Cellular Signalling 27 (2015) 1873–1881

Contents lists available at ScienceDirect

Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig

Apolipoprotein a1 increases mitochondrial biogenesis through AMP-activated protein kinase Parkyong Song a, Yonghoon Kwon a, Kyungmoo Yea a, Hyo-Youl Moon b, Jong Hyuk Yoon a, Jaewang Ghim a, Hyunjung Hyun c, Dayea Kim a, Ara Koh a, Per-Olof Berggren c,d, Pann-Ghill Suh b, Sung Ho Ryu a,⁎ a

Department of Life Sciences, Pohang University of Science and Technology, Pohang, Kyungbuk 790-784, Republic of Korea School of Nano-Biotechnology & Chemical Engineering, Ulsan National Institute of Science and Technology, 689-805, Ulsan, Republic of Korea Division of Integrative Biosciences and Biotechnology, Pohang University of Science and Technology, Pohang, 790-784, Republic of Korea d The Rolf Luft Research Center for Diabetes and Endocrinology, Karolinska Institutet, Stockholm, Sweden b c

a r t i c l e

i n f o

Article history: Received 25 April 2015 Accepted 7 May 2015 Available online 14 May 2015 Keywords: Apolipoprotein a1 Mitochondria AMPK Skeletal muscle

a b s t r a c t Apolipoprotein a1, which is a major lipoprotein component of high-density lipoprotein (HDL), was reported to decrease plasma glucose in type 2 diabetes. Although recent studies also have shown that apolipoprotein a1 is involved in triglyceride (TG) metabolism, the mechanisms by which apolipoprotein a1 modulates TG levels remain largely unexplored. Here we demonstrated that apolipoprotein a1 increased mitochondrial DNA and mitochondria contents through sustained AMPK activation in myotubes. This resulted in enhanced fatty acid oxidation and attenuation of free fatty acid-induced insulin resistance features in skeletal muscle. The increment of mitochondria was mediated through induction of transcription factors, such as peroxisome proliferatoractivated receptor gamma coactivator 1-alpha (PGC-1α) and nuclear transcription factor 1 (NRF-1). The inhibition of AMPK by a pharmacological agent inhibited the induction of mitochondrial biogenesis. Increase of AMPK phosphorylation by apolipoprotein a1 occurs through activation of upstream kinase LKB1. Finally, we confirmed that scavenger receptor Class B, type 1 (SR-B1) is an important receptor for apolipoprotein a1 in stimulating AMPK pathway and mitochondrial biogenesis. Our study suggests that apolipoprotein a1 can alleviate obesity related metabolic disease by inducing AMPK dependent mitochondrial biogenesis. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Apolipoprotein a1 is a major lipoprotein component of high-density lipoprotein (HDL) cholesterol [1]. HDL shows anti-atherogenic function through interaction between apolipoprotein a1 and ABC transporter A1 (ABCA1) in macrophage foam cells, in various tissues [2]. Once cholesterol enriched HDL particles are generated, and cholesterol is removed and excreted into bile at the liver. So, there is reverse relationship between levels of apolipoprotein a1 and cardiovascular diseases [3]. Beyond the reverse cholesterol transport, apolipoprotein a1 is related to many cellular processes such as proliferation [4], endothelial cell survival [5], regulation of inflammation [6,7] and anti-oxidant signaling [8]. Importantly, there is a clear relationship between apolipoprotein a1 and energy homeostasis, with low apolipoprotein a1 levels associated with insulin resistance [9]. In particular, the function of apolipoprotein a1 and HDL in triglyceride (TG) metabolism has been identified.

⁎ Corresponding author at: Department of Life Sciences, Pohang University of Science and Technology, San 31, Hyoja-dong, Pohang, Kyungpook, 790-784 Republic of Korea. Tel.: +82 54 279 2292; fax: +82 54 279 0645. E-mail address: [email protected] (S.H. Ryu).

http://dx.doi.org/10.1016/j.cellsig.2015.05.003 0898-6568/© 2015 Elsevier Inc. All rights reserved.

Although hypertriglyceridemic symptom was observed with two kinds of apolipoprotein a1 mutations [10,11], the underlying molecular mechanism of apolipoprotein a1 in TG metabolism has not been fully examined. Mitochondria is primarily referred to as an energy generating organelle because they supply cellular ATP by oxidative phosphorylation [12]. Given the relationship between fatty acid metabolism and mitochondria, mitochondrial dysfunction is one of the important causes of metabolic syndromes, such as diabetes and obesity [13–15]. Conversely, mitochondrial biogenesis is considered to be a potential therapeutic strategy for the alleviation of insulin resistance associated with type 2 diabetes. Mitochondrial biogenesis is referred to as an increase in the mitochondrial copy number, according to numerous physiological cues, such as endurance exercise, temperature, and pharmacological stimuli [12]. Transcriptional regulation of mitochondrial biogenesis is largely achieved by DNA binding transcription factor, nuclear transcription factor 1 (NRF-1), GABPα (GA-binding protein α) and coregulator, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) [15,16]. NRF-1 stimulates the expression of many mitochondrial genes which are responsible for oxidative phosphorylation [17] and mtDNA replication, like Tfam, Tfb1m, and Tfb2m [18–20]. Also, transcriptional coactivator PGC-1α provides the interface for

1874

P. Song et al. / Cellular Signalling 27 (2015) 1873–1881

recruitment of transcription factor NRF, ERR family [21–23] and histone acetyltransferases, to assemble active mitochondrial transcriptional complex [24]. Based on the involvement with mitochondrial biogenesis, identification of the transcription and post-translational mechanisms that modulate the activity of these mitochondrial transcription factors can present a possible therapeutic means to alleviate metabolic syndrome. The AMP-activated protein kinase is an evolutionarily conserved sensor of cellular energy status and is activated by energy requirement conditions, such as starvation, exercise and many endogenous hormones [25]. Importantly, AMPK has been identified as a master regulator of mitochondrial biogenesis in response to exercise or chronic administration of AMPK activators [26]. AMPK phosphorylates and activates PGC-1α activity, which is required to increase its binding capacity against its own promoter [27]. Prolonged treatment with adiponectin in skeletal muscle enhances PGC-1α and PPAR-α, indicating an increasing mitochondrial biogenesis [28,29]. Also, chemical activators of AMPK, AICAR or β-GPA have revealed the relationship between chronic AMPK activation and the expression of oxidative enzymes, such as NRF-1, cytochrome c and Tfam [30,31]. In the present study, we demonstrate that apolipoprotein a1 induced prolonged AMPK activation, subsequently leading to an increase in mitochondrial biogenesis and fatty acid oxidation in skeletal muscle. Apolipoprotein a1 up-regulated mitochondria contents and oxygen consumption rate through AMPK dependent manner. Based on these findings, our results suggest that an increment in the mitochondrial content through AMPK activation might be an important anti-diabetic aspect of apolipoprotein a1.

2.4. AMPK activity assay Differentiated cells were treated with apolipoprotein a1 for 24 hours. After precipitation, AMPK activity was evaluated as the incorporation of 32P into a synthetic SAMS peptide (HMRSAMSGLHLVKRR) in kinase reaction buffer (40 HEPES pH 7.5, 80 NaCl, 1 DTT, 0.2 AMP, 0.2 ATP, 5 MgCl2, 0.1 SAMS, 0.25 [γ-32P] ATP, mmol/l) at 30 °C for 20 min. 2.5. Mitochondria staining and quantification Mitochondria were detected by Mitotracker Green FM staining (Invitrogen). For the staining, cells were incubated with apolipoprotein a1 for 24 h and were washed with serum free media. Then, cells were incubated at 37 °C for 30 min with 100 nM MitoTracker Red FM for 30 min. Staining was detected on a fluorescence microplate reader (Perkin Elmer Wallac Victor2, excitation 485 nm, emission 520 nm) and fluorescence microscope. For quantification of mtDNA copy number, the control region (D-loop) of mtDNA was amplified from genomic DNA (Forward 5′- GGTTCTTACTTCAGGGCCATCA -3′and Reverse 5′- GATT AGACCCGTTACCATCGAGAT -3′). 2.6. RNA interference Control, ABCA1 (si-RNA No. 1600281), and SR-B1 (si-RNA No. 1753125) specific small interfering RNAs (Bioneer) were transfected using Lipo2000 reagent (Invitrogen), according to the manufacturer's recommendations. After 12 h, cells were washed with minimal medium, and stimulated for another 24 h with apolipoprotein a1.

2. Materials and methods

2.7. Adenoviral infection of dominant negative AMPK 2 isoform

2.1. Materials

Recombinant adenoviral vector expressing a myc-tagged dominant negative mutant of AMPK 2 and control virus were generated as previously described [32]. Dr. Joohun Ha and his colleagues (Kyung Hee University College of Medicine, Republic of Korea) for the generous gift of adenovirus. L6 myotubes were differentiated and infected with the indicated multiplicity of infection titers (MOI, ratio of viral particles per cell) for 6 h in serum free α-MEM media. The cells were then washed and incubated with the appropriate differentiation media for 48 h.

5-aminoimidazole-4-carboxamide-1-b-ribofuranoside (AICAR) was purchased from Toronto Research Chemical Incorporation (Toronto, ON, Canada). [9,10-3H] palmitate was from Perkin Elmer (Wellesley, MA, USA). Compound C, an AMPK inhibitor, and cycloheximide, a protein synthesis inhibitor, were provided by the MERCK Company (RY 70-100; Rahway, NJ). p-AMPK(Thr172), ACC, P-Akt(Ser473) (Cell Signaling Technology, MA), AMPK (Upstate, IL), and p-ACC(Ser79) (Millipore, MA) were purchased from respective company.

2.8. Fatty acid oxidation 2.2. Cell culture L6 cells were grown in α-MEM containing 10% fetal bovine serum (FBS), 50 U of penicillin per ml and 50 μg of streptomycin per ml at 37 °C under humidified air atmosphere containing 5% CO2. Differentiation of myoblast was induced in medium supplemented with 2% FBS. The medium was changed every other day. After 7 days, L6 GLUT4-myc myoblast cells had differentiated into myotubes.

2.3. Immunoblotting To prepare total cell lysates, myotube was washed with cold PBS and was then lysed in cold lysis buffer (40 HEPES pH 7.5, 120 NaCl, 1 EDTA, 10 pyrophosphate, 10 glycerophosphate, 50 NaF, 1.5 Na3VO4, 1 PMSF, 5 MgCl2, mmol/l, 0.5% Triton X-100 and protease inhibitor cocktail). After sonication and centrifugation, the supernatants were separated on SDS–PAGE (8–16%) gels, transferred to nitrocellulose membranes, and were finally incubated with primary antibodies overnight at 4 °C. Detection was performed using HRP-conjugated secondary antibodies and an enhanced chemiluminescence (ECL) solution.

After starvation for 2 h, myotubes were incubated in oxidation media (minimum essential medium containing 0.1 mmol/l palmitate (9,10-[3H] palmitate, 5 μCi/ml) and 0.1% lipid free BSA. After oxidation, media was transferred to new 1.5-ml microcentrifuge tubes, and the same volume of 10% trichloroacetic acid (TCA) solution was added. The supernatants were transferred to capless tubes, which were then placed in a scintillation vial containing 0.5 ml unlabeled water and incubated at 50 °C for 12 h. After evaporation and equilibration, the tubes were removed and scintillation enhancer fluid (PerkinElmer Life and Analytical Sciences) was added to the vial. The 3H2O level was measured in a scintillation counter. 2.9. Quantitative PCR analysis Total RNA was isolated from hepatocyte and mouse liver tissue using the TRIzol reagent and 3μg of RNA was reverse transcribed into cDNA. Quantitative real-time PCR analysis was carried out using HotStart-IT SYBR® Green and Bio-Rad iCycler iQ. The sense and antisense primers used in PCR are listed in Table 1. The relative quantification of mRNA was calculated by the comparative Ct method after normalization to ribosomal protein L32.

P. Song et al. / Cellular Signalling 27 (2015) 1873–1881 Table 1 Primers used for the Q-PCR. PGC-1α PPAR-α NRF1 UCP2 UCP3 ATP Syn Tfam GAPDH

Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse:

5′- GTGCAGCCAAGACTCTGTATGG -3′ 5′- GTCCAGGTCATTCACATCAAGTTC -3′ 5′- ACTATGGAGTCCACGCATGRG -3′ 5′- TTGTCGTACGCCAGCTTTAGC -3′ 5′- CAACAGGGAAGAAACGGAAA -3′ 5′- GTGGCTCTGAGTTTCCGAAG -3′ 5′- TTCTACAAGGGGTTCATGCC -3′ 5′- ATTCATAGGCAGCCATCAGG -3′ 5′- ATTTCAAGCCATGATACGCC -3′ 5′- GTCCCCTGACTCCTTCTTCC -3′ 5′- AGAGATGAGTGTTGAACAGG-3′ 5′-TACAGAATAACCACCATGGG-3′ 5′- CTGATGGCCATTACATGTGG -3′ 5′- AAAGCCCGGAAGGTTCTTAG -3′ 5′- GCATGGCCTTCCGTGTTCC -3′ 5′- GCCGCCTGCTTCACCACCTTCT -3′

1875

these studies, we next examined whether apolipoprotein a1 could improve FFA-induced inflammation and insulin resistance in skeletal muscle. Differentiated L6 myotubes were pretreated with purified apolipoprotein a1 and high density lipoprotein (HDL) for 24 h, then added to BSA-conjugated palmitate for an additional 4 h. Apolipoprotein a1 treatment recovered impaired glucose uptake resulting from palmitate (Fig. 1A). Similar to glucose uptake results, pretreatment with apolipoprotein a1 and HDL improved insulin signaling, such as tyrosine phosphorylation of AKT in the presence of palmitate (Fig. 1B). Conversely, apolipoprotein a1 reduced JNK phosphorylation in the presence of palmitate treatment. Each of these alterations in phosphorylation pattern indicates an improvement in inflammation. Free fatty acid induced inflammation is caused by increased expression of inflammatory cytokines in skeletal muscle. However, there were no changes of IL-6 transcript levels in apolipoprotein a1 pretreated L6 myotubes (Supplementary Fig. 1). Taken together, our findings suggest that apolipoprotein a1 attenuates FFA-induced insulin resistance in skeletal muscle, without any changes in muscle IL6 expression.

2.10. Statistical analysis All data are expressed as means ± S.E.M. Statistical analysis between two groups were performed by unpaired 2-tailed Student’s t test. P values of b 0.05 were considered significant.

3. Results 3.1. Attenuation of FFA-induced insulin resistance by apolipoprotein a1 It has been suggested that apolipoprotein a1 could attenuate obesity and hypertriglyceridemia caused by high fat feeding [33]. Based on

3.2. Apolipoprotein a1 induces mitochondrial biogenesis A major function of mitochondria is the alleviation of lipotoxicity and insulin resistance through increasing fatty acid oxidation [34]. Since apolipoprotein a1 has been shown to decrease palmitate induced insulin resistance, we hypothesized that apolipoprotein a1 might play a potential role in increasing mitochondrial biogenesis and function. To evaluate whether apolipoprotein a1 stimulates mitochondrial biogenesis, we used the mitochondria specific dye – MitoTracker Red, which can quantify total mitochondrial volume. In these experiments, apolipoprotein a1 caused dramatic increases in fluorescence intensity

A

B

Fig. 1. Effect of apolipoprotein a1 on insulin resistance in L6 myotubes. (A) L6 myotubes were pre-incubated with apolipoprotein a1 at indicated concentration for 24 h and glucose uptake was then measured with or without BSA-conjugated palmitate (500 μM). (B) L6 myotubes were pre-treated with apolipoprotein a1 (20 μg/ml) and HDL for 24 h. After 4 h treatment of BSA-conjugated palmitate (500 μM), the cells were further treated with insulin. Cell lysates were analyzed by immunoblotting for phospho/total AKT and JNK antibodies. Values are means ± S.E.M of three independent experiments performed in triplicate. *p b 0.05 and **p b 0.01 compared between two groups as indicated.

1876

P. Song et al. / Cellular Signalling 27 (2015) 1873–1881

A

B

C

D

Fig. 2. Apolipoprotein a1 increases mitochondrial contents. (A) Mitochondria were stained with 100 nM MitoTracker Green FM for 30 min. Images were acquired within 5 min using a fluorescent microscope. Scale bar, 100 μm (B) The cells were treated with the indicated concentrations of apolipoprotein a1 for 24 h. mtDNA contents were determined by quantitative real-time PCR as described in the Materials and Methods section. (C) L6 myotubes were treated with apolipoprotein a1 (20 μg/ml) for 24 h. Relative changes in PGC-1α, PPAR-α, NRF1, UCP2/3, and Tfam transcript levels were examined by quantitative real-time PCR. (D) After incubating with apolipoprotein a1 for 24 h, L6 myotubes were harvested and the cell lysates were analyzed with specific antibodies. Data represent one of three independent experiments. Values are means ± S.E.M of three independent experiments performed in triplicate. *p b 0.05 and **p b 0.01 versus untreated cells.

(Fig. 2A). As expected, mtDNA content was also up-regulated upon apolipoprotein a1 administration (Fig. 2B). Next, we measured transcript levels of the mitochondrial related genes in myotubes after 24 h of apolipoprotein a1 treatment. As a consequence, the expression of mitochondrial transcription factors and transcription co-regulators, such as nuclear respiratory factor 1 (NRF1), transcription factor A, mitochondrial (Tfam), and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), were augmented (Fig. 2C). Furthermore, apolipoprotein a1 significantly increased uncoupling protein (UCP2/3) and ATP synthase, which are important mitochondrial inner membrane components. Concomitant with the transcript level, protein expression of PGC-1α and NRF1 was also increased (Fig. 2D). Importantly, apolipoprotein a1 treatment did not induce cell proliferation (data not shown). Based on these data, we suggest that apolipoprotein a1 stimulates mitochondrial transcription regulators and induces mitochondrial biogenesis.

3.3. Apolipoprotein a1 stimulates AMPK pathway in the L6 myotubes AMPK has been suggested to regulate mitochondrial biogenesis [26, 27]. To confirm whether AMPK is associated with apolipoprotein a1 induced mitochondrial biogenesis, we investigated AMPK phosphorylation and in vitro kinase activity. Similar to myocytes (Supplementary Fig. 2), long term treatment with apolipoprotein a1 elevated the phosphorylation level of AMPK and downstream target acetyl-CoA carboxylase (ACC) in differentiated myotubes, while having no effect on total AMPK (Fig. 3A). Surprisingly, apolipoprotein a1 induced AMPK phosphorylation was sustained. Furthermore, AMPK activation was occurred in a concentration dependent manner (Fig. 3B). To further confirm AMPK activation, we performed a kinase assay with immunoprecipitated AMPK after apolipoprotein a1 treatment. In these experiments, we observed that apolipoprotein a1 significantly upregulated AMPK kinase activity (Fig. 3C). Collectively, these data

P. Song et al. / Cellular Signalling 27 (2015) 1873–1881

1877

A

B

C

Fig. 3. Apolipoprotein a1 stimulates AMPK pathway. (A) L6 myotubes were stimulated with apolipoprotein a1 (20 μg/ml) for varying amounts of time. (B) L6 myotubes were stimulated with an increasing concentration of apolipoprotein a1 for 24 h. The level of AMPK and ACC phosphorylation were quantified by densitometry, and were normalized to total AMPK and ACC respectively. (C) AMPK activity was measured by SAMS peptide phosphorylation assay using immunoprecipitated AMPK. Values are means ± S.E.M *p b 0.05 and **p b 0.01 versus untreated cells.

suggest that apolipoprotein a1 is able to induce sustained AMPK activation in skeletal muscle cells. 3.4. Inhibition of AMPK inhibits apolipoprotein a1 induced mitochondria biogenesis To examine the dependency of AMPK in apolipoprotein a1 induced mitochondrial biogenesis, we used a selective AMPK chemical inhibitor and dominant negative AMPK α2 virus, which was shown to be a major isoform in skeletal muscle. As shown Fig. 4A, apolipoprotein a1 induced AMPK activation was completely blocked by Compound C pre-treatment. As expected, transcript levels of NRF1 were largely attenuated by pretreatment with Compound C (Fig. 4B). Consequently, apolipoprotein a1 induced expression of NRF1 was inhibited by Compound C pretreatment (Fig. 4C). Similar to NRF1 results, induction of mitochondrial DNA was also prevented by AMPK inhibition (Fig. 4D). These results suggest that the AMPK pathway is involved in apolipoprotein a1 mediated mitochondrial biogenesis. To further confirm AMPK dependency, we used the dominant negative virus of AMPK. Similar to the results with Compound C, infection with dominant

negative AMPK α2 completely inhibited AMPK phosphorylation and mitochondrial biogenesis induced by apolipoprotein a1, when compared to control virus (Fig. 4E, F). These findings demonstrate that AMPK is a critical mediator of apolipoprotein a1 stimulated mitochondrial biogenesis in skeletal muscle. 3.5. Apolipoprotein a1 induced AMPK activation is SR-B1 dependent Next, we attempted to determine which kind of upstream molecules are involved in prolonged AMPK activation. Previous studies have suggested that Sirt1 is implicated in the AMPK signaling pathway and mitochondrial biogenesis. To evaluate whether Sirt1 mediates the effect of apolipoprotein a1 on AMPK activation, we used a Sirt1 inhibitor, NAM. However, there was no change in phosphorylation of AMPK with or without NAM (Supplementary Fig. 3). A number of studies have suggested that posttranslational modification affects LKB1 catalytic activity or its cellular localization [35]. As shown in Fig. 5A, apolipoprotein a1 increased LKB1 Ser-431 phosphorylation, which is largely regulated by various signaling proteins such as cAMP-dependent kinase (PKA), p90RSK, and extracellular-signal-regulated kinase (ERK).

1878

P. Song et al. / Cellular Signalling 27 (2015) 1873–1881

A

B

C

D

E

F

Fig. 4. Inhibition of AMPK blocks apolipoprotein a1 induced mitochondrial biogenesis. (A) L6 myotubes were stimulated with apolipoprotein a1 for 24 h with 3 μM of compound c. Cell lysates were analyzed by Western blotting with an anti-phospho-AMPK (Thr172) antibody. (B) Relative changes in NRF1 transcript levels and (C) protein levels were examined with or without Compound C. (D) Apolipoprotein a1 treatment was performed with or without Compound C. mtDNA contents were analyzed. (E) L6 myotubes were infected with either a mock or DN-AMPK α2 adenovirus for 48 h, and were treated with or without apolipoprotein a1. DN-AMPK α2 expression was confirmed using the anti-Myc antibody. (F) mtDNA was measured with either a mock or DN-AMPK α2 adenovirus. Values are means ± S.E.M of three independent experiments performed in triplicate. *p b 0.05 and **p b 0.01 compared between two groups, as indicated.

Two kinds of apolipoprotein a1 receptor, adenosine triphosphate-binding cassette (ABC) transporters ABCA1 and scavenger receptor Class B, type 1 (SR-B1) have been characterized [9]. We now wanted to verify which kind of upstream receptor was involved in the apolipoprotein a1induced AMPK activation. In silencing experiments, induction of AMPK phosphorylation and mtDNA contents were largely attenuated when cells were transfected with SR-B1 siRNA (Fig. 5B, C). Taken together, we demonstrate that SR-B1 is an important receptor in apolipoprotein a1 mediated AMPK activation.

3.6. Effect of apolipoprotein a1 on fatty acid oxidation Fatty acid oxidation is a major function of mitochondria. To determine whether apolipoprotein a1 can increase cellular fatty acid oxidation rates, we carried out a palmitate oxidation assay. Myotubes were treated with apolipoprotein a1 for 24 h and then exposed to [3H] labeled palmitate. Fatty acid oxidation was then determined by measuring the evaporated [3H] from the culture media. In these experiments, apolipoprotein a1 induced palmitate oxidation was significantly increased

P. Song et al. / Cellular Signalling 27 (2015) 1873–1881

A

1879

B

C

Fig. 5. Apolipoprotein a1 stimulates LKB1-AMPK pathway via SR-B1. (A) Time-dependent increases in LKB1 and AMPK phosphorylation by apolipoprotein a1. (B) L6 myotubes transfected with ABCA1 or SR-B1 specific siRNA were treated with apolipoprotein a1 for 24 h. The stimulation of AMPK pathway was determined by immunoblotting. Data represent one of three independent experiments. (C) Knock down effect of SR-B1 to mtDNA levels. Values are means ± S.E.M of triplicate experiments. *p b 0.05.

in a concentration and time dependent manner (Fig. 6 A, B). To further confirm the importance of mitochondrial biogenesis in apolipoprotein a1 mediated fatty acid oxidation, we utilized cycloheximide, which is widely used to inhibit protein synthesis. When cells were preincubated with cycloheximide before apolipoprotein a1 treatment, fatty acid oxidation was largely reduced (Fig. 6C). Thus, these results suggest that mitochondrial biogenesis is a critical point for apolipoprotein a1 to exert fatty acid oxidation. 4. Discussion In the present study, we found that apolipoprotein a1 augments mitochondrial contents by activating AMPK. Through a prolonged activation of AMPK, apolipoprotein a1 increases both nuclear respiratory factor 1 (NRF1) and mtDNA contents. Importantly, the prolonged activation of AMPK in skeletal muscle was mediated in a SR-B1/LKB1 dependent manner. Taken together, these findings suggest a novel function of apolipoprotein a1 in regulating mitochondrial biogenesis in skeletal muscle. In addition to cholesterol metabolism, the function of apolipoprotein a1 in TG metabolism has been investigated. Two kind of mutations in apolipoprotein a1 (ApoA-I[Δ(62–78)] and ApoA-I[Glu110Ala/ Glu111Ala]) have been shown to cause severe hypertriglyceridemia [10,11]. These studies suggested that decreased lipolysis by structural alterations may partly contribute to the increment of plasma TG levels.

Although regulation of lipolysis can be involved in triglyceride metabolism, apolipoprotein a1 induced mitochondrial biogenesis in skeletal muscle may be another mechanism for TG regulation. Mitochondrial β oxidation lowers the levels of systemic fatty acids, which are major precursors for triglyceride synthesis. Indeed, in our study, apolipoprotein a1 largely stimulated palmitate oxidation and attenuated FFA induced insulin resistance, which can be taken to represent a protective role against hypertriglyceridemia. It would be worth examining whether the specific mutations of apolipoprotein a1 affect AMPK activation and mitochondrial biogenesis. Although a previous study has shown that apolipoprotein a1 stimulates AMPK and exerts a beneficial effect on Type 2 diabetes through increasing glucose uptake [36], the working kinetics are different. Han et al. reported that apolipoprotein a1 induced AMPK phosphorylation is transient and returns to basal level after 5 min. When we consider the present results (Fig. 3A), the kinetics of apolipoprotein a1 induced AMPK activation seems to have a biphasic property. Among AMPK activators, it is also easy to find such biphasic activation. Leptin, the most well-known adipose derived ligand modulates energy homeostasis, including fatty acid oxidation and appetite regulation [37]. Importantly, previous studies demonstrated that leptin produced a biphasic stimulation of AMPK, with the early phase rise at around 15 min and late phase activation between 6 and 24 h [38,39]. Another case shows that AMPK activation by statin is also biphasic [40]. When we consider the above studies, the duration of AMPK activation is prolonged at the

1880

P. Song et al. / Cellular Signalling 27 (2015) 1873–1881

A

B

C

Fig. 6. Increase of fatty acid oxidation in response to apolipoprotein a1. (A) Myotubes were incubated in a 6 well plate for the indicated time with vehicle, apolipoprotein a1 (20 μg/ml), or AICAR (500 μM), and were then assayed for oxidation of [3H] palmitate, as described in the Materials and Methods section. (B) Concentration dependent palmitate oxidation. (C) Relative changes in palmitate oxidation with cycloheximide. Values are means ± S.E.M of three independent experiments performed in triplicate. *p b 0.05 and **p b 0.01 compared between two groups, as indicated.

second stage, similar to apolipoprotein a1 induced AMPK activation. It is not clear why this kind of biphasic features exists among AMPK activators. One possibility is that apolipoprotein a1 increases the synthesis and secretion of some ligands, which can further activate AMPK. However, there is no difference in AMPK activation after media change to remove potentially secreted ligands (data not shown). Another possibility is the modulation of upstream regulators. Adiponectin treatment for 48 h increased AMPK activity and mitochondrial bioenergetics in skeletal muscle [28]. In these processes, the phosphorylation of upstream kinase – LKB1 was significantly enhanced. Conversely, tumor necrosis factor (TNF alpha) suppressed AMPK activity via transcriptional up-regulation of protein phosphatase 2C (PP2C) [41]. Although the underlying mechanism for the prolonged activation of AMPK requires further study, we suspect that exposure to apolipoprotein a1 leads to changes in intracellular components, which can contribute to the prolonged activation of LKB1 and AMPK. The increased expression of PGC-1α is highly correlated with mitochondrial biogenesis. Many reports have demonstrated that physical exercise or fasting resulted in significant increases in transcripts and protein levels of PGC-1α, consistent with the up-regulation of mitochondrial proteins [42,43]. Interestingly, the plasma concentration of apolipoprotein a1 is also dynamically regulated by energy status. According to our data, mRNA levels of apolipoprotein a1 are significantly suppressed in leptin-deficient (ob/ob) mice (Supplementary Fig. 4). Williams et al. reported that endurance physical exercise leads to an increase in HDL cholesterol and apolipoprotein a1 concentration in overweight men [44]. Furthermore, public microarray data (GEO DataStes:GDS3135) have indicated that transcript levels of apolipoprotein a1 are significantly increased in the liver after 24 h fasting, which is

major source of apolipoprotein a1, but not in brown (BATs) and white adipose tissues (WATs) (p value = 0.020168). Recently, one group reported that HDL and apolipoprotein a1 directly increases cellular respiration in C2C12 myoblasts [45]. Thus, it would be reasonable to assume that the apolipoprotein a1-AMPK pathway is also an important mediator of exercise or fasting induced mitochondrial biogenesis in vivo. In summary, we show that apolipoprotein a1 improves mitochondrial biogenesis and attenuates FFA induced insulin resistance in skeletal muscle. Because the underlying mechanisms for upstream signaling pathway are still unclear, future studies should be necessary to clarify the molecular events between SR-B1 and LKB1. It will be also interesting to determine whether the apolipoprotein a1 functions to other metabolic tissues such as adipose tissue or liver in terms of mitochondrial biogenesis based on current observation, which may have interesting implications for the treatment of Type 2 diabetes. 5. Conclusion In the present study, our results indicate that apolipoprotein a1 play a role in mitochondrial biogenesis by activating AMPK. Our findings suggest a new mechanism whereby apolipoprotein a1 increases the mitochondrial content, which may have interesting implications for the treatment of Type 2 diabetes. Conflicts of interest Nothing to declare.

P. Song et al. / Cellular Signalling 27 (2015) 1873–1881

Author contributions Conceived and designed the experiments: PS KY. Performed the experiments: PS YK H-YM. Analyzed the data: PS JHY JG P-OB P-GS. Contributed reagents/materials/analysis tools: HH DK AK. Wrote the paper: PS SHR. Acknowledgements This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MEST) (No. 2013R1A2A1A03010110). Appendix A. Supplementary data

[18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30]

Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.cellsig.2015.05.003.

[31]

References

[32]

[1] K.M. Wasan, D.R. Brocks, S.D. Lee, K. Sachs-Barrable, S.J. Thornton, Nat. Rev. Drug Discov. 7 (2008) 84–99. [2] P. Linsel-Nitschke, A.R. Tall, Nat. Rev. Drug Discov. 4 (2005) 193–205. [3] A.R. Tall, L. Yvan-Charvet, N. Terasaka, T. Pagler, N. Wang, Cell Metab. 7 (2008) 365–375. [4] G. Favre, E. Blancy, J.F. Tournier, G. Soula, Biochim. Biophys. Acta 1013 (1989) 118–124. [5] M. Sugano, K. Tsuchida, N. Makino, Biochem. Biophys. Res. Commun. 272 (2000) 872–876. [6] G.W. Cockerill, T.Y. Huehns, A. Weerasinghe, C. Stocker, P.G. Lerch, N.E. Miller, D.O. Haskard, Circulation 103 (2001) 108–112. [7] S.H. Park, J.H. Park, J.S. Kang, Y.H. Kang, Int. J. Biochem. Cell Biol. 35 (2003) 168–182. [8] K.A. Rye, C.A. Bursill, G. Lambert, F. Tabet, P.J. Barter, J. Lipid Res. 50 (Suppl.) (2009) S195–S200. [9] C. Mineo, P.W. Shaul, J. Lipid Res. (2013)http://dx.doi.org/10.1194/jlr.R039479. [10] A. Chroni, H.Y. Kan, K.E. Kypreos, I.N. Gorshkova, A. Shkodrani, V.I. Zannis, Biochemistry 43 (2004) 10442–10457. [11] A. Chroni, H.Y. Kan, A. Shkodrani, T. Liu, V.I. Zannis, Biochemistry 44 (2005) 4108–4117. [12] M.B. Hock, A. Kralli, Annu. Rev. Physiol. 71 (2009) 177–203. [13] D.E. Kelley, J. He, E.V. Menshikova, V.B. Ritov, Diabetes 51 (2002) 2944–2950. [14] B.B. Lowell, G.I. Shulman, Science 307 (2005) 384–387. [15] W.I. Sivitz, M.A. Yorek, Antioxid. Redox Signal. 12 (2010) 537–577. [16] R.M. Reznick, G.I. Shulman, J. Physiol. 574 (2006) 33–39. [17] M.E. Patti, A.J. Butte, S. Crunkhorn, K. Cusi, R. Berria, S. Kashyap, Y. Miyazaki, I. Kohane, M. Costello, R. Saccone, E.J. Landaker, A.B. Goldfine, E. Mun, R. DeFronzo,

[33] [34] [35] [36] [37] [38] [39] [40] [41]

[42] [43] [44] [45]

1881

J. Finlayson, C.R. Kahn, L.J. Mandarino, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 8466–8471. B. Ramachandran, G. Yu, T. Gulick, J. Biol. Chem. 283 (2008) 11935–11946. R.C. Scarpulla, Physiol. Rev. 88 (2008) 611–638. C.A. Virbasius, J.V. Virbasius, R.C. Scarpulla, Genes Dev. 7 (1993) 2431–2445. U. Andersson, R.C. Scarpulla, Mol. Cell. Biol. 21 (2001) 3738–3749. J.M. Huss, R.P. Kopp, D.P. Kelly, J. Biol. Chem. 277 (2002) 40265–40274. S.N. Schreiber, R. Emter, M.B. Hock, D. Knutti, J. Cardenas, M. Podvinec, E.J. Oakeley, A. Kralli, Proc. Natl. Acad. Sci. U. S. A. 101 (2004) 6472–6477. A.E. Wallberg, S. Yamamura, S. Malik, B.M. Spiegelman, R.G. Roeder, Mol. Cell 12 (2003) 1137–1149. D.G. Hardie, Nat. Rev. Mol. Cell Biol. 8 (2007) 774–785. K.S. Rockl, C.A. Witczak, L.J. Goodyear, IUBMB Life 60 (2008) 145–153. S. Jager, C. Handschin, J. St-Pierre, B.M. Spiegelman, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 12017–12022. A.E. Civitarese, B. Ukropcova, S. Carling, M. Hulver, R.A. DeFronzo, L. Mandarino, E. Ravussin, S.R. Smith, Cell Metab. 4 (2006) 75–87. M.J. Yoon, G.Y. Lee, J.J. Chung, Y.H. Ahn, S.H. Hong, J.B. Kim, Diabetes 55 (2006) 2562–2570. R. Bergeron, J.M. Ren, K.S. Cadman, I.K. Moore, P. Perret, M. Pypaert, L.H. Young, C.F. Semenkovich, G.I. Shulman, Am. J. Physiol. Endocrinol. Metab. 281 (2001) E1340–E1346. H. Zong, J.M. Ren, L.H. Young, M. Pypaert, J. Mu, M.J. Birnbaum, G.I. Shulman, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 15983–15987. M. Lee, J.T. Hwang, H.J. Lee, S.N. Jung, I. Kang, S.G. Chi, S.S. Kim, J. Ha, J. Biol. Chem. 278 (2003) 39653–39661. X. Ruan, Z. Li, Y. Zhang, L. Yang, Y. Pan, Z. Wang, G.S. Feng, Y. Chen, J. Cell. Mol. Med. 15 (2011) 763–772. J. Hoeks, P. Schrauwen, Trends Endocrinol. Metab. 23 (2012) 444–450. S.E. Korsse, M.P. Peppelenbosch, W. van Veelen, Biochim. Biophys. Acta 1835 (2013) 194–210. R. Han, R. Lai, Q. Ding, Z. Wang, X. Luo, Y. Zhang, G. Cui, J. He, W. Liu, Y. Chen, Diabetologia 50 (2007) 1960–1968. M.W. Schwartz, S.C. Woods, D. Porte Jr., R.J. Seeley, D.G. Baskin, Nature 404 (2000) 661–671. Y. Minokoshi, Y.B. Kim, O.D. Peroni, L.G. Fryer, C. Muller, D. Carling, B.B. Kahn, Nature 415 (2002) 339–343. A. Suzuki, S. Okamoto, S. Lee, K. Saito, T. Shiuchi, Y. Minokoshi, Mol. Cell. Biol. 27 (2007) 4317–4327. H.C. Choi, P. Song, Z. Xie, Y. Wu, J. Xu, M. Zhang, Y. Dong, S. Wang, K. Lau, M.H. Zou, J. Biol. Chem. 283 (2008) 20186–20197. G.R. Steinberg, B.J. Michell, B.J. van Denderen, M.J. Watt, A.L. Carey, B.C. Fam, S. Andrikopoulos, J. Proietto, C.Z. Gorgun, D. Carling, G.S. Hotamisligil, M.A. Febbraio, T.W. Kay, B.E. Kemp, Cell Metab. 4 (2006) 465–474. K. Baar, A.R. Wende, T.E. Jones, M. Marison, L.A. Nolte, M. Chen, D.P. Kelly, J.O. Holloszy, FASEB J. 16 (2002) 1879–1886. C.T. Teng, Y. Li, P. Stockton, J. Foley, PLoS One 6 (2011) e26961. P.T. Williams, R.M. Krauss, K.M. Vranizan, P.D. Wood, Circulation 81 (1990) 1293–1304. M. Lehti, E. Donelan, W. Abplanalp, O. Al-Massadi, K.M. Habegger, et al., Circulation 128 (2013) 2364–2371.