Aptamer-based label-free impedimetric biosensor for detection of progesterone.

Subscriber access provided by University of Virginia Libraries & VIVA (Virtual Library of Virginia)

Article

Aptamer-Based Label-Free Impedimetric Biosensor for the detection of Progesterone Gaston Contreras Jiménez, Shimaa Hassan Hassan Eissa, Andy Ng, Hani Alhadrami, Mohammed M. Zourob, and Mohamed Siaj Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/ac503639s • Publication Date (Web): 08 Dec 2014 Downloaded from http://pubs.acs.org on December 11, 2014

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28

1 2 3 4 5 6 7 8 9 10 1 11 2 12 13 3 14 15 4 16 5 17 6 18 19 7 20 8 21 22 9 23 24 25 10 26 27 11 28 29 30 12 31 13 32 33 34 14 35 36 15 37 38 39 16 40 41 17 42 43 18 44 45 46 19 47 48 20 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Aptamer-Based Label-Free Impedimetric Biosensor for the detection of Progesterone Gastón Contreras Jiménez1, Shimaa Eissa1,2, Andy Ng2, Hani Alhadrami3 , Mohammed Zourob4,5, Mohamed Siaj1*

1

Département de Chimie et Biochimie, Université du Québec à Montréal, Montréal, QC H3C 3P8, Canada

2

Institut National de la Recherche Scientifique, Centre Énergie Matériaux Télécommunications, Varennes,

QC J3X 1S2 Canada 3

Faculty of Applied Medical Sciences, King Abdulaziz University, P.O.Box. 80402, Jeddah 21589,

Kingdom of Saudi Arabia, 4

Center of Biomedical Engineering, School of Engineering, Cranfield University, Cranfield, Bedfordshire

MK43 0AL, United Kingdom 5

Chemistry Department, Alfaisal University, Al Zahrawi Street, Al Maather, Al Takhassusi Rd, Riyadh

11533, Kingdom of Saudi Arabia *Corresponding Authors Mohamed Siaj E-mail: [email protected], Tel: +1514 987 3000 # 1921

1 ACS Paragon Plus Environment


1 2 3 1 4 5 6 2 7 8 3 9 10 11 4 12 13 5 14 15 6 16 17 18 7 19 20 8 21 22 23 9 24 25 10 26 27 11 28 29 30 12 31 32 13 33 34 14 35 36 37 15 38 39 16 40 41 17 42 43 44 18 45 46 19 47 48 49 20 50 51 21 52 53 22 54 55 56 23 57 58 59 60

Page 2 of 28

ABSTRACT Rising progesterone (P4) levels in humans due to its overconsumption through hormonal therapy, food products or drinking water can lead to many negative health effects. Thus, the simple and accurate assessment of P4 in both environmental and clinical samples is highly important to protect the public health. In this work, we present the selection, identification and characterization of ssDNA aptamers with high binding affinity to progesterone (P4). The aptamers were selected in vitro from a ssDNA library of 1.8×1015 oligonucleotides showing a dissociation constants (KD) in the low nanomolar range. The dissociation constant of the best aptamer, designated as P4G13, was estimated to be 17 nM using electrochemical impedance spectroscopy (EIS) as well as fluorometric assay. Moreover, the aptamer P4G13 did not show cross-reactivity to analogues similar to progesterone such as 17b-estradiol (E2) and norethisterone (NET). An impedimetric aptasensor for progesterone was then fabricated based on the conformational change of P4G13 aptamer, immobilized on the gold electrode by self-assembly, upon binding to P4 which results in an increase in the electron transfer resistance. An aptamer-complementary DNA (cDNA) oligonucleotides were tested to maximize the signal gain of the aptasensor after binding with progesterone. A significant signal enhancement was observed when the aptamer hybridized with a short complementary sequence at specific site was used instead of the pure aptamer. This signal gain is likely due to the more significant conformational change of the aptamer-cDNA than the pure aptamer upon binding with P4 as confirmed by circular dichroism (CD) spectroscopy. The developed aptasensor exhibited a linear range for the concentrations of P4 from 10 ng/ml to 60 ng/ml with a detection limit of 0.90 ng/mL. Moreover, the aptasensor was applied in spiked tap water samples showing good recovery percentages. The new selected progesterone aptamers can be exploited in further biosensing applications for environmental, clinical and medical diagnostic purposes.


Page 3 of 28

1 2 3 1 4 5 6 2 7 8 9 3 10 11 4 12 13 14 5 15 16 6 17 18 7 19 20 21 8 22 23 9 24 25 26 10 27 28 11 29 30 12 31 32 33 13 34 35 14 36 37 15 38 39 40 16 41 42 17 43 44 45 18 46 47 19 48 49 20 50 51 52 21 53 54 22 55 56 23 57 58 59 60


Introduction Endocrine-disrupting chemicals (EDCs) are substances that may exist in our drinking water and food products that interfere with hormones biosynthesis, metabolism, or action resulting in a deviation from normal homeostatic control or reproduction1. The presence of these EDCs above or below a certain threshold may cause adverse effects in wildlife as well as humans by interfering with the normal function of the endocrine system. Progesterone (P4) is a 21 carbon steroid hormone secreted meanly by the corpus luteum, associated with the establishment and maintenance of mammalian pregnancy and essentially required for growth and development of the animal. Progesterone is used as menopausal hormone therapy, to regulate abnormal menstrual cycles and as hormone replacement therapy for the treatment of gender dysphoria2,3. However, high amount of P4 in women may cause side effects such as breast tenderness, headache, upset stomach, constipation, diarrhea, vomiting, tiredness, body pain, irritability, mood swings, excessive worrying, sneezing, runny nose, cough, vaginal discharge and urination problems4. Excess consumption of high P4 in milk may result in breast and lungs cancers5. High levels of P4 in males may also provoke negative effect on Gonadotropin releasing hormone (GnRH) secretion6 which may lead to a decrease of testosterone secretion and affect male behavior7. High doses of this progestogen are usually consumed by humans, nonetheless the body just absorbs low amounts and the rest is wasted to the sewage water and may affects the environment. Therefore, the accurate monitoring of P4 concentration in both environmental and clinical samples is highly important. Several methods are currently employed for P4 detection. Instrumental analysis methods such as HPLC, LC/MS or GC/MS, are very sensitive with a limit of detection ranging from 0.01 to 0.21 ng/L8,9. However, these methods are usually costly and time consuming, require highly trained personnel to perform and thus, are not suitable for field applications. Immunological methods such as enzyme linked immunosorbent assay (ELISA) and radioimmunoassay 3 ACS Paragon Plus Environment


1 2 3 1 4 5 6 2 7 8 3 9 10 11 4 12 13 5 14 15 6 16 17 18 7 19 20 8 21 22 23 9 24 25 10 26 27 11 28 29 30 12 31 32 13 33 34 14 35 36 37 15 38 39 16 40 41 17 42 43 44 18 45 46 19 47 48 49 20 50 51 21 52 53 22 54 55 56 23 57 58 59 60

(RIA) are also currently utilized for P4 detection10,11.

Page 4 of 28

However, the RIA requires specialized and

expensive equipment to handle the radioactive and hazard materials which brings environmental protection concerns and the ELISA kits are still expensive, time consuming and requires multi-steps. Recently, immunosensors have been shown as a good alternative to these traditional analytical and immunological methods for P4 detection. Several optical immunosensors for P4 detection based on surface plasmon resonance12, total internal reflectance fluorescence13,14, and by an integrated optical grating coupler15 have been reported showing good sensitivity. Moreover, electrochemical immunosensors have been also reported based on amperometry16,17, differential pulse voltammetry18, and chronoamperometry19 detection showing lower cost, more simplicity and capability of miniaturization rather than optical assays. Nevertheless, a major weakness of these immunosensors is the use of antibodies as biorecognition receptor. The production of antibodies is highly costly and requires the use of experimental animals which raise ethical concerns20,21. Moreover, antibodies targeting similar molecules usually suffer from cross-reactivities and requires special storage and handling conditions. Recently, aptamers as bioreceptors have emerged as good alternative to antibodies in the development of biosensor devices22,23 because of their high stability and easier chemical synthesis with very low cost. Aptamers are small single-stranded DNA (ssDNA) or RNA sequences (oligonucleotides of ~100 nucleotides or less) that fold into a unique 3D structure due to the intramolecular interactions between nucleotides. Because of such unique structures, aptamers can bind with high affinity to a specific analyte by intermolecular interactions such as hydrogen bonds and Van der Waals forces24,25. In the last two decades, many aptamers have been selected against various analytes such as bacteria, viruses26, proteins27 and small molecules28-31 and even ions as Hg2+,32 with high affinity and specificity. These aptamers have opened the way for fabricating new generation of biosensor devices with lower cost, stability and much simpler detection strategies than immunosensors. Only few aptamers targeting hormones have been


Page 5 of 28

1 2 3 1 4 5 6 2 7 8 3 9 10 4 11 12 13 5 14 15 6 16 17 18 7 19 20 21 8 22 23 9 24 25 26 10 27 28 11 29 30 31 12 32 33 34 13 35 36 14 37 38 15 39 40 41 16 42 43 17 44 45 46 18 47 48 19 49 50 20 51 52 53 21 54 55 22 56 57 23 58 59 60


identified so far such as 17b-estradiol33, hormone abscisic acid34, thyroxine35 and vasopressin36. In this work, we report for first time the selection and characterization of aptamer that bind progesterone and its application in a biosensing platform. The aptamers were obtained from a diverse random library of ~1015 ssDNA sequences through in vitro selection procedures. After selection, the affinity, cross-reactivity and conformational change of the selected aptamer was characterized. Finally, a simple label-free biosensing aptamer-based platform for progesterone detection was developed.

Experimental Section Materials, Reagents and Instrumentation. All the materials, reagents and instrumentation are described in details in the Supporting Information Methods Progesterone immobilization on agarose beads Progesterone was coupled to DADPA agarose beads (P4-beads) following the protocol reported previously. Briefly, 11 µmol progesterone 3-O-carboxymethyloxime was dissolved in 0.5 mL DMSO and then mixed with 0.36 mmol EDC-HCl in 1.0 mL coupling buffer (0.5 M MES buffer pH 4.7) to be activated. The activated hormone was immediately added to 2 mL of washed DADPA agarose beads in coupling buffer to react for 3 hours by mild shaking at 25 °C in 5.5 mL final volume. Afterwards, the beads were washed with 1 M NaCl solution to remove the unreacted P4. Then, the unreacted amine functions on the beads were blocked by incubation in Sulfo-NHS-acetate solution in 1 M carbonate buffer, pH 8.6 and rotation for 1 hr, after which the beads were washed extensively with binding buffer and kept at 4 oC. The coupling between DADPA agarose beads and P4 3-O-CMO (P4 immobilization) was confirmed by an ELISA test. Primary anti P4 3-O-CMO rabbit monoclonal antibody and HRP-labeled goat anti-rabbit IgG secondary polyclonal antibody were used in the assay. 5 ACS Paragon Plus Environment


1 2 3 1 4 5 6 2 7 8 9 3 10 11 4 12 13 5 14 15 16 6 17 18 7 19 20 8 21 22 23 9 24 25 10 26 27 28 11 29 30 12 31 32 13 33 34 35 14 36 37 38 15 39 40 16 41 42 17 43 44 45 18 46 47 19 48 49 20 50 51 52 21 53 54 22 55 56 57 58 59 60

Page 6 of 28

Random ssDNA library and primers design A random ssDNA library of 1.80×1015 (3 nmol) oligonucleotides was chemically synthesized and purified by PAGE. The ssDNA library consisted of a central random region of 60 nucleotides flanked by two 18 nucleotides primers at 3’ and 5’ ends. The primers are binding sites for PCR amplification of each ssDNA sequence, 5’-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT-3’ (96mer). To facilitate the separation of the desirable ssDNA from the double stranded DNA (dsDNA) symmetric PCR products, the reverse primer was labeled with hexaethyleneglycol (HEGL) linker (to block the polymerase extension) followed by a ssDNA tail of 20 d-Adenine; labeled reverse primer: 5’- poly-dA20-HEGLAGATTGCACTTACTATCT-3’. To quantify the separated and the recovered ssDNA, the forward primer was labeled with fluorescein isothiocyanate (FITC) fluorophore; labeled forward primer: Fluorescein-5’-TATACCAGCTTATTCAATT-3’. Unlabeled primers set were specifically used for PCR amplification for cloning step when in vitro selection rounds were completed. In vitro selection of the progesterone aptamers Six consecutive steps were performed for each round (Scheme 1): (1) incubation of the DNA library with the P4-beads, (2) separation of the unbound DNA to the P4- beads by washing, (3) Elution of the bound DNA sequences to P4, (4) Desalting and PCR amplification of the eluted DNA, (5) denaturation of the dsDNA aptamer from the PCR products using polyacrylamide gel electrophoresis. A negative selection cycle was performed in the 11th cycle and a specific elution (SE) was used to elute the bound ssDNA in the last two cycles. The DNA from the last cycle was then cloned and sequenced. All the details of the selection and cloning can be found in the Supporting Information. Electrochemical measurements


Page 7 of 28

1 2 3 1 4 5 6 2 7 8 3 9 10 4 11 12 13 5 14 15 6 16 17 18 7 19 20 8 21 22 23 9 24 25 10 26 27 28 11 29 30 12 31 32 13 33 34 35 14 36 37 15 38 39 40 16 41 42 17 43 44 45 18 46 47 19 48 49 20 50 51 52 21 53 54 22 55 56 23 57 58 59 60


The cyclic voltammetry (CV) experiments were conducted at a scan rate of 50 or 100 mV/s.

The

electrochemical impedance spectroscopy (EIS) were recorded over a frequency range from 10 kHz to 0.1 Hz using an alternative voltage with an amplitude of 10 mV, superimposed on a DC potential of 0.23 V (vs a Ag/AgCl reference electrode). The impedance data were plotted in the form of complex plane diagram (Nyquist plot) with a sampling rate of 25 points per decade. The obtained spectra were fitted using Nova 1.9 software to a modified Randles equivalent circuit. All the EIS and CV measurements were recorded in a 0.01 M PBS buffer solution containing 5 mM [Fe(CN)6]3−/4− redox pair (1:1 molar ratio). Dissociation constant (KD) determination by fluorescence The selected ssDNA aptamers sequences were amplified by PCR with the fluorescein-labeled forward primer and the poly-A labeled reverse primer to allow easy separation of the antiparallel DNA strands and quantification. Each fluorescein-labeled sequence were heated to 90 °C for 10 minutes, 4 °C for 10 minutes and then 25 °C for 5 minutes. Different amounts of individual sequence (0 to 300nM final concentration) were incubated with P4-beads (equivalent to 11.2 pmol free P4) for 2 hours at 25 °C. The mixture was washed and DNA was eluted and quantified as described above. A one-site saturation curve was obtained for each sequence and their respective KD values was calculated by non-linear regression analysis. Dissociation constant determination by electrochemical impedance spectroscopy (EIS) First, the selected ssDNA aptamers sequences were chemically synthesized without the primers sequences and purified by PAGE. Progesterone molecules were immobilized on a gold electrode surface through an amine terminated linker as described in details in the Supporting Information. Different concentrations of each sequence (5 to 300nM final concentration) were then incubated with the P4 modified electrodes for 40 min at 25 °C [optimized binding time]. The electrodes were washed with binding buffer and subjected to the EIS measurement. The binding was monitored by measuring the change in the charge transfer resistance (Rct) before and after binding with the aptamer. A one-site saturation curve 7 ACS Paragon Plus Environment


1 2 3 1 4 5 6 2 7 8 3 9 10 11 4 12 13 5 14 15 16 6 17 18 7 19 20 21 8 22 23 9 24 25 26 10 27 28 11 29 30 12 31 32 33 13 34 35 14 36 37 38 15 39 40 16 41 42 17 43 44 45 18 46 47 19 48 49 20 50 51 52 21 53 54 55 22 56 57 23 58 59 60

Page 8 of 28

was obtained for the sequences (P4G11 and P4G13) and their respective KD value was also calculated using non-linear regression analysis. Cross-reactivity study by fluorescence assay The cross-reactivities of P4G13 aptamer to NET and E2 as analogues of P4 were tested. Certain amounts of P4G13 sequence were separately incubated with 5 µL of each hormone-beads in binding buffer for 1 hr at 25 °C with mild shaking; 100 nM to P4-beads (equivalent to 11.2 pmol free P4), 300 nM to NET-beads (equivalent to ~39.5 nmol free NET) and 300 nM to E2-beads (equivalent to ~69 nmol free E2). Conformation study of the pure aptamer and aptamer-complementary DNA upon progesterone binding using Circular Dichroism (CD) spectroscopy P4G13 aptamer sequence (5’-GCATCACACACCGATACTCACCCGCCTGATTAACATTAGCCCAC CGCCCACCCCCGCTGC-3’, 60mer) was partially hybridized with one of its complementary fragment (cDNA2) (5’-TGGGCGGTGG-3’, 10mer). The hybridization was achieved by mixing equal amounts of the aptamer with cDNA2 in binding buffer and pre-treating the solution by incubation at 94 °C for 5 min, then at 47 °C for 5min, cool down at 4 °C for 10 min and finally at 25 °C for 5min. A solution of 1.5 µM of the resultant partially double stranded DNA aptamer (pdsDNA) was incubated separately with 1.5 µM of P4 free analyte and Bisphenol A as control for 1 hr. For comparison, 1.5 µM of the pure aptamer was also incubated with 1.5 µM of P4. The CD measurements were carried out by scanning from 350 to 230 nm the corresponding samples before and after binding to the target analyte. Contributions of the binding buffer and the analyte spectra on the measurements were eliminated by subtraction from the corresponding sample spectra. Electrochemical aptasensor of Progesterone Initially, the gold (Au) electrodes were polished with 1, 0.3, and 0.05 µm particle size alumina slurry (Al2O3) followed by washing with ultrapure water (18.2 MΩ·cm), ultrasonication for 2 min in water, 8 ACS Paragon Plus Environment

Page 9 of 28

1 2 3 1 4 5 6 2 7 8 3 9 10 4 11 12 13 5 14 15 6 16 17 18 7 19 20 8 21 22 9 23 24 25 10 26 27 11 28 29 12 30 31 32 13 33 34 14 35 36 37 15 38 39 16 40 41 42 17 43 44 45 18 46 47 19 48 49 50 20 51 52 21 53 54 22 55 56 57 23 58 59 60


immersion in piranha solution (3:1 mixture of concentrated H2SO4 and 30% H2O2) only for 1 min (to avoid etching and gold oxidation37), washing with water, ultrasonication for 2 min in ethanol 100%. After that, the gold electrode was electrochemically cleaned in 0.5 M H2SO4 by CV sweeping from 0 to 1.6 V for 15 times at 100 mV/s scan rate, followed by washing with ultrapure water. Then, the hybridized disulfide modified HO-(CH2)6-S-S-(CH2)6-5’-P4G13-3’aptamer-cDNA2, prepared following the hybridization conditions described above was immobilized on the clean Au surface using self-assembly. The Au electrode was incubated with in 1 µM of disulfide pdsDNA solution in binding buffer for 16 hours and subsequently immersed in 1 µM of 6-mercaptohexanol (MCH) for 30 min in 10 mM PBS pH 7.4. The modified electrode were then washed thoroughly with binding buffer and immediately used in the electrochemical experiments or kept in binding buffer at 4 °C until later use. For progesterone detection experiments, The pdsDNA modified Au electrodes were incubated in different concentrations of free P4 solutions (0, 10, 20, 30, 40, 50, 60, 70, 80 and 1000 ng/mL) for 40 min followed by washing the electrode with binding buffer to remove the remained unbound P4 and subjected to EIS measurements. A calibration curve was obtained by plotting the percentage change in the charge transfer resistance upon P4 binding versus P4 concentrations.

Results and Discussions Progesterone aptamer selection In order to perform the SELEX experiments for small molecule targets, the analyte is usually immobilized on a solid support. We used here, a modified form of P4 analyte and performed the coupling to the beads through the external carboxylic modifier to keep all the functions groups of the progesterone molecule available for the DNA binding. The carboxylic groups of P4 3-O-CMO were coupled to the terminal amine groups of the DADPA agarose beads using EDC chemistry. The unreacted amine functions 9 ACS Paragon Plus Environment


1 2 3 1 4 5 6 2 7 8 3 9 10 4 11 12 13 5 14 15 6 16 17 18 7 19 20 8 21 22 9 23 24 25 10 26 27 11 28 29 12 30 31 32 13 33 34 14 35 36 37 15 38 39 16 40 41 17 42 43 44 18 45 46 19 47 48 20 49 50 51 21 52 53 22 54 55 23 56 57 58 59 60

Page 10 of 28

on the beads were then blocked using Sulfo-NHS-acetate to decrease the possible electrostatic interaction of the DNA with the amine groups which can lead to undesirable binding of nonspecific DNA sequences during the selection31. A direct ELISA was performed for the P4 coupled beads and negative blocked DADPA beads as a control using primary anti P4 3-O-CMO rabbit monoclonal antibody as capturing agent and HRP-labeled goat anti-rabbit IgG secondary polyclonal antibody and TMB substrate as reporter reagents. A blue color was produced in the P4 coupled beads indicating the success of the coupling reaction. The aptamers selection against the P4 analyte was carried out through 15 cycles of in vitro selection (or SELEX cycles). The cycles were done as shown in Scheme 1, by incubating a large random ssDNA aptamers library consists (of 1.80x1015 sequences in the first round with a constant amount of P4beads followed by separation of the bound and unbound DNA. Each selection cycle was monitored by following the bound ssDNA percentage with respect to the total input template ssDNA quantified by fluorescence and UV measurements. As shown in Figure 1, a high ssDNA recovery percentage was observed in the third cycle which was unexpected to be due to enrichment of P4 bound DNA at this early stage. We presumed that this high recovery was attributed to the strong electrostatic interaction between ssDNA and partially unblocked amines groups on the beads. Therefore, we did further blocking of the beads and significant decrease in the recovery was observed in the subsequent selection cycle which confirmed the crucial role of the blocking step. We then observed gradual increase in the DNA recovery until the tenth cycle after which negative selection cycle was performed to remove the non-specifically bound aptamers to the beads matrix. A high ssDNA amount was retained onto the blank-beads whereas low amount of DNA was found to be specific to the P4 analyte. However, a significant increase in the DNA recovery was observed again in the next cycles after NS which indicates the specificity of this low amount of washed ssDNA to the P4. In order to increase the stringency of the selection and recover the most specific DNA to the free P4, a specific elutions was used in the last two cycles. Due to the low solubility of


Page 11 of 28

1 2 3 1 4 5 6 2 7 8 3 9 10 4 11 12 13 5 14 15 6 16 17 18 7 19 20 8 21 22 23 9 24 25 10 26 27 28 11 29 30 12 31 32 13 33 34 35 14 36 37 15 38 39 16 40 41 42 17 43 44 18 45 46 19 47 48 49 20 50 51 21 52 53 54 22 55 56 23 57 58 59 60


P4 in water (16.8 mg/L at 25 °C38), a saturated solution of P4 was used for the specific elution step by dissolving 1.0 mg in 10 mL of binding buffer. At the 15th SELEX cycle when the ssDNA recovery reached a plateau, the SELEX was stopped and the resultant ssDNA pool was cloned and sequenced. A total of 19 aptamers were isolated, identified, aligned and grouped into eight families on the basis of their common motifs (see Table S-1 in the Supporting Information). Characterization of the selected aptamers The binding affinity of representative ssDNA aptamers to P4 from different families were individually tested using fluorescence assay and their dissociation constants were calculated using nonlinear regression analysis. As shown in Table 1, all the tested aptamers exhibited KD values in the low nanomolar range which implies high affinity to the P4 analyte. Figure 2a shows the plot of the saturation curves of P4G11 and P4G13 aptamers as examples. However, the KD determined using this fluorescence assay showed significant variation (40% standard deviation from the average KD value in some cases). Therefore, affinity binding were also attempted using EIS method. A gold electrode surface was used as the solid support on which the P4 analyte was immobilized as shown in the schematic diagram (Supporting information, Figure S-1 and S-2). The progesterone molecules were immobilized on the Au electrode via the carboxylic groups to keep the exposition site of the P4 molecules to the DNA similar to that used in the selection step. The immobilization of the P4 on the functionalized gold electrode was characterized by CV and EIS (Supporting information, Figure S-3a and S-3b, respectively). After incubating the P4 modified electrodes with different concentration of the aptamer, we observed remarkable increase in the Rct due to the binding with the negatively charged DNA which retarded the electron transfer of the [Fe(CN)6]3−/4− to the gold electrode (Supporting Information, Figure S-4). The change in the Rct was monitored and a saturation curve was plotted as shown in Figure 2b. As observed in Table 1, the KD values determined by EIS were close to the fluorescence method which confirms the high affinity of the selected aptamers. Moreover, the



1 2 3 1 4 5 6 2 7 8 3 9 10 4 11 12 13 5 14 15 6 16 17 18 7 19 20 8 21 22 23 9 24 25 10 26 27 28 11 29 30 12 31 32 13 33 34 35 14 36 37 15 38 39 40 16 41 42 17 43 44 45 18 46 47 19 48 49 20 50 51 52 21 53 54 22 55 56 57 23 58 59 60

Page 12 of 28

variation of the KD values determined by EIS was less than the fluorescence assay as indicated by the lower standard deviation which confirms the usefulness of the developed electrochemical binding affinity assay. A control measurement was also carried out by incubating the Au electrode with nonspecific DNA sequence. The low signal response to the nonspecific sequence indicated the selectivity of the EIS method (Fig. 2b, black line). Because our goal was to apply the selected aptamers in a label-free detection platform, it was important to study the conformational change of the aptamers with the highest affinity to progesterone (P4G03, P4G06, P4G11, and P4G13) before and after binding using circular dichroism spectroscopy. As shown in the Supporting information Figure S-5, the preliminary CD results showed that the aptamer P4G13 yielded more conformational change upon binding to P4 analyte. To study the specificity of P4G13 aptamer, cross-reactivity assays with NET and E2, hormones that can present in the same environmental samples and have similar chemical structure, were performed using fluorescence assay. A very low DNA recovery percentage was obtained with NET and E2 beads compared with the P4-beads (Figure 2c) which indicates the specificity of this aptamer. Electrochemical aptasensor of progesterone detection Because of its high affinity and specificity, P4G13 aptamer was chosen to be utilized as a sensing probe in an electrochemical biosensing platform. First, the aptasensor was fabricated by immobilizing the disulfide modified aptamer on the gold electrodes using self-assembly and characterized using CV as well as EIS. As shown in Figure 3a, a significant decrease in the anodic and cathodic peak currents of the [Fe(CN)6]3−/4− redox couple with an increase in the peaks separation ( ∆E) compared to the bare gold electrode was observed due to the negative charge of the DNA. Likewise, the charge transfer resistance of the [Fe(CN)6]3−/4− to the gold electrode was increased after the aptamer immobilization (Figure 3b) confirming the success of the self-assembly. The binding of P4 with the aptasensor result in a further small 12 ACS Paragon Plus Environment

Page 13 of 28

1 2 3 1 4 5 6 2 7 8 3 9 10 4 11 12 13 5 14 15 6 16 17 18 7 19 20 8 21 22 9 23 24 25 10 26 27 11 28 29 12 30 31 32 13 33 34 14 35 36 37 15 38 39 16 40 41 17 42 43 44 18 45 46 19 47 48 49 20 50 51 21 52 53 22 54 55 56 23 57 58 59 60


increase in the Rct. We presume that this change in the Rct is not due to blocking effect of such small size and neutral molecule (314.4 Da). However, we attribute this increase in the EIS signal to a partial change of the aptamer conformation upon binding to P4 causing more retardation of the [Fe(CN)6]3−/4− anions to the electrode surface and thus, increasing the Rct. The percentage change in the charge transfer resistance (R-Ro)/Ro % between the signal of the blank and the P4 solution before reaching the saturation point was 17.6% with a calculated detection limit of 3.2 ng/mL suggesting a poor response of the aptasensor to the P4 analyte (see Figure 3c) and (Supporting Information, Figure S-6). With the aim to improve the response of the biosensing platform, different aptameric arrangements were tested to increase the conformational change of the aptamer after binding to the analyte. The design was based on partial hybridization of a short moiety of the aptamer with a complementary ssDNA fragment. Hence, five complementary ssDNA sequences (cDNA, 10mer) of P4G13 at different sites were separately hybridized to the disulfide modified P4G13 sequence (60mer) and subsequently immobilized on the gold electrode. Figure 3c shows the response of the resultant pdsDNA aptasensors after incubation with the P4 analyte. It was observed that the resultant hybridized aptamer with the second complementary sequence (P4G13-cDNA2, 5’TGGGCGGTGG -3’) showed the highest response after binding to the P4 analyte. We believe that by hybridizing a moiety of the aptamer, we force the aptamer to adopt a different conformation that eventually will change in a distinct way by binding the analyte. This change have led to more significant blocking of the electron transfer and in turn the Rct was increased (Scheme 2). On the other hand, the response of some of the tested P4G13-cDNA at other sites were even lower than the pure aptamer. This could be due to different conformation changes of the pdsDNA which resulted in more access of the [Fe(CN)6]3−/4− to the gold electrode. Moreover, possible displacement of the 10mer cDNA that was hybridized to the binding site of the analyte with the free progesterone may occur. The liberated cDNA can decrease the total negative charge on the electrode surface leading to a decrease in the Rct. No



1 2 3 1 4 5 6 2 7 8 3 9 10 4 11 12 13 5 14 15 6 16 17 18 7 19 20 8 21 22 9 23 24 25 10 26 27 11 28 29 12 30 31 32 13 33 34 14 35 36 37 15 38 39 16 40 41 17 42 43 44 18 45 46 19 47 48 49 20 50 51 21 52 53 54 22 55 56 23 57 58 59 60

Page 14 of 28

signficant change was reported in the P4G13-cDNA2 sensor response after the incubation with bisphenol, which could indicates the specificity of the aptasensor. Figure 4 shows more significant change in the CD spectra of the P4G13-cDNA2 than the pure aptamer upon binding with progesterone whereas no change was observed with bisphenol A, another water contaminant with a MW=228.29 Da as a control which also supports our explanation. Figure 5a, show the P4G13-cDNA2 aptasensor upon binding with different concentration of P4. An increase in the aptasensor response was observed in the range of 10 ng/ml to 60 ng/ml. A calibration plot is shown in Figure 5b which can be represented by the equation: (RRo)/Ro=3.94%+1.268[P4] with a detection limit of 0.90 ng/ml calculated as DL= 3S/b, where S is the standard deviation of the blank and b is the slope of the straight line. The standard deviations of the measurement were ranging from 1% to 7%, indicating good reproducibility of the P4 aptasensor. This detection limit is comparable with the detection limits of some other reported electrochemical immunosensors16,17,18. Moreover, based on this data, the affinity of the aptamer was again assessed by calculating the KD in the aptasensor configuration (supporting information, Figure S7). A value of 111.74±24.58 nM was obtained which is close to that previously obtained by fluorescence and EIS measurements (low nanomolar range). These results indicate that the hybridization of the aptamer with the short complementary sequence and further anchoring to the gold surface did not significantly influence the affinity of the aptamer. Real biosensing application Spiked progesterone concentrations in tap water were testing to check the possibility of applying the developed EIS aptasensor in real samples.

Good recovery percentages were obtained that indicates non

significant interference from the tap water components on the aptasensor detection. Hence, these results ratify the real application of the EIS aptasensor in environmental analysis (see Table S-2 in the Supporting Information).


Page 15 of 28

1 2 3 1 4 5 2 6 3 7 8 9 4 10 11 5 12 13 6 14 15 16 7 17 18 8 19 20 9 21 22 23 10 24 25 11 26 27 28 12 29 30 13 31 32 33 14 34 15 35 16 36 37 38 17 39 40 18 41 42 19 43 44 45 20 46 47 21 48 49 50 22 51 52 23 53 54 55 24 56 57 58 25 59 60


Conclusions In this work, the selection and characterization of the first DNA aptamers with high affinity to progesterone was presented. The aptamer P4G13 (KD= 17nM) showed excellent specificity to progesterone with no detectable cross reactivity with its similar congeners E2 and NET. We showed by circular dichroism analysis that the conformation change of the aptamer upon binding with P4 was more significant when the aptamer was hybridized with a 10mer short complementary sequence. This phenomenon has been exploited to develop a label- free aptasensor with enhanced signal gain monitored by EIS. The proposed aptasensor showed a linear dynamic range from 10 to 60 ng/mL with a limit of detection of 0.90 ng/mL. A preliminary application of the EIS aptasensor in the spiked tap water samples showed a good recovery percentage. The application of the developed aptasensor in clinical samples will be studied in the future as well as therapeutic biosensing applications of the selected progesterone aptamers are expected.

ACKNOWLEDGMENTS

This work was made possible by support from the Natural Science and Engineering Research Council of Canada (NSERC) and Le Fonds de Recherche du Québec—Nature et Technologies (FQRNT). We are gratefully acknowledge the fellowship received towards G.C.J from the FQRNT- Scholarships program for international students. We acknowledge all the characterization centers including NanoQAM, Le Centre de Caractérisation Microscopique des Matériaux (CM2) and CoFaMic. We would like to thank Prof. Mario Morin for valuable help for L.M.F.E. laboratory renovation.

References 15 ACS Paragon Plus Environment


1 2 3 1 4 2 5 6 3 7 4 8 5 9 6 10 7 11 8 12 9 13 14 10 15 11 16 12 17 13 18 14 19 15 20 21 16 22 17 23 18 24 19 25 20 26 21 27 28 22 29 23 30 24 31 25 32 26 33 27 34 28 35 29 36 37 30 38 31 39 32 40 33 41 34 42 35 43 44 36 45 37 46 38 47 39 48 40 49 41 50 51 42 52 43 53 44 54 45 55 46 56 47 57 48 58 59 60

(1) (2) (3) (4) (5) (6) (7) (8) (9) (10) (11) (12) (13) (14) (15) (16) (17) (18) (19) (20) (21) (22) (23) (24) (25) (26) (27) (28) (29) (30) (31) (32) (33) (34) (35) (36) (37)

Page 16 of 28

Diamanti-Kandarakis, E.; Bourguignon, J. P.; Giudice, L. C.; Hauser, R.; Prins, G. S.; Soto, A. M.; Zoeller, R. T.; Gore, A. C. Endocr. Rev. 2009, 30, 293-342. Hewitt, J. K.; Campbell, P.; Porpavai, K.; Grover, S. R.; Newman, L. K.; Warne, G. L. Med. J. Aust. 2012, 196(9), 578-81. King, T. L.; Brucker, M. C. Pharmacology For Women’s Health, 1st Ed. Jones & Bartlett Publishers, San Francisco, 2010, 372. Sherwin, B. B. J. Reprod. Med. 1999, 44(2 Suppl): 227-32. Ganmaa, D.; Sato, A. Med. Hypotheses 2005, 65, 1028-37. Kanasaki, H.; Purwana, I. N.; Mijiddorj, T.; Sukhbaatar, U.; Oride, A.; Miyazaki, K. Neuro Endocrinol. Lett. 2012, 33, 608-13. Schneider, J. S.; Stone, M. K.; Wynne-Edwards, K. E.; Horton, T. H.; Lydon, J.; O'Malley, B.; Levine, J. E. Proc. Natl. Acad. Sci. U S A 2003, 100, 2951-6. Beiraghi, A.; Pourghazi, K.; Amoli-Diva, M. Anal. Method. 2014, 6, 1418-26. Tolgyesi, A.; Verebey, Z.; Sharma, V. K.; Kovacsics, L.; Fekete, J. Chemosphere 2010, 78, 972-9. Capparelli, R.; Iannelli, D.; Bordi, A. J. Dairy Res. 1987, 54, 471-77. Shrivastav, T. G.; Chaube, S. K.; Charu; Rangari, K.; Kariya, K. P.; Singh, R.; Nagendra, A. J. Immunoassay and Immunochemistry 2010, 31, 301-13. Gillis, E. H.; Traynor, I.; Gosling, J. P.; Kane, M. J AOAC Int 2006, 89, 838-42. Tschmelak, J.; Kappel, N.; Gauglitz, G. Anal. Bioanal. Chem 2005, 382, 1895-903. Kappel, N. D.; Proll, F.; Gauglitz, G. Biosens. Bioelectron. 2007, 22, 2295-300. Ehrentreich-Forster, E.; Scheller, F. W.; Bier, F. F. Biosens. Bioelectron. 2003, 18, 375-80. Carralero, V.; González-Cortés, A.; Yáñez-Sedeño, P.; Pingarrón, J. M. Anal. Chim. Acta 2007, 596, 86-91. Pemberton, R. M.; Hart, J. P.; Mottram, T. T. Biosens. Bioelectron. 2001, 16, 715-23. Kreuzer, M. P.; McCarthy, R.; Pravda, M.; Guilbault, G. G. Anal. Lett. 2005, 37, 943-56. Arevalo, F. J.; Messina, G. A.; Molina, P. G.; Zon, M. A.; Raba, J.; Fernandez, H. Talanta 2010, 80, 1986-92. National Health and Medical Research Council (2013) Australian code for the care and use of animals for scientific purposes; Council., t. e. C. N. H. a. M. R. Perry, M. Aust. Vet. J. 1998, 76, 286. Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818-22. Tuerk, C.; Gold, L. Science 1990, 249, 505-10. Stoltenburg, R.; Reinemann, C.; Strehlitz, B. Biomol. Eng. 2007, 24, 381-403. Stoltenburg, R.; Reinemann, C.; Strehlitz, B. Anal. Bioanal. Chem. 2005, 383, 83-91. Liang, H. R.; Hu, G. Q.; Xue, X. H.; Li, L.; Zheng, X. X.; Gao, Y. W.; Yang, S. T.; Xia, X. Z. Virus Res. 2014, 184, 713. Umekage, S.; Kikuchi, Y. Nucleic Acids Symp. Ser. (Oxf) 2006, 323-4. Mann, D.; Reinemann, C.; Stoltenburg, R.; Strehlitz, B. Biochem. Bioph.l Res. Co. 2005, 338, 1928-34. Reinemann, C.; Stoltenburg, R.; Strehlitz, B. Anal. Chem. 2009, 81, 3973-78. Ng, A.; Chinnappan, R.; Eissa, S.; Liu, H.; Tlili, C.; Zourob, M. Environ. Sci. & Technology 2012, 46, 10697-703. Eissa, S.; Ng, A.; Siaj, M.; Tavares, A. C.; Zourob, M. Anal. Chem. 2013, 85, 11794-801. Gao, C.; Wang, Q.; Gao, F. Chem. Commun. 2014, 50, 9397-400. Kim, Y. S.; Jung, H. S.; Matsuura, T.; Lee, H. Y.; Kawai, T.; Gu, M. B. Biosens. Bioelectron. 2007, 22, 2525-31. Grozio, A.; Gonzalez, V. M.; Millo, E.; Sturla, L.; Vigliarolo, T.; Bagnasco, L.; Guida, L.; D'Arrigo, C.; De Flora, A.; Salis, A.; Martin, E. M.; Bellotti, M.; Zocchi, E. Nucleic Acid Ther. 2013, 23, 322-31. Kawazoe, N.; Ito, Y.; Shirakawa, M.; Imanishi, Y. B. Chem. Soc. Jpn. 1998, 71, 1699-703. Williams, K. P.; Liu, X. H.; Schumacher, T. N. M.; Lin, H. Y.; Ausiello, D. A.; Kim, P. S.; Bartel, D. P. Proc. Natl. Acad. Sci. USA 1997, 94, 11285-290. Fischer, L. M.; Tenje, M.; Heiskanen, A. R.; Masuda, N.; Castillo, J.; Bentien, A.; Émneus, J.; Jakobsen, M. H.; Boisen, A. Microelectron. Eng. 2009, 86, 1282-5. 16 ACS Paragon Plus Environment

Page 17 of 28

1 2 3 1 4 5 2 6 3 7 4 8 9 5 10 6 11 12 7 13 8 14 15 9 16 10 17 11 18 19 12 20 13 21 22 14 23 15 24 25 16 26 17 27 28 18 29 19 30 20 31 32 21 33 22 34 35 23 36 24 37 38 25 39 40 26 41 27 42 43 28 44 45 29 46 47 30 48 49 31 50 51 32 52 53 33 54 55 34 56 57 35 58 59 60


(38) Haskins, A. L. Exp. Biol. Med. 1949, 70, 228-9.

Figure captions 17 ACS Paragon Plus Environment


1 2 3 1 4 5 6 2 7 8 3 9 10 11 4 12 13 5 14 15 6 16 17 18 7 19 20 8 21 22 23 9 24 25 10 26 27 11 28 29 30 12 31 32 33 13 34 35 36 14 37 38 15 39 40 16 41 42 43 17 44 45 46 18 47 48 49 19 50 51 52 20 53 54 21 55 56 22 57 58 59 60

Page 18 of 28

Figure 1. Selection of progesterone aptamers: recovery of ssDNA pool after each SELEX cycle, negative selection (NS) performed by using blank-beads and specific elutions (SE) performed in two last cycles. The gray column represent the recovery of ssDNA by using unblocked P4-beads.

Figure 2. Binding affinity assays between ssDNA aptamers and progesterone (P4). The saturation curves were obtained, using fluorescence measurements (a), by plotting the concentration of the complex formed by the binding between ssDNA aptamer and P4 analyte ([ssDNA-P4]) as a function of unbound ssDNA concentration ([ssDNA] = x) and using EIS measurements (b), by plotting the percentage of charge transfer resistance (Rct) value as a function of initial ssDNA aptamer concentration (by considering that [ssDNA]0 >> [ssDNA]). Bmax1 and Bmax2 are the corresponding total binding sites in each

‫݀ܭ‬

determination way. The

KD values were determined by non-linear regression analysis. (c) Cross-reactivities tests of P4G13 aptamer to 17b-estradiol (E2) and norethisterone (NET).

Figure 3. Cyclic voltammograms at scan rate of 100 mV/s (a) and EIS Nyquist plots (b) recorded in 5 mM [Fe(CN)6]4-/3- redox couple in 10 mM PBS of bare gold and after the formation of self-assembled monolayer (SAM) of the aptamer (b). Comparison of the aptasensor response (R-R0/R0) % after saturation point achieved by the different SAM biosensing platforms using different aptameric arrangements (c).

Figure 4. Circular Dichroism spectra of different aptameric arrangement before and after binding to 1.5 µM P4 analyte. 1.5 µM of pure ssDNA P4G13 aptamer (a), P4G13 -cDNA2 (b), P4G13 -cDNA2 was also incubated with 1.5µM of BPA in binding buffer at 25°C as a negative control experiment (c). The DNA samples were individually scanned from 340 to 230 nm at 100 nm/s scan rate.


Page 19 of 28

1 2 3 1 4 5 6 7 2 8 9 3 10 11 4 12 13 14 5 15 16 6 17 18 7 19 20 21 8 22 23 24 9 25 26 27 28 10 29 30 31 11 32 33 34 12 35 36 13 37 38 39 14 40 41 15 42 43 44 16 45 46 17 47 48 18 49 50 19 51 52 20 53 54 21 55 56 22 57 58 59 60


Figure 5. (a) Nyquist plots (EIS spectra) of faradaic measurements in 5mM [Fe(CN)6]4-/3- of the aptasensor in different concentrations of P4 analyte ( 0, 10, 20, 30 , 40, 50, 60, 70, and, 80 ng/mL), symbols profile corresponds to the experimental data and the lines to the fitted data. Each measurement was swept from 10 KHz to 0.1 Hz at a bias potential of 0.230 V with an alternating potential of 10 mV. (b) The calibration curve of the aptasensor; linear plot with a regression coefficient r2=0.995. The LOD was estimated to be 0.90 ng/mL at a linear range from 0 to 60 ng/mL.

Scheme. 1 diagram of systematic evolution of ligands by exponential enrichment (SELEX) protocol

Scheme 2. Impedimetric mechanism of the aptasensor.

Table 1. Aptamer sequences for progesterone (P4). The KD values were determined by fluorescence measurements and EIS measurements. All the sequences alignment can be seen in the supporting information, Table S-1.

Scheme 1



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 1 40 2 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Page 20 of 28

Page 21 of 28

100

99.86%

Figure 1

SE

80 60

NS

40 20

0.46%

ssDNA recovery [%]

1 2 3 1 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 2 37 38 3 39 4 40 41 5 42 43 6 44 45 7 46 47 8 48 49 9 50 51 10 52 53 11 54 55 12 56 57 13 58 59 60


0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

In vitro selection cycle #



Figure 2

300

P4G13 P4G11

(a)

(b)

P4G11 P4G13 Control

(R-R0)/R0 (%)

200

100

600 400 200

0

0 0

50

100

150

200

250

300

(c) 60

ssDNA recovery [%]

800 [ssDNA-P4] (RFU/µL)

1 2 3 1 4 5 2 6 7 3 8 9 4 10 11 5 12 13 6 14 15 7 16 17 8 18 19 9 20 21 10 22 23 11 24 25 12 26 13 27 28 14 29 30 15 31 32 16 33 34 17 35 36 18 37 38 19 39 40 20 41 42 21 43 44 22 45 46 23 47 48 24 49 50 25 51 26 52 53 27 54 55 28 56 57 29 58 59 60

Page 22 of 28

0

50

100

[ssDNA] (nM)

150

200

250

[ssDNA] (nM)


300

P4

40

NET

20

E2

0 P4

NET

Analyte

E2

Page 23 of 28

1 2 3 1 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 2 20 21 3 22 23 4 24 25 5 26 27 6 28 29 7 30 31 8 32 9 33 34 10 35 36 11 37 38 12 39 40 13 41 42 14 43 44 15 45 46 16 47 48 17 49 50 18 51 52 19 53 54 20 55 56 21 57 58 22 59 60


Figure 3



Figure 4 10

(a)

10

(b)

10

8

Before After

8

Before After

8

4 2

4 2

0

0

-2

-2

-4

-4

(c) Before After

6

6 θ (mdeg)

6

θ (mdeg)

θ (mdeg)

1 2 3 1 4 5 2 6 7 3 8 9 4 10 11 5 12 13 6 14 15 7 16 17 8 18 19 9 20 21 10 22 23 11 24 25 12 26 27 13 28 14 29 30 15 31 32 16 33 34 17 35 36 18 37 38 19 39 40 20 41 42 21 43 44 22 45 46 23 47 48 24 49 50 25 51 52 26 53 27 54 55 28 56 57 29 58 59 60

Page 24 of 28

4 2 0 -2 -4

220

240

260

280

300

Wavelength (nm)

320

340

-6 -8

220

240

260

280

300

320

340

Wavelength (nm)


220

240

260

280

300

Wavelength (nm)

320

340

Page 25 of 28

1

Figure 5

2 2

r = 0.995

7.5

(R-R0)/R0 (%))

4 5.0

2.5

60

40

20

5 6

f = 3.94% + 1.268[P4]

80

3

Z'' (kΩ)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(a)

0.0

(b)

0 0

5

10

15

20

0

Z' (kΩ)

20

40 CP4 (ng/mL)


60

80


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1

Scheme 2

2 3 4 5


Page 26 of 28

Page 27 of 28

1 2 3 1 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 2 20 21 3 22 4 23 24 5 25 26 6 27 28 7 29 30 8 31 32 9 33 34 10 35 36 11 37 38 12 39 40 13 41 42 14 43 44 15 45 46 16 47 48 17 49 18 50 51 19 52 53 20 54 55 21 56 57 22 58 59 60


Table 1 Label P4G11 P4G06 P4G13 P4G04 P4G03

Aptamer Sequence CAACGATCGTACCACAGTACCCACCCACCAGCCCCAACAT CATGCCCATGCGTCGGTGTG CACGCACACAACAGCCAATAATGTATAACGCTGTCCACTG TGTGGTGTCCCCCGCGTCG GCATCACACACCGATACTCACCCGCCTGATTAACATTAGC CCACCGCCCACCCCCGCTGC GGCACGGCAAAGGGGTACAGCCTACCGAACCGTGGCTGTA AGGGTGGTTGTGGTGTG CACACACGCAGCAAGGTCGTCGATACAAAACGTATCGACC CGTCACAGACTGCCCCGGGT


Kd (nM) Fluorescence EIS 15.14±3.75

12.58±1.39

28.66±12.20

-

35.23±8.30

16.81±3.12

133.30±40.51

-

9.63±3.12

-


1 2 3 1 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 2 24 25 3 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table of content (TOC)


Page 28 of 28

An ultrasensitive impedimetric glycan biosensor with controlled glycan density for detection of lectins and influenza hemagglutinins.

A label-free electrical impedimetric biosensor for the specific detection of Alzheimer's amyloid-beta oligomers.

Sensitive impedimetric biosensor for direct detection of diazinon based on lipases.

Ultrasensitive impedimetric lectin based biosensor for glycoproteins containing sialic acid.

Ultrasensitive detection of influenza viruses with a glycan-based impedimetric biosensor.

Copper Induced Conformational Changes of Tripeptide Monolayer Based Impedimetric Biosensor.

Sensitive impedimetric biosensor based on duplex-like DNA scaffolds and ordered mesoporous carbon nitride for silver(I) ion detection.

Impedimetric cell-based biosensor for real-time monitoring of cytopathic effects induced by dengue viruses.

Ultrasensitive Impedimetric Biosensor Fabricated by a New Immobilisation Technique for Parathyroid Hormone.

Universal biosensor for detection of influenza virus.

An electrochemiluminescence biosensor for endonuclease EcoRI detection.

Fabrication of an ultrasensitive impedimetric buprenorphine hydrochloride biosensor from computational and experimental angles.

Impedimetric detection of alcohol vapours using nanostructured zinc ferrite.

Impedimetric DNA-biosensor for the study of anti-cancer action of mitomycin C: comparison between acid and electroreductive activation.

Impedimetric screening for bacteriuria.

Novel impedimetric immunosensor for detection of pathogenic bacteria Streptococcus pyogenes in human saliva.

Preparation of electrochemical biosensor for detection of organophosphorus pesticides.

Label-free aptamer biosensor for selective detection of thrombin.

An integrated giant magnetoimpedance biosensor for detection of biomarker.

An aptamer-based electrochemical biosensor for the detection of Salmonella.

Giant Magnetoresistance-based Biosensor for Detection of Influenza A Virus.

Field-Effect Transistor Biosensor for Rapid Detection of Ebola Antigen.

Acetylcholinesterase fiber-optic biosensor for detection of anticholinesterases.

Multicolor fluorescent biosensor for multiplexed detection of DNA.