Atherosclerosis, 92 (1992) 15I- 164 0 1992 Eisevier Scientific Publishers Ireland, Ltd. All rights reserved 0021-9150/92/%05.00

151

Printed and Published in Ireland

Apolipoprotein B gene polymorphisms, lipoproteins and coronary atherosclerosis: A study of young myocardial infarction survivors and healthy population-based individuals Rachel Peacock I, Alison Dunning I, Anders Hamsten Per Tornval12, Steve Humphries’ and Philippa Talmud{ ‘The Char@ Cross Suniey Research Centre, Lurgan Avenue, Hammersmith, London, W6 8L W (UK.) and 2King Gustaf V Research Institute and Department of Internal Medicine. Karolinska Hospital, Karolinska Institute. Stockholm (Sweden)

(Received 24 July, 1991) (Revised, received 25 October 1991) (Accepted 29 October 1991)

Summary Association studies were carried out in a sample of 87 patients from Sweden who had survived a myocardial infarction (MI) before the age of 45, and 91 age-matched healthy individuals, to compare the impact of polymorphisms at the apolipoprotein (apo) E and B gene loci on among-individual differences in plasma lipid traits and progression of atherosclerosis. In the group of healthy individuals, polymorphisms creating the common apo E isoforms were, as expected, associated with significant differences in total and low density lipoprotein (LDL) cholesterol (11.7% and 11.6% of sample variance). For apo B, the polymorphism with the largest effect on apo B levels (16% of sample variance) was the C to T transition 265 bp 5 ’ of the cap site, in the promoter (detectable by MspI). Both this polymorphism and the threonine*,ss neutral substitution (detectable by XbaI) were associated with significant effects on LDL-cholesterol (8.3% and 9.3% of sample variance, respectively). The asparaginekerine 4311polymorphism was associated with a significant effect on high density lipoprotein (HDL) cholesterol alone, and there was no significant association with the glutamate/lysine4iS polymorphism (detectable by EcoRI) or the leucine-alanine-leucine (LAL) insertion/deletion polymorphism in the signal peptide. In the patients, polymorphisms creating the three common apo E isoforms were associated with large effects on cholesterol, apo B and triglyceride levels (19.9%, 20.3% and 23.9% of sample variance) of similar magnitude as in the healthy individuals. Apo B polymorphisms were found to be associated with much smaller effects on lipid traits than in the healthy individuals. The only significant association was between the asparagine/serine4si 1 polymorphism and HDL-triglyceride levels. However, global severity of coronary atherosclerosis at the first angiography was found to be significantly associated with the LAL insertion/deletion polymorphism (P = 0.008). Thus Correspondence to: Miss R. Peacock, The Centre for Genetics of CardiovascularDisorders, University College & Middlesex School of Medicine, Department of Medicine, The Rayne Institute, University Street, London, WCIE 6JI, U.K.

Abbrevations; apo, apolipoprotein; RFLP. restriction fragment length polymorphism; chol, cholesterol: TG. triglycerides: Ml. myocardial infarction.

152 variation at the apo B gene locus is associated with the development of atherosclerosis, but the data suggests that this may act through mechanisms not directly related to effects on measured lipid traits.

Key words: Myocardial infarction; Apo B gene polymorphism; Angiography; Apo E genotype

Introduction Apolipoprotein (apo) B, a monomeric glycoprotein of approximately 550 kDa, plays a central role in lipoprotein metabolism and in maintaining the normal homeostasis of serum cholesterol levels [ 11. Apo B is essential both for the assembly and secretion of chylomicrons from the small intestine and of very low density lipoproteins (VLDL) from the liver [2] and as the ligand for the LDL receptor [3] mediating the cellular uptake of cholesterol. Thus variation within the apo B gene is likely to explain some of the inter-individual differences in serum lipid levels and suspectibility to coronary heart disease (CHD) that has been reported in numerous population studies [4-71. Epidemiological studies have established that elevated plasma levels of LDL and apo B and depressed plasma levels of HDL and apo A-I are correlated with increased risk of CHD and premature atherosclerosis (reviewed in Ref. 8), thus suggesting that variation at the apo B gene locus may be associated both with differences in lipid levels and with incidence of CHD. Over the past 6 years, a number of restriction fragment length polymorphisms (RFLPs) in the apo B gene have been reported [9- 181. Some of these polymorphisms have subsequently been found to be associated with peripheral arterial disease [4], coronary artery disease (CAD) [5,6] and risk of myocardial infarction (MI) [ 191. Associations have also been found between RFLPs of the apo B gene and serum lipid levels, and several studies have shown an association between serum cholesterol and/or triglyceride levels and the threoninez4ss (Thr) neutral substitution detectable by XbaI [20-221. However results from these population studies were not without inconsisten-

RFLP;

Coronary

atherosclerosis;

cies [5,11,19-221, i.e. associations found by some groups have not been found by other groups. The purpose of this study was twofold; firstly to investigate whether there was an association between variation at the apo B gene locus and global severity and rate of progression of coronary atherosclerosis in a group of young MI patients and secondly to determine the contribution of variation within the apo B gene to amongindividual variation in serum lipid and apolipoprotein levels, compared with the well known effects associated with the common apo E isoforms. Materials and methods Subjects The initial study population consisted of 145 patients and 96 healthy individuals recruited from Stockholm County, Sweden. The patients had all suffered a first MI before the age of 45 years. Patients who were female, diabetic or had familial hypercholesterolaemia or other major concomitant disease such as uraemia and collagenosis were excluded, which left 87 patients in the study. The healthy individuals were age-matched male residents of Stockholm County. They were free of symptoms and clinical signs of CHD. DNA was not available for live of the healthy individuals, leaving 91 individuals in the study. All individuals used in this study were unrelated and of Swedish origin except for 10 patients who had at least one parent or grandparent born in Finland. Recruitment and clinical prodecures have been described in detail previously [23,24]. Metabolic and haemostatic investigations were done 3-6 months after the MI. Within the next few weeks the patients had coronary angiography. Reangiogra-

153 phies were done after the first angiography on 74 of the patients (mean time between angiographies = 5 years, 2 months, SD. = 9 months; range 3.5 to 6.75 years). Coronary artery disease severity and progression

Prodecures for coronary angiography and details of the scoring systems have been described the global coronary elsewhere [25]. In atherosclerosis score, points were assigned for extension of atherosclerosis and plaque size in each of fifteen proximal coronary arterial segments. Atherosclerotic lesions were defined as sharpedged, plaque-like or irregular indentations, often multiple, into the vessel lumen without features suggesting fibromuscular hyperplasia. A single stenosis with smooth contours, or a single occlusion, in the absence of additional changes in the same or any other artery, was not classifed as atherosclerosis. Distinct stenoses were quantified by means of a separate classification system in which a coronary stenosis score was derived from estimations of the proportional reduction in luminal diameter of the three most stenotic portions of each segment. The global atherosclerosis and stenosis severity scores were obtained by dividing the sum of all segmental atherosclerosis and stenosis scores, respectively, by the number of segments accessible to evaluation. The presence and severity of diffuse coronary atherosclerosis was distinctly differentiated from the number and severity of haemodynamically significant stenoses by the two systems. The tine films from the first and second angiographies were projected simultaneously for purpose of comparison. Progression of coronary atherosclerosis and distinct stenoses was defined as increase in the global coronary atherosclerosis and stenosis scores. Lipid and lipoprotein analysis

A combination of preparative ultracentrifugation and precipitation of apo B-containing lipoproteins, followed by lipid analyses in the major lipoprotein fractions [26] was used to determine serum lipoproteins. Cholesterol [27] and triglycerides [28] were determined on an Ultrolab (LKB Bromma, Sweden) after chloroform-metha-

nol extraction of whole serum, the VLDL fraction, the infranatant after ultracentrifugation (containing LDL and HDL), and the supernatant (HDL) after precipitation. Apo A-I and apo B were determined by electroimmunoassay [23]., DNA preparation and analysis

Blood was collected after an overnight fast. DNA extraction from fresh blood samples was carried out by the Triton X-100 lysis method [29]. PCR-amplification [30] in a total volume of 50 ~1 was on a Cambio intelligent heating block (Cambio, Cambridge, U.K.). Oligonucleotides were obtained from Severn Biotech Ltd (Kidderminister, U.K.). Thermus aquaticus polymerase was from Perkin Elmer-Cetus (CT, U.S.A.), and 0.5 unit used per PCR. Buffers were as recommended by Perkin Elmer-Cetus. In each PCR 100-200 ng of each primer was used. C to T (-265) substitution The denaturation step of the PCR was performed at 93°C for 5 min; annealing and extension at 58°C for 5 min. Thirty subsequent cycles were as follows; 92°C for I min and 58°C for 5 min. Sequences of the 5 ’ primer and 3 ’ primer were (5 ‘ to 3’) CAATTCAGTCCAGGAGAAGCA and CAGCAACCGAGAAGGGCACTCAG, respectively. Ten units of MspI (Northumbrian Biologicals Ltd, U.K.) was added and incubation was overnight. Digests were subsequently run on 2% agarose gels at 50 V for 2 h. After digestion, constant fragments of 76 bp and 54 bp are produced; with a 275 bp fragment in the absence of the polymorphic site or 179 and 96 bp fragments in its presence, as shown in Fig. 1. Other apo B gene polymorphisms

PCR procedures and subsequent electrophoresis and typing of alleles were as described for the LAL insertion/deletion polymorphism [ 15,3 I] and for the Thr24s8 neutral substitution detectable with XbaI and the glutamine/lysine,,,, (Glu/Lys) substitution - the t/z epitope detectable with EcoRI [32]. Detection of the asparagine/serine (AsriSer) substitution at amino acid 4311 was carried out by a double Southern blotting procedure of the PCR products followed by hybridisation to allele specific oligonucleotides (ASO) as described 1331.

154 sion and analysis of variance (ANOVA), if it was not already approximately normally distributed. Lipid and apolipoprotein traits were adjusted by linear regression for age and recorded body mass index (BMI) and the percentage variance associated with age and BMI (R2 x 100) was estimated. A one-way analysis of variance was performed on the age and BMI adjusted levels to test the null hypothesis that phenotypic variations in lipid and apolipoprotein levels were not associated with genetic variation at the apo B or apo E gene loci. The impact of apo E and apo B genotypes on age and BMI adjusted lipid and apolipoprotein traits were estimated by non-linear regression which removes the dependence on the existence of a linear relationship between the mean of a trait for each genotype and genotypes of the particular DNA polymorphism. Allele frequencies for each RFLP/polymorphism were estimated using the ‘gene-counting’ method, and determined separately for the healthy individuals and patients. To compare allele frequency in healthy individuals with that in patients, 2 x 2 contingency tables were used; 2 x 3 contingency tables were used to compare genotype frequencies, for each polymor-

Apo E genotyping

The restriction isotyping procedure (PCR amplification, digestion with the enzyme HhaI and electrophoresis on polyacrylamide gels) was as described by Hixson and Vernier [34]. Oligonucleotide primers used in the PCR were as described [35]. Statistical

analysis

Statistical analysis was carried out using the SPSS computer program. Only those healthy individuals with serum cholesterol levels less than 9.5 mmol/l and serum triglyceride levels less than 3.0 mmol/l were selected. These cut-off points were chosen for the healthy individuals, to give a sample more representative of the general population of Sweden and to remove the disproportionate effects of a few individuals with extremely high lipid levels on the analysis of the data. Thus four individuals with abnormally high levels and three individuals with no values for either cholesterol (chol) or triglyceride (TG) levels were excluded. Mean levels of each lipid/lipoprotein trait for the healthy individuals and patients were compared using the ttest. Data was loglo-transformed prior to regres-

TABLE 1 MEANS AND STANDARD Trait

Age (years) BMI (kg/m2) Cholesterol (mmolil) Total VLDL LDL HDL Triglycerides (mmol/I) Total VLDL LDL HDL Apo A-l (mg/lOO ml) Apo B (mg/lOO ml)

DEVIATIONS (UNADJUSTED)

FOR LIPID TRAITS IN THE SWEDISH SAMPLE

Healthy individuals (n = 84)

Patients (n = 87)

Mean

Mean

zt S.D.

P from t-test” f S.D.

40.51 24.57

3.98 2.36

40.35 26.42

3.50 3.25

NS