Antimicrobial Activity of Fosfomycin-Tobramycin Combination against Pseudomonas aeruginosa Isolates Assessed by Time-Kill Assays and Mutant Prevention Concentrations María Díez-Aguilar,a,b María Isabel Morosini,a,b Ana P. Tedim,a,c,d Irene Rodríguez,a,c Zerrin Aktas¸,e Rafael Cantóna,b,d Servicio de Microbiología, Hospital Universitario Ramón y Cajal, Instituto Ramón y Cajal de Investigación Sanitaria (IRYCIS), Madrid, Spaina; Red Española de Investigación en Patología Infecciosa (REIPI), Instituto de Salud Carlos III, Madrid, Spainb; CIBER en Epidemiología y Salud Pública (CIBERESP), Instituto de Salud Carlos III, Madrid, Spainc; Unidad de Resistencia a Antibióticos y Virulencia Bacteriana asociada al Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spaind; Department of Clinical Microbiology, Istanbul Medical Faculty, Istanbul University, Istanbul, Turkey.e
The antibacterial activity of fosfomycin-tobramycin combination was studied by time-kill assay in eight Pseudomonas aeruginosa clinical isolates belonging to the fosfomycin wild-type population (MIC ⴝ 64 g/ml) but with different tobramycin susceptibilities (MIC range, 1 to 64 g/ml). The mutant prevention concentration (MPC) and mutant selection window (MSW) were determined in five of these strains (tobramycin MIC range, 1 to 64 g/ml) in aerobic and anaerobic conditions simulating environments that are present in biofilm-mediated infections. Fosfomycin-tobramycin was synergistic and bactericidal for the isolates with mutations in the mexZ repressor gene, with a tobramycin MIC of 4 g/ml. This effect was not observed in strains displaying tobramycin MICs of 1 to 2 g/ml due to the strong bactericidal effect of tobramycin alone. Fosfomycin presented higher MPC values (range, 2,048 to >2,048 g/ml) in aerobic and anaerobic conditions than did tobramycin (range, 16 to 256 g/ml). Interestingly, the association rendered narrow or even null MSWs in the two conditions. However, for isolates with high-level tobramycin resistance that harbored aminoglycoside nucleotidyltransferases, time-kill assays showed no synergy, with wide MSWs in the two environments. glpT gene mutations responsible for fosfomycin resistance in P. aeruginosa were determined in fosfomycin-susceptible wild-type strains and mutant derivatives recovered from MPC studies. All mutant derivatives had changes in the GlpT amino acid sequence, which resulted in a truncated permease responsible for fosfomycin resistance. These results suggest that fosfomycin-tobramycin can be an alternative for infections due to P. aeruginosa since it has demonstrated synergistic and bactericidal activity in susceptible isolates and those with low-level tobramycin resistance. It also prevents the emergence of resistant mutants in either aerobic or anaerobic environments.
P
seudomonas aeruginosa is an opportunistic pathogen responsible for a wide variety of infections. Its high intrinsic and acquired antimicrobial resistance combined with the ability to produce biofilms makes the treatment of these infections a critical challenge (1, 2). Patients with underlying conditions such as cystic fibrosis, obstructive pulmonary disease, and bronchiectasis are particularly vulnerable and usually develop chronic infections. Due to the paucity of new compounds, therapeutic strategies in these situations are based on antimicrobial combinations of already existing antibiotics trying to obtain a synergistic effect (3–5). Fosfomycin shows no cross-resistance with other antimicrobials, and data suggest that its association with other antipseudomonal agents, such as tobramycin, may be an option for the treatment of infections caused by this pathogen (6, 7). Fosfomycin inhibits bacterial cell wall biosynthesis by inactivating the UDP-N-acetylglucosamine-3-o-enolpyruvultransferase. In the case of P. aeruginosa, this compound exclusively enters into bacterial cells through the glycerol-3-phosphate nutrient transporter (GlpT) (8). The GlpT protein is an antiporter that belongs to the major facilitator superfamily and consists of 12 transmembrane ␣-helices (H1 to H12) with two domains each containing a six-helix bundle and connected by a long central loop. It transports across the inner membrane an inorganic phosphate molecule outside the cell, subsequently driving the transport of one molecule of glycerol-3phosphate into the cell, in both cases against their correspondent concentration gradients (9). Molecular mechanisms implicated in
October 2015 Volume 59 Number 10
the inactivation of this permease and consequently in fosfomycin resistance are not widely studied. However, a fosfomycin and tobramycin combination has been demonstrated to be beneficial, since fosfomycin enhances the active uptake of tobramycin into P. aeruginosa, resulting in greater inhibition of protein synthesis, enhanced bacterial killing, and a lower frequency of resistance development (10). The objectives of this work were to study the in vitro activity of a fosfomycin and tobramycin combination against P. aeruginosa clinical isolates by time-kill assays and to determine the mutant prevention concentration (MPC) and the mutant selection win-
Received 7 April 2015 Returned for modification 17 May 2015 Accepted 12 July 2015 Accepted manuscript posted online 20 July 2015 Citation Díez-Aguilar M, Morosini MI, Tedim AP, Rodríguez I, Aktas¸ Z, Cantón R. 2015. Antimicrobial activity of fosfomycin-tobramycin combination against Pseudomonas aeruginosa isolates assessed by time-kill assays and mutant prevention concentrations. Antimicrob Agents Chemother 59:6039 –6045. doi:10.1128/AAC.00822-15. Address correspondence to María Isabel Morosini, [email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /AAC.00822-15. Copyright © 2015, American Society for Microbiology. All Rights Reserved. doi:10.1128/AAC.00822-15
Antimicrobial Agents and Chemotherapy
aac.asm.org
6039
Díez-Aguilar et al.
dow (MSW) values of these antimicrobials alone and in combination. Moreover, MPCs were also determined under conditions simulating microaerobic or anaerobic environments that are present in biofilm-mediated infections. In addition, glpT gene mutations responsible for fosfomycin resistance in P. aeruginosa were determined. MATERIALS AND METHODS MIC testing. MICs of fosfomycin (Laboratorios Ern, S.A., Barcelona, Spain), tobramycin (Sigma-Aldrich Chemical Co., St. Louis, MO), and a fosfomycin-tobramycin combination were determined by the agar dilution method (BBL Mueller-Hinton II cation-adjusted broth and agar; BD, Sparks, MD) for eight genetically unrelated P. aeruginosa clinical isolates (Pa1 to Pa8). Pa4 (nonmucoid) and Pa5 (mucoid) were isolated from the sputum of two cystic fibrosis patients, while the rest of the strains were recovered from a previously published collection that included isolates causing bacteremia and nosocomial pneumonia (11). Anaerobic susceptibility testing was also performed by the agar dilution method by supplementing medium with 1% KNO3 (wt/vol) (Sigma-Aldrich Chemical Co.). Anaerobic conditions of incubation were generated by a GasPak EZ anaerobe container system (BD). The European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoint for tobramycin (susceptible [S], ⱕ4 g/ml; resistant [R], ⬎4 g/ml) and the epidemiological cutoff (ECOFF) value for fosfomycin (128 g/ml) were applied (12). Time-kill assays. Time-kill assays (Fig. 1) were performed in the eight P. aeruginosa isolates (Pa1 to Pa8), all of them having a fosfomycin MIC of 64 g/ml, representing the modal MIC value for this compound reported by EUCAST for this organism. However, they differed in tobramycin susceptibilities: five isolates were susceptible (MIC range, 1 to 4 g/ml) (Pa1 to Pa5) and three isolates were resistant (MIC range, 32 to 64 g/ml) (Pa6 to Pa8). Time-kill assays (initial inoculum of 105 to 106 CFU/ml) were performed with fosfomycin and tobramycin alone as well as in combination. Corresponding fosfomycin and tobramycin maximum concentrations of drug in serum (Cmax), 90 g/ml and 10 g/ml, respectively, were used in all experiments (13, 14). In vitro activity was assessed at 1, 2, 4, 6, 8, 12, and 24 h (Fig. 1). The reduction of the original inoculum by ⱖ3 log10 CFU/ml was considered bactericidal, and a reduction of ⱖ2 log10 CFU/ml by the antibiotic combination compared with that of the most active compound was defined as synergism. Indifference was defined as a ⬍2 log10 reduction with the combination compared with that obtained with the most active single agent. Antagonism was defined as a ⱖ2 log10 increase in viable count when using the combination compared with that obtained with the most active drug alone (15). Estimation of the mutant prevention concentration. Fosfomycin, tobramycin, and fosfomycin-tobramycin combination MPCs were calculated for three tobramycin-susceptible (Pa2, MIC ⫽ 2 g/ml; Pa4, MIC ⫽ 4 g/ml; Pa5, MIC ⫽ 4 g/ml) and two tobramycin-resistant (Pa7, MIC ⫽ 64 g/ml; Pa8, MIC ⫽ 32 g/ml) isolates. MPCs were determined in aerobic and anaerobic conditions (16). Briefly, an initial inoculum of approximately 1010 CFU/ml was placed onto Mueller-Hinton agar plates with twofold-increasing fosfomycin concentrations (16 to 2,048 g/ml) and tobramycin concentrations (0.5 to 512 g/ml) and with the fosfomycin-tobramycin combination. A variable fosfomycin concentration (8 to 256 g/ml) and different fixed tobramycin concentrations (0.5 to 64 g/ml) were used to test the combination. Plates were incubated for 48 h at 37°C. MPC was defined as the lowest antibiotic concentration that prevented the visible growth of mutant colonies (17). MICs for the mutants recovered from the highest fosfomycin, tobramycin, and fosfomycin-tobramycin concentration plates were retested by Etest (bio Mérieux, France) after serial passages in agar plates that did not contain antibiotics. The MSW for the fosfomycin-tobramycin combination was determined by graphing the fosfomycin-tobramycin MICs and fosfomycin-tobramycin MPCs resulting from each tobramycin and fosfomycin concentration (Fig. 2). Putatively hypermutable P. aeruginosa among the tested strains was
6040
aac.asm.org
screened by the disk diffusion method through observation of resistant mutant subpopulations within the inhibition zones of the following antibiotics: ceftazidime, imipenem, meropenem, ciprofloxacin, and tobramycin (18). PAO1 and PAOmutS were used as strain controls. Characterization of tobramycin resistance mechanisms. Tobramycin resistance mechanisms were first phenotypically characterized by the disk diffusion method with gentamicin, tobramycin, netilmicin, amikacin, and ciprofloxacin. Following phenotypic results, confirmation of resistance mechanisms was subsequently performed by amplification and sequencing of the aminoglycoside-2-O-nucleotidyltransferase [ANT(2)-I] enzyme with ant(2⬙)-Ia-F (ACACAACGCAGGTCACA) as the forward primer and ant(2⬙)-Ia-R (CATGCGAGCCTGTAGGA) as the reverse primer (19). mexZ and the mexX-mexZ intergenic region were amplified and sequenced with primers MexZ1026 (CAGCGTGGAGATC GAAGGCAGCCGG) and MexZ2060 (CCAGCAGGAATAGGGCGACC AGGGC) (20). The sequence was compared with that reported by Aires et al. (21). Molecular bases of fosfomycin resistance and hypothetical GlpT protein structure. Fosfomycin-resistant mutants generated from the P. aeruginosa isolates tested in the MPC studies (Pa2M, Pa4M, Pa5M, Pa7M, and Pa8M), as well as their parental strains (Pa2, Pa4, Pa5, Pa7, and Pa8), were subjected to further analysis to determine possible mutations or other genetic changes implicated in fosfomycin resistance. Additionally, six other genetically unrelated P. aeruginosa clinical isolates (Pa9 to Pa14) from the same collection (11), with different fosfomycin MICs (32 to 1,024 g/ml), were subjected to screening of possible mutations with the aim of comparing them with those of fosfomycin-resistant mutants obtained in this study (Table 2). The glpT gene was amplified and sequenced by PCR using glpT-F(5=-AGCGGAGCTCGCGATGTTC-3=) and glpT-R (5=-TCAGCCGGCTTGCTGCGG-3=) as the forward and reverse primers, respectively (8). glpTw-F (5=-TGCTCTGCGGCTGGCTGTCGG-3=) and glpTw-R (5=-AATGAACATCACCGCCGCC-3=) were used in primer walking and were designed in our laboratory. P. aeruginosa ATCC 27853 and PAO1 strains were used as controls. Nucleotide and amino acid sequences were analyzed with the sequence analysis software Clone Manager 9 (Scientific and Educational Software). Homology searches were done using BLAST search algorithms (http://blast.ncbi.nlm.nih.gov/Blast .cgi). The hypothetical three-dimensional structure of the GlpT protein of the PAO1 strain was compared with that of the GlpT transporter of the fosfomycin-resistant mutants obtained in this study using the SwissModel tool (http://swissmodel.expasy.org/) in the ExPASy Bioinformatics resource portal (see Fig. S1 in the supplemental material).
RESULTS
Time-kill assays. Fosfomycin exhibited a bacteriostatic activity, with a 0.2 to 2.15 log10 CFU/ml inoculum reduction in the first 8 h, against the eight isolates tested; at 12 to 24 h, regrowth was observed in all the cases when this antimicrobial was used alone. For Pa1 (tobramycin MIC, 2 g/ml), Pa2 (tobramycin MIC, 2 g/ml), and Pa3 (tobramycin MIC, 1 g/ml), tobramycin alone exhibited a bactericidal effect in the first 4 h, and all of these isolates experienced a complete inhibition of growth (no colony count). The fosfomycin-tobramycin combination was indifferent in these three isolates. However, for Pa4, a tobramycin-susceptible isolate (MIC ⫽ 4 g/ml), tobramycin alone presented a bacteriostatic profile, with a 2.1 log10 CFU/ml inoculum reduction at 12 h but with regrowth at 24 h. In this isolate, the fosfomycin-tobramycin combination was synergistic and bactericidal, with a ⬎3 log10 CFU/ml inoculum reduction in the first 4 h and a complete inhibition of growth at 6 h, maintained until the end of the curve. For Pa5 (MIC ⫽ 4 g/ml), tobramycin was bactericidal at 8 h while the fosfomycin-tobramycin combination was synergistic and bactericidal, with a complete inhibition of growth at 4 h.
Antimicrobial Agents and Chemotherapy
October 2015 Volume 59 Number 10
Fosfomycin-Tobramycin Combination against P. aeruginosa
FIG 1 Time-kill assays for P. aeruginosa isolates with tobramycin (TOB), fosfomycin (FOS), and fosfomycin-tobramycin combination.
Tobramycin-resistant isolates (tobramycin MICs of 64 g/ml for Pa6 and Pa7 and 32 g/ml for Pa8) displayed no inoculum reduction and a marked regrowth when tobramycin was used alone. In Pa7, fosfomycin-tobramycin exhibited a bacteriostatic
October 2015 Volume 59 Number 10
profile at 8 h but did not reduce the initial inoculum at 24 h. For the other two tobramycin-resistant isolates, the fosfomycin-tobramycin combination was indifferent and did not impede regrowth. Antagonism was not observed in any case.
Antimicrobial Agents and Chemotherapy
aac.asm.org
6041
Díez-Aguilar et al.
FIG 2 MPCs and MICs for fosfomycin-tobramycin (FOS-TOB) combination in aerobiosis (AE) and anaerobiosis (ANA).
Estimation of the MPC. The fosfomycin and tobramycin MIC and MPC results determined in aerobiosis and anaerobiosis are shown in Table 1. For all of the strains, the fosfomycin MIC in the two environments was 64 g/ml. Fosfomycin MPCs went up to ⬎2,048 g/ml in the aerobic and to 2,048 g/ml in the anaerobic environment, respectively. In the three tobramycin-susceptible isolates, tobramycin MICs in anaerobiosis went up to resis-
tance levels (Pa2, MIC ⫽ 8 g/ml; Pa4, MIC ⫽ 64 g/ml; Pa5, MIC ⫽ 32 g/ml). Tobramycin MPCs were two- to threefolddilutions higher in anaerobiosis than in aerobiosis. For the two tobramycin-resistant isolates, the MIC and MPC values in anaerobiosis were ⬎512 g/ml. For the fosfomycin-tobramycin combination, the MIC and MPC values in aerobiosis and anaerobiosis, as well as the MSWs for the different fosfomycin and tobramycin
TABLE 1 Fosfomycin and tobramycin MICs and MPCs in aerobiosis and anaerobiosis Fosfomycin MIC (g/ml)
Fosfomycin MPC (g/ml)
Tobramycin MIC (g/ml)
Tobramycin MPC (g/ml)
Isolate
Aerobiosis
Anaerobiosis
Aerobiosis
Anaerobiosis
Aerobiosis
Anaerobiosis
Aerobiosis
Anaerobiosis
Pa2 Pa4 Pa5 Pa7 Pa8
64 64 64 64 64
64 64 64 64 64
⬎2,048 ⬎2,048 ⬎2,048 ⬎2,048 ⬎2,048
2,048 2,048 2,048 2,048 2,048
2 4 4 64 32
8 64 32 ⬎512 ⬎512
16 32 32 ⬎512 ⬎512
64 256 256 ⬎512 ⬎512
6042
aac.asm.org
Antimicrobial Agents and Chemotherapy
October 2015 Volume 59 Number 10
Fosfomycin-Tobramycin Combination against P. aeruginosa
TABLE 2 Analysis of glpT sequence of parental strains, mutant derivatives, and isolates Pa9 to Pa14 Parental strain or mutant derivative
glpT sequence
Fosfomycin MIC (g/ml)
Pa2 Pa2M Pa4 Pa4M Pa5 Pa5M Pa7 Pa7M Pa8 Pa8M Pa9 Pa10 Pa11 Pa12 Pa13 Pa14
No mutation C681 deletion (1-bp frameshift), stop TGA987 No mutation G to A; G358 (G1072GC)¡S (A1072GC) No mutation C398 insertion (1-bp frameshift), stop TGA514 No mutation G211CCATC216 deletion (6-bp frameshift), ⌬ A71-I72 No mutation G355insertion (1-bp frameshift), stop TAA390 No mutation No mutation No mutation No mutation G to A; A121(G361CC)¡T(ACC) A to C; T211 (A631CC)¡P (CCC)
64 ⬎1,024 64 ⬎1,024 64 ⬎1,024 64 ⬎1,024 64 ⬎1,024 32 128 128 128 512 1,024
concentrations used in combination, are shown in Fig. 2. In tobramycin-resistant isolates (Pa7 and Pa8), the MSWs exhibited a wide range of values and even high fosfomycin and tobramycin concentrations did not reduce this window. However, for tobramycin-susceptible isolates (Pa2, Pa4, and Pa5), MSWs were very narrow, almost disappearing in the two environments. A hypermutable phenotype was not detected in any strain. Characterization of tobramycin resistance mechanisms. The susceptibility profiles of Pa4 and Pa5 (cystic fibrosis isolates) to the panel of aminoglycosides and fluoroquinolones were consistent with hyperexpression of the MexXY-OprM efflux system, as they showed low-level resistance to gentamicin, tobramycin, netilmicin, amikacin, and ciprofloxacin (22). The overproduction of this pump resulted from a mutation in the repressor gene mexZ, confirmed by amplification and sequencing of this gene. A deletion of a guanine (G) at position 72 resulted in a frameshift in the coding sequence that was found in the two strains. The alteration in this repressor may explain the overproduction of the efflux system and consequently the low-level tobramycin resistance. In fact, MexXY is primarily implicated in panaminoglycoside resistance in clinical cystic fibrosis isolates (23). No mutations were detected in the mexZ-mexX intergenic region of any of the sequenced isolates. For the isolates with high-level tobramycin resistance (Pa6, Pa7, and Pa8), the susceptibility profiles corresponded to the presence of an aminoglycoside nucleotidyltransferase (2=)-I enzyme (22), which confers high-level resistance to gentamicin and tobramycin, with susceptibility to netilmicin and amikacin. This enzyme was confirmed by PCR and sequencing. Molecular bases of fosfomycin resistance and hypothetical GlpT protein structure. The glpT genes of all original strains and of their corresponding fosfomycin mutant derivatives were sequenced and compared. Results demonstrated that all the strains with an MIC equal to or below the ECOFF (128 g/ml) had no codifying mutations. However, mutant derivatives and originally resistant isolates contained mutations in the glpT sequence (Table 2). Three of these mutants (Pa2M, Pa5M, and Pa8M) had frameshifts that resulted in premature stop codons, while Pa7M presented deletions that conferred the loss of various amino acids of the protein. Pa4M and the two originally resistant isolates (Pa13
October 2015 Volume 59 Number 10
and Pa14) had point mutations in their nucleotide sequence that conferred an amino acid substitution in the corresponding proteins. Mutations in the glpT gene sequence that resulted in premature codon stop in fosfomycin-resistant mutants Pa2M, Pa5M, and Pa8M led to an incomplete truncated protein. The stop codon in Pa2M at amino acid position 328 is located in H9, which resulted in the loss of 3 ␣-helices. The stop codon in Pa5M at position 171 is located in H5 and resulted in the loss of 7 ␣-helices. The stop codon in Pa8M at position 129 is located in H4, which resulted in the loss of 8 ␣-helices. The loss of two amino acids in Pa7M created a distortion in H2 that is involved in the pore formation. The amino acid substitution in Pa4M is located in the central helix H10 (24) (see Fig. S1 in the supplemental material). Additionally, silent mutations were found in all the strains. Polymorphisms detected in glpT sequences are summarized in Table S1 in the supplemental material. The glpT gene sequence of the wild-type strain PAO1 was used for comparison purposes (25). DISCUSSION
A strategy to prevent the development of resistance and to improve infection treatments is the use of antimicrobial combinations. In vitro evaluation of fosfomycin-tobramycin through timekill assays and MPCs against P. aeruginosa has demonstrated that this combination in tobramycin- and fosfomycin-susceptible isolates not only enhances bacterial killing but also prevents the selection of fosfomycin-resistant mutants. P. aeruginosa is a versatile organism capable of growing in anaerobic environments in the presence of the alternative electron acceptors NO3⫺, NO2⫺, or arginine (26). Since the course of some infections, such as biofilm-mediated ones, develop in microaerobic environments or in completely anaerobic conditions, such as cystic fibrosis chronic infections (26, 27), the development of resistant mutants was tested also in anaerobiosis. It is known that aminoglycosides are less active in anaerobiosis because their penetration into bacterial cells depends on an oxygen-dependent reaction (28). This fact reinforces the need to administer tobramycin in combination with other compounds. Fosfomycin has demonstrated that it can enhance the active transport of tobramy-
Antimicrobial Agents and Chemotherapy
aac.asm.org
6043
Díez-Aguilar et al.
cin into the cell (10); furthermore, its activity does not decrease in anaerobiosis, and some studies have reported high activity under these conditions (16). It has also been reported that fosfomycintobramycin association is advantageous in anaerobiosis, as it downregulates the expression of nitrate reductase genes that are essential for the growth of P. aeruginosa (28). As has been previously described, fosfomycin-tobramycin combination is capable of eradicating P. aeruginosa biofilm growth on cystic fibrosis-derived airway cells (6) and of improving the therapeutic effect in a biofilm-infected animal model (29). This approach also may be beneficial considering that fosfomycin has a protective action against the potential nephrotoxicity of aminoglycosides (30). Furthermore, decreased administration of tobramycin during treatment with a fosfomycin-tobramycin combination may decrease the negative side effects of the aminoglycoside. For tobramycin-susceptible isolates, the fosfomycin-tobramycin combination was synergistic and bactericidal for the cystic fibrosis isolates, with a tobramycin MIC of 4 g/ml. In one of these strains, tobramycin alone was not bactericidal. This may be explained by the fact that tobramycin is a concentration-dependent antimicrobial and the MIC for this isolate was close to the susceptibility breakpoint value. Alteration of the MexXY efflux system was implicated in low-level aminoglycoside resistance in the two isolates, with mexZ the most commonly mutated gene in cystic fibrosis strains (23, 31). Fosfomycin-tobramycin synergy may be related to the type of tobramycin resistance mechanism involved. MexXY-OprM alteration is implicated in aminoglycoside expulsion attributed to the increase in the drug efflux, and although fosfomycin is not inhibiting this efflux, it causes a rapid accumulation inside the cell by inducing the active uptake (10). Thus, this potentiation in tobramycin accumulation may lead to the achievement of a sufficient concentration for bactericidal effect in spite of the efflux hyperproduction. A synergistic effect with fosfomycin-tobramycin may not be appreciated in strains with a tobramycin MIC of 1 to 2 g/ml due to the strong bactericidal effect of this antimicrobial alone. Nevertheless, MIC results obtained in anaerobiosis and MPC results support the use of the combination for susceptible strains. Tobramycin-susceptible isolates became resistant in anaerobic conditions. Indeed, tobramycin or fosfomycin alone did not prevent the appearance of resistant mutants in aerobiosis or anaerobiosis with very high MPC values, especially for fosfomycin. These results reinforce the idea that these antibiotics must not be used in monotherapy. In contrast, a fosfomycin-tobramycin combination rendered narrow or even null MSWs in aerobic and anaerobic conditions. Therefore, the potential selection of resistant mutants during therapy with a fosfomycin-tobramycin combination in susceptible isolates is unlikely. In line with this observation, it has been observed that the combination of fosfomycin with tobramycin makes the generation of mutants resistant to the two antibiotics very difficult, even in a hypermutable background (32). When isolates with high-level tobramycin resistance harboring aminoglycoside-modifying enzymes were analyzed, the possibility of using the combination was dismissed, as time-kill assays showed very weak or no synergy with wide MSWs in aerobic and anaerobic environments. These results indicate that a combination with tobramycin in these cases should not be recommended. Nevertheless, the conclusions of our work are based on the analysis of eight strains. Further studies with larger collections,
6044
aac.asm.org
including hypermutable strains, are needed to give strength to clinical decisions. As has been reported previously, the only fosfomycin transporter in P. aeruginosa is the glycerol-3-phosphate nutrient permease (8, 33). In this study, we observed that nucleotide changes in the glpT gene sequence are responsible for fosfomycin resistance in P. aeruginosa. These changes followed different patterns in each isolate, resulting in various modifications through which the hypothetical permease structure was truncated or significantly modified. As a consequence, uptake of a specific substrate by altered forms of GlpT would be either totally blocked or reduced, concomitantly resulting in high fosfomycin MIC values. These results are consistent with those previously reported (8). Currently, neither EUCAST nor the Clinical and Laboratory Standards Institute (CLSI) have established fosfomycin breakpoints for P. aeruginosa. EUCAST includes an ECOFF value that separates the wild-type population from that which harbors acquired resistance mechanisms. As this study has confirmed, none of the strains with MICs below the ECOFF value (128 g/ml) presented any mutation in their glpT gene sequence. In conclusion, fosfomycin-tobramycin combination activity has been analyzed against fosfomycin-susceptible P. aeruginosa clinical isolates with different tobramycin MICs; it has been demonstrated, according to previous studies, that a fosfomycin-tobramycin combination merits consideration as a treatment strategy against P. aeruginosa infections due to the potential synergy and the prevention of resistance development when the two antimicrobials are administered together. This combination may be particularly beneficial in those infections that develop in anaerobic environments, such as biofilm-mediated ones, since the antimicrobial activity is maintained under these conditions. ACKNOWLEDGMENTS This study was supported by the Instituto de Salud Carlos III, Subdirección General de Redes y Centros de Investigación Cooperativa, Ministerio de Economía y Competitividad, Spanish Network for Research in Infectious Diseases (REIPI, RD12/0015) and cofinanced by the European Development Regional Fund (ERDF, “A Way to Achieve Europe”) and Fondo de Investigación Sanitaria (grant PI09) and Fundación Francisco Soria Melguizo, Madrid, Spain. We declare no conflict of interests.
REFERENCES 1. Gellatly SL, Hancock REW. 2013. Pseudomonas aeruginosa: new insights into pathogenesis and host defenses. Pathog Dis 67:159 –173. http://dx.doi .org/10.1111/2049-632X.12033. 2. Morita Y, Tomida J, Kawamura Y. 2014. Responses of Pseudomonas aeruginosa to antimicrobials. Front Microbiol 4:422. 3. Winkler ML, Papp-Wallace KM, Hujer AM, Domitrovic TN, Hujer KM, Hurless KN, Tuohy M, Hall G, Bonomo RA. 2015. Unexpected challenges in treating multidrug-resistant Gram-negative rods: resistance to ceftazidime-avibactam in archived isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother 59:1020 –1029. http://dx.doi.org/10.1128 /AAC.04238-14. 4. Santos DA, Nascimento MM, Vitali LH, Martinez R. 2013. In vitro activity of antimicrobial combinations against multidrug-resistant Pseudomonas aeruginosa. Rev Soc Bras Med Trop 46:299 –303. http://dx.doi .org/10.1590/0037-8682-0012-2013. 5. Montgomery AB, Rhomberg PR, Abuan T, Walters KA, Flamm RK. 2014. Amikacin-fosfomycin at a five-to-two ratio: characterization of mutation rates in microbial strains causing ventilator-associated pneumonia and interactions with commonly used antibiotics. Antimicrob Agents Chemother 58:3708 –3713. http://dx.doi.org/10.1128/AAC.02779-13. 6. Anderson GG, Kenney TF, Macleod DL, Henig NR, O’Toole GA. 2013.
Antimicrobial Agents and Chemotherapy
October 2015 Volume 59 Number 10
Fosfomycin-Tobramycin Combination against P. aeruginosa
7.
8.
9. 10.
11.
12. 13. 14.
15. 16.
17. 18. 19.
20.
21.
Eradication of Pseudomonas aeruginosa biofilms on cultured airway cells by a fosfomycin/tobramycin antibiotic combination. Pathog Dis 67:39 – 45. http://dx.doi.org/10.1111/2049-632X.12015. Trapnell BC, McColley SA, Kissner DG, Rolfe MW, Rosen JM, McKevitt M, Moorehead L, Montgomery AB, Geller DE. 2012. Fosfomycin/ tobramycin for inhalation in patients with cystic fibrosis with pseudomonas airway infection. Am J Respir Crit Care Med 185:171–178. http://dx .doi.org/10.1164/rccm.201105-0924OC. Castañeda-García A, Rodríguez-Rojas A, Guelfo JR, Blázquez J. 2009. The glycerol-3-phosphate permease GlpT is the only fosfomycin transporter in Pseudomonas aeruginosa. J Bacteriol 191:6968 – 6974. http://dx .doi.org/10.1128/JB.00748-09. Lemieux MJ, Huang Y, Wang DN. 2005. Crystal structure and mechanism of GlpT, the glycerol-3-phosphate transporter from E. coli. J Electron Microsc (Tokyo) 54:S43–S46. http://dx.doi.org/10.1093/jmicro/dfh102. MacLeod DL, Velayudhan J, Kenney TF, Therrien JH, Sutherland JL, Barker LM, Baker WR. 2012. Fosfomycin enhances the active transport of tobramycin in Pseudomonas aeruginosa. Antimicrob Agents Chemother 56:1529 –1538. http://dx.doi.org/10.1128/AAC.05958-11. García-Castillo M, Del Campo R, Morosini MI, Riera E, Cabot G, Willems R, Van Mansfeld R, Oliver A, Cantón R. 2011. Wide dispersion of ST175 clone despite high genetic diversity of carbapenemnonsusceptible Pseudomonas aeruginosa clinical strains in 16 Spanish hospitals. J Clin Microbiol 49:2905–2910. http://dx.doi.org/10.1128/JCM .00753-11. EUCAST. 2014. Breakpoint tables for interpretation of MICs and zone diameters. http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files /Breakpoint_tables/Breakpoint_table_v_4.0.pdf. Gobernado M. 2003. Fosfomicina. Rev Esp Quimioter 16:15– 40. Alvarez F, Olaechea P, Grau S, Marín M, Domínguez A, MartínezLanao J, Soy D, Alos M, Victoria M, Sádaba B, Mediavilla A, Fatela D. Recomendaciones para la monitorización de antibióticos en pacientes críticos ingresados en UCI. Farm Hosp 32:113–123. Clinical and Laboratory Standards Institute. 1999. Methods for determining bactericidal activity of antimicrobial agents. Approved Standard M26-A. Clinical and Laboratory Standards Institute, Wayne, PA. McCaughey G, Diamond P, Elborn JS, McKevitt M, Tunney MM. 2013. Resistance development of cystic fibrosis respiratory pathogens when exposed to fosfomycin and tobramycin alone and in combination under aerobic and anaerobic conditions. PLoS One 8:e69763. http://dx.doi.org /10.1371/journal.pone.0069763. Drlica K. 2003. The mutant selection window and antimicrobial resistance. J Antimicrob Chemother 52:11–17. http://dx.doi.org/10.1093/jac /dkg269. Maciá MD, Borrell N, Pérez JL, Oliver A. 2004. Detection and susceptibility testing of hypermutable Pseudomonas aeruginosa strains with the Etest and disk diffusion. Antimicrob Agents Chemother 48:7 2665–2672. Henrichfreise B, Wiegand I, Pfister W, Wiedemann B. 2007. Resistance mechanisms of multiresistant Pseudomonas aeruginosa strains from Germany and correlation with hypermutation. Antimicrob Agents Chemother 51:4062– 4070. http://dx.doi.org/10.1128/AAC.00148-07. Hocquet D, Bertrand X, Köhler T, Talon D, Plésiat P. 2003. Genetic and phenotypic variations of a resistant Pseudomonas aeruginosa epidemic clone. Antimicrob Agents Chemother 47:1887–1894. http://dx.doi.org/10 .1128/AAC.47.6.1887-1894.2003. Aires JR, Köhler T, Nikaido H, Plésiat P. 1999. Involvement of an active
October 2015 Volume 59 Number 10
22. 23.
24. 25.
26.
27.
28.
29.
30. 31.
32.
33.
efflux system in the natural resistance of Pseudomonas aeruginosa to aminoglycosides. Antimicrob Agents Chemother 43:2624 –2628. Vila J, Francesc A. 2010. Lectura interpretada del antibiograma de bacilos gramnegativos no fermentadores. Enferm Infecc Microbiol Clin 28:726 – 736. (In Spanish.) http://dx.doi.org/10.1016/j.eimc.2010.05.001. Smith EE, Buckley DG, Wu Z, Saenphimmachak C, Hoffman LR, D’Argenio DA, Miller SI, Ramsey BW, Speert DP, Moskowitz SM, Burns JL, Kaul R, Olson MV. 2006. Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc Natl Acad Sci U S A 103:8487– 8492. http://dx.doi.org/10.1073/pnas.0602138103. Huang Y, Lemieux MJ, Song J, Auer M, Wang DN. 2003. Structure and mechanism of the glycerol-3-phosphate transporter from Escherichia coli. Science 301:616 – 620. http://dx.doi.org/10.1126/science.1087619. Stover CK, Pham XQ, Erwin AL, Mizoguchi SD, Warrener P, Hickey MJ, Brinkman FS, Hufnagle WO, Kowalik DJ, Lagrou M, Garber RL, Goltry L, Tolentino E, Westbrock-Wadman S, Yuan Y, Brody LL, Coulter SN, Folger KR, Kas A, Larbig K, Lim R, Smith K, Spencer D, Wong GK, Wu Z, Paulsen IT, Reizer J, Saier MH, Hancock RE, Lory S, Olson MV. 2000. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406:959 –964. http://dx.doi.org /10.1038/35023079. Hassett DJ, Sutton MD, Schurr MJ, Herr AB, Caldwell CC, Matu JO. 2009. Pseudomonas aeruginosa hypoxic or anaerobic biofilm infections within cystic fibrosis airways. Trends Microbiol 17:130 –138. http://dx.doi .org/10.1016/j.tim.2008.12.003. Worlitzsch D, Tarran R, Ulrich M, Schwab U, Cekici A, Meyer KC, Birrer P, Bellon G, Berger J, Weiss T, Botzenhart K, Yankaskas JR, Randell S, Boucher RC, Döring G. 2002. Effects of reduced mucus oxygen concentration in airway Pseudomonas infections of cystic fibrosis patients. J Clin Invest 109:317–325. http://dx.doi.org/10.1172/JCI02 13870. McCaughey G, Gilpin DF, Schneiders T, Hoffman LR, McKevitt M, Elborn JS, Tunney MM. 2013. Fosfomycin and tobramycin in combination downregulate nitrate reductase genes narG and narH, resulting in increased activity against Pseudomonas aeruginosa under anaerobic conditions. Antimicrob Agents Chemother 57:5406 –5414. http://dx.doi.org /10.1128/AAC.00750-13. Cai Y, Fan Y, Wang R, An MM, Liang BB. 2009. Synergistic effects of aminoglycosides and fosfomycin on Pseudomonas aeruginosa in vitro and biofilm infections in a rat model. J Antimicrob Chemother 64:563–566. http://dx.doi.org/10.1093/jac/dkp224. Yanagida C, Ito K, Komiya I, Horie T. 2004. Protective effect of fosfomycin on gentamicin-induced lipid peroxidation of rat renal tissue. Chem Biol Interact 148:139 –147. http://dx.doi.org/10.1016/j.cbi.2004.05.005. Guénard S, Muller C, Monlezun L, Benas P, Broutin I, Jeannot K, Plésiat P. 2014. Multiple mutations lead to MexXY-OprM-dependent aminoglycoside resistance in clinical strains of Pseudomonas aeruginosa. Antimicrob Agents Chemother 58:221–228. http://dx.doi.org/10.1128 /AAC.01252-13. Rodríguez-Rojas A, Couce A, Blázquez J. 2010. Frequency of spontaneous resistance to fosfomycin combined with different antibiotics in Pseudomonas aeruginosa. Antimicrob Agents Chemother 54:4948 – 4949. http: //dx.doi.org/10.1128/AAC.00415-10. Kahan FM, Kahan JS, Cassidy PJ, Kropp H. 1974. The mechanism of action of fosfomycin (phosphonomycin). Ann N Y Acad Sci 235:364 –386. http://dx.doi.org/10.1111/j.1749-6632.1974.tb43277.x.
Antimicrobial Agents and Chemotherapy
aac.asm.org
6045
The antibacterial activity of fosfomycin-tobramycin combination was studied by time-kill assay in eight Pseudomonas aeruginosa clinical isolates belonging to the fosfomycin wild-type population (MIC ⴝ 64 g/ml) but with different tobramycin susceptibilities (MIC range, 1 to 64 g/ml). The mutant prevention concentration (MPC) and mutant selection window (MSW) were determined in five of these strains (tobramycin MIC range, 1 to 64 g/ml) in aerobic and anaerobic conditions simulating environments that are present in biofilm-mediated infections. Fosfomycin-tobramycin was synergistic and bactericidal for the isolates with mutations in the mexZ repressor gene, with a tobramycin MIC of 4 g/ml. This effect was not observed in strains displaying tobramycin MICs of 1 to 2 g/ml due to the strong bactericidal effect of tobramycin alone. Fosfomycin presented higher MPC values (range, 2,048 to >2,048 g/ml) in aerobic and anaerobic conditions than did tobramycin (range, 16 to 256 g/ml). Interestingly, the association rendered narrow or even null MSWs in the two conditions. However, for isolates with high-level tobramycin resistance that harbored aminoglycoside nucleotidyltransferases, time-kill assays showed no synergy, with wide MSWs in the two environments. glpT gene mutations responsible for fosfomycin resistance in P. aeruginosa were determined in fosfomycin-susceptible wild-type strains and mutant derivatives recovered from MPC studies. All mutant derivatives had changes in the GlpT amino acid sequence, which resulted in a truncated permease responsible for fosfomycin resistance. These results suggest that fosfomycin-tobramycin can be an alternative for infections due to P. aeruginosa since it has demonstrated synergistic and bactericidal activity in susceptible isolates and those with low-level tobramycin resistance. It also prevents the emergence of resistant mutants in either aerobic or anaerobic environments.
P
seudomonas aeruginosa is an opportunistic pathogen responsible for a wide variety of infections. Its high intrinsic and acquired antimicrobial resistance combined with the ability to produce biofilms makes the treatment of these infections a critical challenge (1, 2). Patients with underlying conditions such as cystic fibrosis, obstructive pulmonary disease, and bronchiectasis are particularly vulnerable and usually develop chronic infections. Due to the paucity of new compounds, therapeutic strategies in these situations are based on antimicrobial combinations of already existing antibiotics trying to obtain a synergistic effect (3–5). Fosfomycin shows no cross-resistance with other antimicrobials, and data suggest that its association with other antipseudomonal agents, such as tobramycin, may be an option for the treatment of infections caused by this pathogen (6, 7). Fosfomycin inhibits bacterial cell wall biosynthesis by inactivating the UDP-N-acetylglucosamine-3-o-enolpyruvultransferase. In the case of P. aeruginosa, this compound exclusively enters into bacterial cells through the glycerol-3-phosphate nutrient transporter (GlpT) (8). The GlpT protein is an antiporter that belongs to the major facilitator superfamily and consists of 12 transmembrane ␣-helices (H1 to H12) with two domains each containing a six-helix bundle and connected by a long central loop. It transports across the inner membrane an inorganic phosphate molecule outside the cell, subsequently driving the transport of one molecule of glycerol-3phosphate into the cell, in both cases against their correspondent concentration gradients (9). Molecular mechanisms implicated in
October 2015 Volume 59 Number 10
the inactivation of this permease and consequently in fosfomycin resistance are not widely studied. However, a fosfomycin and tobramycin combination has been demonstrated to be beneficial, since fosfomycin enhances the active uptake of tobramycin into P. aeruginosa, resulting in greater inhibition of protein synthesis, enhanced bacterial killing, and a lower frequency of resistance development (10). The objectives of this work were to study the in vitro activity of a fosfomycin and tobramycin combination against P. aeruginosa clinical isolates by time-kill assays and to determine the mutant prevention concentration (MPC) and the mutant selection win-
Received 7 April 2015 Returned for modification 17 May 2015 Accepted 12 July 2015 Accepted manuscript posted online 20 July 2015 Citation Díez-Aguilar M, Morosini MI, Tedim AP, Rodríguez I, Aktas¸ Z, Cantón R. 2015. Antimicrobial activity of fosfomycin-tobramycin combination against Pseudomonas aeruginosa isolates assessed by time-kill assays and mutant prevention concentrations. Antimicrob Agents Chemother 59:6039 –6045. doi:10.1128/AAC.00822-15. Address correspondence to María Isabel Morosini, [email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /AAC.00822-15. Copyright © 2015, American Society for Microbiology. All Rights Reserved. doi:10.1128/AAC.00822-15
Antimicrobial Agents and Chemotherapy
aac.asm.org
6039
Díez-Aguilar et al.
dow (MSW) values of these antimicrobials alone and in combination. Moreover, MPCs were also determined under conditions simulating microaerobic or anaerobic environments that are present in biofilm-mediated infections. In addition, glpT gene mutations responsible for fosfomycin resistance in P. aeruginosa were determined. MATERIALS AND METHODS MIC testing. MICs of fosfomycin (Laboratorios Ern, S.A., Barcelona, Spain), tobramycin (Sigma-Aldrich Chemical Co., St. Louis, MO), and a fosfomycin-tobramycin combination were determined by the agar dilution method (BBL Mueller-Hinton II cation-adjusted broth and agar; BD, Sparks, MD) for eight genetically unrelated P. aeruginosa clinical isolates (Pa1 to Pa8). Pa4 (nonmucoid) and Pa5 (mucoid) were isolated from the sputum of two cystic fibrosis patients, while the rest of the strains were recovered from a previously published collection that included isolates causing bacteremia and nosocomial pneumonia (11). Anaerobic susceptibility testing was also performed by the agar dilution method by supplementing medium with 1% KNO3 (wt/vol) (Sigma-Aldrich Chemical Co.). Anaerobic conditions of incubation were generated by a GasPak EZ anaerobe container system (BD). The European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoint for tobramycin (susceptible [S], ⱕ4 g/ml; resistant [R], ⬎4 g/ml) and the epidemiological cutoff (ECOFF) value for fosfomycin (128 g/ml) were applied (12). Time-kill assays. Time-kill assays (Fig. 1) were performed in the eight P. aeruginosa isolates (Pa1 to Pa8), all of them having a fosfomycin MIC of 64 g/ml, representing the modal MIC value for this compound reported by EUCAST for this organism. However, they differed in tobramycin susceptibilities: five isolates were susceptible (MIC range, 1 to 4 g/ml) (Pa1 to Pa5) and three isolates were resistant (MIC range, 32 to 64 g/ml) (Pa6 to Pa8). Time-kill assays (initial inoculum of 105 to 106 CFU/ml) were performed with fosfomycin and tobramycin alone as well as in combination. Corresponding fosfomycin and tobramycin maximum concentrations of drug in serum (Cmax), 90 g/ml and 10 g/ml, respectively, were used in all experiments (13, 14). In vitro activity was assessed at 1, 2, 4, 6, 8, 12, and 24 h (Fig. 1). The reduction of the original inoculum by ⱖ3 log10 CFU/ml was considered bactericidal, and a reduction of ⱖ2 log10 CFU/ml by the antibiotic combination compared with that of the most active compound was defined as synergism. Indifference was defined as a ⬍2 log10 reduction with the combination compared with that obtained with the most active single agent. Antagonism was defined as a ⱖ2 log10 increase in viable count when using the combination compared with that obtained with the most active drug alone (15). Estimation of the mutant prevention concentration. Fosfomycin, tobramycin, and fosfomycin-tobramycin combination MPCs were calculated for three tobramycin-susceptible (Pa2, MIC ⫽ 2 g/ml; Pa4, MIC ⫽ 4 g/ml; Pa5, MIC ⫽ 4 g/ml) and two tobramycin-resistant (Pa7, MIC ⫽ 64 g/ml; Pa8, MIC ⫽ 32 g/ml) isolates. MPCs were determined in aerobic and anaerobic conditions (16). Briefly, an initial inoculum of approximately 1010 CFU/ml was placed onto Mueller-Hinton agar plates with twofold-increasing fosfomycin concentrations (16 to 2,048 g/ml) and tobramycin concentrations (0.5 to 512 g/ml) and with the fosfomycin-tobramycin combination. A variable fosfomycin concentration (8 to 256 g/ml) and different fixed tobramycin concentrations (0.5 to 64 g/ml) were used to test the combination. Plates were incubated for 48 h at 37°C. MPC was defined as the lowest antibiotic concentration that prevented the visible growth of mutant colonies (17). MICs for the mutants recovered from the highest fosfomycin, tobramycin, and fosfomycin-tobramycin concentration plates were retested by Etest (bio Mérieux, France) after serial passages in agar plates that did not contain antibiotics. The MSW for the fosfomycin-tobramycin combination was determined by graphing the fosfomycin-tobramycin MICs and fosfomycin-tobramycin MPCs resulting from each tobramycin and fosfomycin concentration (Fig. 2). Putatively hypermutable P. aeruginosa among the tested strains was
6040
aac.asm.org
screened by the disk diffusion method through observation of resistant mutant subpopulations within the inhibition zones of the following antibiotics: ceftazidime, imipenem, meropenem, ciprofloxacin, and tobramycin (18). PAO1 and PAOmutS were used as strain controls. Characterization of tobramycin resistance mechanisms. Tobramycin resistance mechanisms were first phenotypically characterized by the disk diffusion method with gentamicin, tobramycin, netilmicin, amikacin, and ciprofloxacin. Following phenotypic results, confirmation of resistance mechanisms was subsequently performed by amplification and sequencing of the aminoglycoside-2-O-nucleotidyltransferase [ANT(2)-I] enzyme with ant(2⬙)-Ia-F (ACACAACGCAGGTCACA) as the forward primer and ant(2⬙)-Ia-R (CATGCGAGCCTGTAGGA) as the reverse primer (19). mexZ and the mexX-mexZ intergenic region were amplified and sequenced with primers MexZ1026 (CAGCGTGGAGATC GAAGGCAGCCGG) and MexZ2060 (CCAGCAGGAATAGGGCGACC AGGGC) (20). The sequence was compared with that reported by Aires et al. (21). Molecular bases of fosfomycin resistance and hypothetical GlpT protein structure. Fosfomycin-resistant mutants generated from the P. aeruginosa isolates tested in the MPC studies (Pa2M, Pa4M, Pa5M, Pa7M, and Pa8M), as well as their parental strains (Pa2, Pa4, Pa5, Pa7, and Pa8), were subjected to further analysis to determine possible mutations or other genetic changes implicated in fosfomycin resistance. Additionally, six other genetically unrelated P. aeruginosa clinical isolates (Pa9 to Pa14) from the same collection (11), with different fosfomycin MICs (32 to 1,024 g/ml), were subjected to screening of possible mutations with the aim of comparing them with those of fosfomycin-resistant mutants obtained in this study (Table 2). The glpT gene was amplified and sequenced by PCR using glpT-F(5=-AGCGGAGCTCGCGATGTTC-3=) and glpT-R (5=-TCAGCCGGCTTGCTGCGG-3=) as the forward and reverse primers, respectively (8). glpTw-F (5=-TGCTCTGCGGCTGGCTGTCGG-3=) and glpTw-R (5=-AATGAACATCACCGCCGCC-3=) were used in primer walking and were designed in our laboratory. P. aeruginosa ATCC 27853 and PAO1 strains were used as controls. Nucleotide and amino acid sequences were analyzed with the sequence analysis software Clone Manager 9 (Scientific and Educational Software). Homology searches were done using BLAST search algorithms (http://blast.ncbi.nlm.nih.gov/Blast .cgi). The hypothetical three-dimensional structure of the GlpT protein of the PAO1 strain was compared with that of the GlpT transporter of the fosfomycin-resistant mutants obtained in this study using the SwissModel tool (http://swissmodel.expasy.org/) in the ExPASy Bioinformatics resource portal (see Fig. S1 in the supplemental material).
RESULTS
Time-kill assays. Fosfomycin exhibited a bacteriostatic activity, with a 0.2 to 2.15 log10 CFU/ml inoculum reduction in the first 8 h, against the eight isolates tested; at 12 to 24 h, regrowth was observed in all the cases when this antimicrobial was used alone. For Pa1 (tobramycin MIC, 2 g/ml), Pa2 (tobramycin MIC, 2 g/ml), and Pa3 (tobramycin MIC, 1 g/ml), tobramycin alone exhibited a bactericidal effect in the first 4 h, and all of these isolates experienced a complete inhibition of growth (no colony count). The fosfomycin-tobramycin combination was indifferent in these three isolates. However, for Pa4, a tobramycin-susceptible isolate (MIC ⫽ 4 g/ml), tobramycin alone presented a bacteriostatic profile, with a 2.1 log10 CFU/ml inoculum reduction at 12 h but with regrowth at 24 h. In this isolate, the fosfomycin-tobramycin combination was synergistic and bactericidal, with a ⬎3 log10 CFU/ml inoculum reduction in the first 4 h and a complete inhibition of growth at 6 h, maintained until the end of the curve. For Pa5 (MIC ⫽ 4 g/ml), tobramycin was bactericidal at 8 h while the fosfomycin-tobramycin combination was synergistic and bactericidal, with a complete inhibition of growth at 4 h.
Antimicrobial Agents and Chemotherapy
October 2015 Volume 59 Number 10
Fosfomycin-Tobramycin Combination against P. aeruginosa
FIG 1 Time-kill assays for P. aeruginosa isolates with tobramycin (TOB), fosfomycin (FOS), and fosfomycin-tobramycin combination.
Tobramycin-resistant isolates (tobramycin MICs of 64 g/ml for Pa6 and Pa7 and 32 g/ml for Pa8) displayed no inoculum reduction and a marked regrowth when tobramycin was used alone. In Pa7, fosfomycin-tobramycin exhibited a bacteriostatic
October 2015 Volume 59 Number 10
profile at 8 h but did not reduce the initial inoculum at 24 h. For the other two tobramycin-resistant isolates, the fosfomycin-tobramycin combination was indifferent and did not impede regrowth. Antagonism was not observed in any case.
Antimicrobial Agents and Chemotherapy
aac.asm.org
6041
Díez-Aguilar et al.
FIG 2 MPCs and MICs for fosfomycin-tobramycin (FOS-TOB) combination in aerobiosis (AE) and anaerobiosis (ANA).
Estimation of the MPC. The fosfomycin and tobramycin MIC and MPC results determined in aerobiosis and anaerobiosis are shown in Table 1. For all of the strains, the fosfomycin MIC in the two environments was 64 g/ml. Fosfomycin MPCs went up to ⬎2,048 g/ml in the aerobic and to 2,048 g/ml in the anaerobic environment, respectively. In the three tobramycin-susceptible isolates, tobramycin MICs in anaerobiosis went up to resis-
tance levels (Pa2, MIC ⫽ 8 g/ml; Pa4, MIC ⫽ 64 g/ml; Pa5, MIC ⫽ 32 g/ml). Tobramycin MPCs were two- to threefolddilutions higher in anaerobiosis than in aerobiosis. For the two tobramycin-resistant isolates, the MIC and MPC values in anaerobiosis were ⬎512 g/ml. For the fosfomycin-tobramycin combination, the MIC and MPC values in aerobiosis and anaerobiosis, as well as the MSWs for the different fosfomycin and tobramycin
TABLE 1 Fosfomycin and tobramycin MICs and MPCs in aerobiosis and anaerobiosis Fosfomycin MIC (g/ml)
Fosfomycin MPC (g/ml)
Tobramycin MIC (g/ml)
Tobramycin MPC (g/ml)
Isolate
Aerobiosis
Anaerobiosis
Aerobiosis
Anaerobiosis
Aerobiosis
Anaerobiosis
Aerobiosis
Anaerobiosis
Pa2 Pa4 Pa5 Pa7 Pa8
64 64 64 64 64
64 64 64 64 64
⬎2,048 ⬎2,048 ⬎2,048 ⬎2,048 ⬎2,048
2,048 2,048 2,048 2,048 2,048
2 4 4 64 32
8 64 32 ⬎512 ⬎512
16 32 32 ⬎512 ⬎512
64 256 256 ⬎512 ⬎512
6042
aac.asm.org
Antimicrobial Agents and Chemotherapy
October 2015 Volume 59 Number 10
Fosfomycin-Tobramycin Combination against P. aeruginosa
TABLE 2 Analysis of glpT sequence of parental strains, mutant derivatives, and isolates Pa9 to Pa14 Parental strain or mutant derivative
glpT sequence
Fosfomycin MIC (g/ml)
Pa2 Pa2M Pa4 Pa4M Pa5 Pa5M Pa7 Pa7M Pa8 Pa8M Pa9 Pa10 Pa11 Pa12 Pa13 Pa14
No mutation C681 deletion (1-bp frameshift), stop TGA987 No mutation G to A; G358 (G1072GC)¡S (A1072GC) No mutation C398 insertion (1-bp frameshift), stop TGA514 No mutation G211CCATC216 deletion (6-bp frameshift), ⌬ A71-I72 No mutation G355insertion (1-bp frameshift), stop TAA390 No mutation No mutation No mutation No mutation G to A; A121(G361CC)¡T(ACC) A to C; T211 (A631CC)¡P (CCC)
64 ⬎1,024 64 ⬎1,024 64 ⬎1,024 64 ⬎1,024 64 ⬎1,024 32 128 128 128 512 1,024
concentrations used in combination, are shown in Fig. 2. In tobramycin-resistant isolates (Pa7 and Pa8), the MSWs exhibited a wide range of values and even high fosfomycin and tobramycin concentrations did not reduce this window. However, for tobramycin-susceptible isolates (Pa2, Pa4, and Pa5), MSWs were very narrow, almost disappearing in the two environments. A hypermutable phenotype was not detected in any strain. Characterization of tobramycin resistance mechanisms. The susceptibility profiles of Pa4 and Pa5 (cystic fibrosis isolates) to the panel of aminoglycosides and fluoroquinolones were consistent with hyperexpression of the MexXY-OprM efflux system, as they showed low-level resistance to gentamicin, tobramycin, netilmicin, amikacin, and ciprofloxacin (22). The overproduction of this pump resulted from a mutation in the repressor gene mexZ, confirmed by amplification and sequencing of this gene. A deletion of a guanine (G) at position 72 resulted in a frameshift in the coding sequence that was found in the two strains. The alteration in this repressor may explain the overproduction of the efflux system and consequently the low-level tobramycin resistance. In fact, MexXY is primarily implicated in panaminoglycoside resistance in clinical cystic fibrosis isolates (23). No mutations were detected in the mexZ-mexX intergenic region of any of the sequenced isolates. For the isolates with high-level tobramycin resistance (Pa6, Pa7, and Pa8), the susceptibility profiles corresponded to the presence of an aminoglycoside nucleotidyltransferase (2=)-I enzyme (22), which confers high-level resistance to gentamicin and tobramycin, with susceptibility to netilmicin and amikacin. This enzyme was confirmed by PCR and sequencing. Molecular bases of fosfomycin resistance and hypothetical GlpT protein structure. The glpT genes of all original strains and of their corresponding fosfomycin mutant derivatives were sequenced and compared. Results demonstrated that all the strains with an MIC equal to or below the ECOFF (128 g/ml) had no codifying mutations. However, mutant derivatives and originally resistant isolates contained mutations in the glpT sequence (Table 2). Three of these mutants (Pa2M, Pa5M, and Pa8M) had frameshifts that resulted in premature stop codons, while Pa7M presented deletions that conferred the loss of various amino acids of the protein. Pa4M and the two originally resistant isolates (Pa13
October 2015 Volume 59 Number 10
and Pa14) had point mutations in their nucleotide sequence that conferred an amino acid substitution in the corresponding proteins. Mutations in the glpT gene sequence that resulted in premature codon stop in fosfomycin-resistant mutants Pa2M, Pa5M, and Pa8M led to an incomplete truncated protein. The stop codon in Pa2M at amino acid position 328 is located in H9, which resulted in the loss of 3 ␣-helices. The stop codon in Pa5M at position 171 is located in H5 and resulted in the loss of 7 ␣-helices. The stop codon in Pa8M at position 129 is located in H4, which resulted in the loss of 8 ␣-helices. The loss of two amino acids in Pa7M created a distortion in H2 that is involved in the pore formation. The amino acid substitution in Pa4M is located in the central helix H10 (24) (see Fig. S1 in the supplemental material). Additionally, silent mutations were found in all the strains. Polymorphisms detected in glpT sequences are summarized in Table S1 in the supplemental material. The glpT gene sequence of the wild-type strain PAO1 was used for comparison purposes (25). DISCUSSION
A strategy to prevent the development of resistance and to improve infection treatments is the use of antimicrobial combinations. In vitro evaluation of fosfomycin-tobramycin through timekill assays and MPCs against P. aeruginosa has demonstrated that this combination in tobramycin- and fosfomycin-susceptible isolates not only enhances bacterial killing but also prevents the selection of fosfomycin-resistant mutants. P. aeruginosa is a versatile organism capable of growing in anaerobic environments in the presence of the alternative electron acceptors NO3⫺, NO2⫺, or arginine (26). Since the course of some infections, such as biofilm-mediated ones, develop in microaerobic environments or in completely anaerobic conditions, such as cystic fibrosis chronic infections (26, 27), the development of resistant mutants was tested also in anaerobiosis. It is known that aminoglycosides are less active in anaerobiosis because their penetration into bacterial cells depends on an oxygen-dependent reaction (28). This fact reinforces the need to administer tobramycin in combination with other compounds. Fosfomycin has demonstrated that it can enhance the active transport of tobramy-
Antimicrobial Agents and Chemotherapy
aac.asm.org
6043
Díez-Aguilar et al.
cin into the cell (10); furthermore, its activity does not decrease in anaerobiosis, and some studies have reported high activity under these conditions (16). It has also been reported that fosfomycintobramycin association is advantageous in anaerobiosis, as it downregulates the expression of nitrate reductase genes that are essential for the growth of P. aeruginosa (28). As has been previously described, fosfomycin-tobramycin combination is capable of eradicating P. aeruginosa biofilm growth on cystic fibrosis-derived airway cells (6) and of improving the therapeutic effect in a biofilm-infected animal model (29). This approach also may be beneficial considering that fosfomycin has a protective action against the potential nephrotoxicity of aminoglycosides (30). Furthermore, decreased administration of tobramycin during treatment with a fosfomycin-tobramycin combination may decrease the negative side effects of the aminoglycoside. For tobramycin-susceptible isolates, the fosfomycin-tobramycin combination was synergistic and bactericidal for the cystic fibrosis isolates, with a tobramycin MIC of 4 g/ml. In one of these strains, tobramycin alone was not bactericidal. This may be explained by the fact that tobramycin is a concentration-dependent antimicrobial and the MIC for this isolate was close to the susceptibility breakpoint value. Alteration of the MexXY efflux system was implicated in low-level aminoglycoside resistance in the two isolates, with mexZ the most commonly mutated gene in cystic fibrosis strains (23, 31). Fosfomycin-tobramycin synergy may be related to the type of tobramycin resistance mechanism involved. MexXY-OprM alteration is implicated in aminoglycoside expulsion attributed to the increase in the drug efflux, and although fosfomycin is not inhibiting this efflux, it causes a rapid accumulation inside the cell by inducing the active uptake (10). Thus, this potentiation in tobramycin accumulation may lead to the achievement of a sufficient concentration for bactericidal effect in spite of the efflux hyperproduction. A synergistic effect with fosfomycin-tobramycin may not be appreciated in strains with a tobramycin MIC of 1 to 2 g/ml due to the strong bactericidal effect of this antimicrobial alone. Nevertheless, MIC results obtained in anaerobiosis and MPC results support the use of the combination for susceptible strains. Tobramycin-susceptible isolates became resistant in anaerobic conditions. Indeed, tobramycin or fosfomycin alone did not prevent the appearance of resistant mutants in aerobiosis or anaerobiosis with very high MPC values, especially for fosfomycin. These results reinforce the idea that these antibiotics must not be used in monotherapy. In contrast, a fosfomycin-tobramycin combination rendered narrow or even null MSWs in aerobic and anaerobic conditions. Therefore, the potential selection of resistant mutants during therapy with a fosfomycin-tobramycin combination in susceptible isolates is unlikely. In line with this observation, it has been observed that the combination of fosfomycin with tobramycin makes the generation of mutants resistant to the two antibiotics very difficult, even in a hypermutable background (32). When isolates with high-level tobramycin resistance harboring aminoglycoside-modifying enzymes were analyzed, the possibility of using the combination was dismissed, as time-kill assays showed very weak or no synergy with wide MSWs in aerobic and anaerobic environments. These results indicate that a combination with tobramycin in these cases should not be recommended. Nevertheless, the conclusions of our work are based on the analysis of eight strains. Further studies with larger collections,
6044
aac.asm.org
including hypermutable strains, are needed to give strength to clinical decisions. As has been reported previously, the only fosfomycin transporter in P. aeruginosa is the glycerol-3-phosphate nutrient permease (8, 33). In this study, we observed that nucleotide changes in the glpT gene sequence are responsible for fosfomycin resistance in P. aeruginosa. These changes followed different patterns in each isolate, resulting in various modifications through which the hypothetical permease structure was truncated or significantly modified. As a consequence, uptake of a specific substrate by altered forms of GlpT would be either totally blocked or reduced, concomitantly resulting in high fosfomycin MIC values. These results are consistent with those previously reported (8). Currently, neither EUCAST nor the Clinical and Laboratory Standards Institute (CLSI) have established fosfomycin breakpoints for P. aeruginosa. EUCAST includes an ECOFF value that separates the wild-type population from that which harbors acquired resistance mechanisms. As this study has confirmed, none of the strains with MICs below the ECOFF value (128 g/ml) presented any mutation in their glpT gene sequence. In conclusion, fosfomycin-tobramycin combination activity has been analyzed against fosfomycin-susceptible P. aeruginosa clinical isolates with different tobramycin MICs; it has been demonstrated, according to previous studies, that a fosfomycin-tobramycin combination merits consideration as a treatment strategy against P. aeruginosa infections due to the potential synergy and the prevention of resistance development when the two antimicrobials are administered together. This combination may be particularly beneficial in those infections that develop in anaerobic environments, such as biofilm-mediated ones, since the antimicrobial activity is maintained under these conditions. ACKNOWLEDGMENTS This study was supported by the Instituto de Salud Carlos III, Subdirección General de Redes y Centros de Investigación Cooperativa, Ministerio de Economía y Competitividad, Spanish Network for Research in Infectious Diseases (REIPI, RD12/0015) and cofinanced by the European Development Regional Fund (ERDF, “A Way to Achieve Europe”) and Fondo de Investigación Sanitaria (grant PI09) and Fundación Francisco Soria Melguizo, Madrid, Spain. We declare no conflict of interests.
REFERENCES 1. Gellatly SL, Hancock REW. 2013. Pseudomonas aeruginosa: new insights into pathogenesis and host defenses. Pathog Dis 67:159 –173. http://dx.doi .org/10.1111/2049-632X.12033. 2. Morita Y, Tomida J, Kawamura Y. 2014. Responses of Pseudomonas aeruginosa to antimicrobials. Front Microbiol 4:422. 3. Winkler ML, Papp-Wallace KM, Hujer AM, Domitrovic TN, Hujer KM, Hurless KN, Tuohy M, Hall G, Bonomo RA. 2015. Unexpected challenges in treating multidrug-resistant Gram-negative rods: resistance to ceftazidime-avibactam in archived isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother 59:1020 –1029. http://dx.doi.org/10.1128 /AAC.04238-14. 4. Santos DA, Nascimento MM, Vitali LH, Martinez R. 2013. In vitro activity of antimicrobial combinations against multidrug-resistant Pseudomonas aeruginosa. Rev Soc Bras Med Trop 46:299 –303. http://dx.doi .org/10.1590/0037-8682-0012-2013. 5. Montgomery AB, Rhomberg PR, Abuan T, Walters KA, Flamm RK. 2014. Amikacin-fosfomycin at a five-to-two ratio: characterization of mutation rates in microbial strains causing ventilator-associated pneumonia and interactions with commonly used antibiotics. Antimicrob Agents Chemother 58:3708 –3713. http://dx.doi.org/10.1128/AAC.02779-13. 6. Anderson GG, Kenney TF, Macleod DL, Henig NR, O’Toole GA. 2013.
Antimicrobial Agents and Chemotherapy
October 2015 Volume 59 Number 10
Fosfomycin-Tobramycin Combination against P. aeruginosa
7.
8.
9. 10.
11.
12. 13. 14.
15. 16.
17. 18. 19.
20.
21.
Eradication of Pseudomonas aeruginosa biofilms on cultured airway cells by a fosfomycin/tobramycin antibiotic combination. Pathog Dis 67:39 – 45. http://dx.doi.org/10.1111/2049-632X.12015. Trapnell BC, McColley SA, Kissner DG, Rolfe MW, Rosen JM, McKevitt M, Moorehead L, Montgomery AB, Geller DE. 2012. Fosfomycin/ tobramycin for inhalation in patients with cystic fibrosis with pseudomonas airway infection. Am J Respir Crit Care Med 185:171–178. http://dx .doi.org/10.1164/rccm.201105-0924OC. Castañeda-García A, Rodríguez-Rojas A, Guelfo JR, Blázquez J. 2009. The glycerol-3-phosphate permease GlpT is the only fosfomycin transporter in Pseudomonas aeruginosa. J Bacteriol 191:6968 – 6974. http://dx .doi.org/10.1128/JB.00748-09. Lemieux MJ, Huang Y, Wang DN. 2005. Crystal structure and mechanism of GlpT, the glycerol-3-phosphate transporter from E. coli. J Electron Microsc (Tokyo) 54:S43–S46. http://dx.doi.org/10.1093/jmicro/dfh102. MacLeod DL, Velayudhan J, Kenney TF, Therrien JH, Sutherland JL, Barker LM, Baker WR. 2012. Fosfomycin enhances the active transport of tobramycin in Pseudomonas aeruginosa. Antimicrob Agents Chemother 56:1529 –1538. http://dx.doi.org/10.1128/AAC.05958-11. García-Castillo M, Del Campo R, Morosini MI, Riera E, Cabot G, Willems R, Van Mansfeld R, Oliver A, Cantón R. 2011. Wide dispersion of ST175 clone despite high genetic diversity of carbapenemnonsusceptible Pseudomonas aeruginosa clinical strains in 16 Spanish hospitals. J Clin Microbiol 49:2905–2910. http://dx.doi.org/10.1128/JCM .00753-11. EUCAST. 2014. Breakpoint tables for interpretation of MICs and zone diameters. http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files /Breakpoint_tables/Breakpoint_table_v_4.0.pdf. Gobernado M. 2003. Fosfomicina. Rev Esp Quimioter 16:15– 40. Alvarez F, Olaechea P, Grau S, Marín M, Domínguez A, MartínezLanao J, Soy D, Alos M, Victoria M, Sádaba B, Mediavilla A, Fatela D. Recomendaciones para la monitorización de antibióticos en pacientes críticos ingresados en UCI. Farm Hosp 32:113–123. Clinical and Laboratory Standards Institute. 1999. Methods for determining bactericidal activity of antimicrobial agents. Approved Standard M26-A. Clinical and Laboratory Standards Institute, Wayne, PA. McCaughey G, Diamond P, Elborn JS, McKevitt M, Tunney MM. 2013. Resistance development of cystic fibrosis respiratory pathogens when exposed to fosfomycin and tobramycin alone and in combination under aerobic and anaerobic conditions. PLoS One 8:e69763. http://dx.doi.org /10.1371/journal.pone.0069763. Drlica K. 2003. The mutant selection window and antimicrobial resistance. J Antimicrob Chemother 52:11–17. http://dx.doi.org/10.1093/jac /dkg269. Maciá MD, Borrell N, Pérez JL, Oliver A. 2004. Detection and susceptibility testing of hypermutable Pseudomonas aeruginosa strains with the Etest and disk diffusion. Antimicrob Agents Chemother 48:7 2665–2672. Henrichfreise B, Wiegand I, Pfister W, Wiedemann B. 2007. Resistance mechanisms of multiresistant Pseudomonas aeruginosa strains from Germany and correlation with hypermutation. Antimicrob Agents Chemother 51:4062– 4070. http://dx.doi.org/10.1128/AAC.00148-07. Hocquet D, Bertrand X, Köhler T, Talon D, Plésiat P. 2003. Genetic and phenotypic variations of a resistant Pseudomonas aeruginosa epidemic clone. Antimicrob Agents Chemother 47:1887–1894. http://dx.doi.org/10 .1128/AAC.47.6.1887-1894.2003. Aires JR, Köhler T, Nikaido H, Plésiat P. 1999. Involvement of an active
October 2015 Volume 59 Number 10
22. 23.
24. 25.
26.
27.
28.
29.
30. 31.
32.
33.
efflux system in the natural resistance of Pseudomonas aeruginosa to aminoglycosides. Antimicrob Agents Chemother 43:2624 –2628. Vila J, Francesc A. 2010. Lectura interpretada del antibiograma de bacilos gramnegativos no fermentadores. Enferm Infecc Microbiol Clin 28:726 – 736. (In Spanish.) http://dx.doi.org/10.1016/j.eimc.2010.05.001. Smith EE, Buckley DG, Wu Z, Saenphimmachak C, Hoffman LR, D’Argenio DA, Miller SI, Ramsey BW, Speert DP, Moskowitz SM, Burns JL, Kaul R, Olson MV. 2006. Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc Natl Acad Sci U S A 103:8487– 8492. http://dx.doi.org/10.1073/pnas.0602138103. Huang Y, Lemieux MJ, Song J, Auer M, Wang DN. 2003. Structure and mechanism of the glycerol-3-phosphate transporter from Escherichia coli. Science 301:616 – 620. http://dx.doi.org/10.1126/science.1087619. Stover CK, Pham XQ, Erwin AL, Mizoguchi SD, Warrener P, Hickey MJ, Brinkman FS, Hufnagle WO, Kowalik DJ, Lagrou M, Garber RL, Goltry L, Tolentino E, Westbrock-Wadman S, Yuan Y, Brody LL, Coulter SN, Folger KR, Kas A, Larbig K, Lim R, Smith K, Spencer D, Wong GK, Wu Z, Paulsen IT, Reizer J, Saier MH, Hancock RE, Lory S, Olson MV. 2000. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406:959 –964. http://dx.doi.org /10.1038/35023079. Hassett DJ, Sutton MD, Schurr MJ, Herr AB, Caldwell CC, Matu JO. 2009. Pseudomonas aeruginosa hypoxic or anaerobic biofilm infections within cystic fibrosis airways. Trends Microbiol 17:130 –138. http://dx.doi .org/10.1016/j.tim.2008.12.003. Worlitzsch D, Tarran R, Ulrich M, Schwab U, Cekici A, Meyer KC, Birrer P, Bellon G, Berger J, Weiss T, Botzenhart K, Yankaskas JR, Randell S, Boucher RC, Döring G. 2002. Effects of reduced mucus oxygen concentration in airway Pseudomonas infections of cystic fibrosis patients. J Clin Invest 109:317–325. http://dx.doi.org/10.1172/JCI02 13870. McCaughey G, Gilpin DF, Schneiders T, Hoffman LR, McKevitt M, Elborn JS, Tunney MM. 2013. Fosfomycin and tobramycin in combination downregulate nitrate reductase genes narG and narH, resulting in increased activity against Pseudomonas aeruginosa under anaerobic conditions. Antimicrob Agents Chemother 57:5406 –5414. http://dx.doi.org /10.1128/AAC.00750-13. Cai Y, Fan Y, Wang R, An MM, Liang BB. 2009. Synergistic effects of aminoglycosides and fosfomycin on Pseudomonas aeruginosa in vitro and biofilm infections in a rat model. J Antimicrob Chemother 64:563–566. http://dx.doi.org/10.1093/jac/dkp224. Yanagida C, Ito K, Komiya I, Horie T. 2004. Protective effect of fosfomycin on gentamicin-induced lipid peroxidation of rat renal tissue. Chem Biol Interact 148:139 –147. http://dx.doi.org/10.1016/j.cbi.2004.05.005. Guénard S, Muller C, Monlezun L, Benas P, Broutin I, Jeannot K, Plésiat P. 2014. Multiple mutations lead to MexXY-OprM-dependent aminoglycoside resistance in clinical strains of Pseudomonas aeruginosa. Antimicrob Agents Chemother 58:221–228. http://dx.doi.org/10.1128 /AAC.01252-13. Rodríguez-Rojas A, Couce A, Blázquez J. 2010. Frequency of spontaneous resistance to fosfomycin combined with different antibiotics in Pseudomonas aeruginosa. Antimicrob Agents Chemother 54:4948 – 4949. http: //dx.doi.org/10.1128/AAC.00415-10. Kahan FM, Kahan JS, Cassidy PJ, Kropp H. 1974. The mechanism of action of fosfomycin (phosphonomycin). Ann N Y Acad Sci 235:364 –386. http://dx.doi.org/10.1111/j.1749-6632.1974.tb43277.x.
Antimicrobial Agents and Chemotherapy
aac.asm.org
6045
