbNfo and their respective mutants. 5’-[32P]-labelled THF•C (A) and Exo20THF•RexT (B) were incubated with increasing amounts of mycobacterial AP endonucleases for 30 min at 37°C. (A) AP site cleavage activity of WT and mutant AP endonucleases. Lanes 1 and 6, 25 and 10 nM WT MtbXthA; lanes 2 and 10, control THF•C; lanes 3-5, MtbXthA-D180N; lanes 7-9, MtbXthA-N182A; lane 11, 100 nM WT MtbNfo; lanes 12-14, MtbNfo-E126Q; lanes 15-17, MtbNfo-H206N. (B) 3'-phosphodiesterase activity of WT and mutant AP endonucleases. lanes 1 and 11, control Exo20THF•RexT; Lanes 2-4, WT MtbXthA; lanes 5-7, MtbXthA-D180N; lanes 8-10, MtbXthA-N182A; lanes 12-14, WT MtbNfo; lanes 15-17, MtbNfo-E126Q; lanes 18-20, MtbNfo-H206N. For details, see Materials and Methods. Figure 10. Sequence alignments and structural models of mycobacterial AP endonucleases. (A) Alignment of Xth homologs from E. coli (Xth), M. tuberculosis (MtbXthA) and N. meningitides (NApe and NExo). Identical residues are boxed in black, highly conserved ones, in grey, and conserved, in light grey. Active site residues, including the metal-coordinating ones, are labeled yellow; the His/Ser/Gly position distinguishing AP endonucleases from 3′-exonucleases is blue. (B) Overlay of the structure of E. coli Xth (1AKO, green) and the MtbXthA model (cyan). All active site residues are shown but left unlabeled for clarity, except for the His/Ser residue at the entrance. (C) Alignment of Nfo homologs from E. coli (Nfo), M. tuberculosis (MtbNfo) and G. kaustophilus (GkNfo). Conservation coloring is the same as in (A). Metal-coordinating residues are labeled green; the intercalating triad is yellow. (D) Overlay of the structure of E. coli Nfo (1QTW, green) and the MtbNfo model (cyan). All metal coordinators are shown but left unlabeled for clarity. Metal ions occupying Zn1, Zn2, and Zn3 sites are shown as dark grey, grey, and light grey spheres, respectively. Figure 11. Differential drug sensitivity of AP endonuclease-deficient E. coli strain carrying plasmids DNA with mycobacterial genes. (A) The survival of the E. coli AP endonuclease-deficient mutant strains under oxidative stress conditions. The strains are represented as: BH110 strain carrying control empty vector pBluescript II SK+ (▲), BH110 strain carrying pBW21-Nfo (■), BH110(DE3) strain carrying pBluescript II SK+/MtbXthA (○) and BH110(DE3) strain carrying pBluescript II SK+/MtbNfo (▼). Each survival curve represents at least three independent experiments. (B) The survival of the MMS-treated E. coli AP endonuclease-deficient strains expressing E. coli Nfo or Mtb AP endonucleases. The strains are represented as above. Each survival curve represents at least three independent experiments. For details, see Materials and Methods.

27 Tables Table 1. Comparison of kinetic parameters of AP endonucleases Mycobacterium tuberculosis. Proteins MtbXthA E. coli Xthb –1 DNA kcat, min kcat/KM, KM, kcat, KM, nM substratea min– nM min–1 –1 1 ·µM THF•C 55.6±19.2 0.025±0.003 0.45 31 40 THF Exo20 •T 817±266 362±43 443 731 32.2 Exo20P•T 571±96 728±40 1275 Exo20•T 1268±362 6.4±0.8 5 -

DNA substratea

MtbNfo KM, nM

kcat, min

–1

E. coli Nfod kcat, KM, nM min–1

from Escherichia coli and

kcat/KM, min– 1 ·µM–1 1300 44 -

kcat/KM ratio, MtbXthA/EcXth 3.5x10-4 10 -

kcat/KM, kcat/KM, kcat/KM ratio, min– min– MtbNfo/EcNfo 1 1 –1 –1 ·µM ·µM THF•C 78.3±28.3 0.04±0.01 0.51 4.8 4.5 900 5.7x10-4 THF Exo20 •T 215±31 0.06±0.003 0.26 7.4 4.5 608 4.3x10-4 P Exo20 •T 210±52 0.14±0.01 0.65 10 32 3200 2.0x10-4 Exo20•T N.D.c N.D. N.D. a Each substrate was used to measure a specific DNA repair function under the optimal reaction conditions: THF•C duplex for the AP endonuclease activity; Exo20THF•T recessed DNA duplex for the 3′-repair phosphodiesterase activity, Exo20P•T recessed DNA duplex for the 3′-phosphatase activity and Exo20•T recessed DNA duplex for the 3′5′ exonuclease activity (see Materials and Methods). b Kinetic parameters of E. coli Xth-catalyzed AP site cleavage were taken from [52] and for 3′phosphodiesterase activity obtained in this study. c N.D., not determined. Kinetic parameters could not be determined because of low 3′5′ exonuclease activity of MtbNfo. d Kinetic parameters of E. coli Nfo-catalyzed AP site cleavage activity on THF•C substrate were taken from [15], and for 3′-phosphodiesterase on 3′-dR5P DNA substrate and 3′-phosphatase activities were taken from [53].