Food and Chemical Toxicology 74 (2014) 206–215

Contents lists available at ScienceDirect

Food and Chemical Toxicology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / f o o d c h e m t o x

Anti-inflammatory and anti-periductal fibrosis effects of an anthocyanin complex in Opisthorchis viverrini-infected hamsters Kitti Intuyod a,b, Aroonsri Priprem c, Wanwisa Limphirat d, Lakhanawan Charoensuk b,e, Porntip Pinlaor b,f, Chawalit Pairojkul b,g, Kamol Lertrat h, Somchai Pinlaor b,e,* a

Biomedical Science Program, Graduate School, Khon Kaen University, Khon Kaen, Thailand Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand c Department of Pharmaceutical Technology, Faculty of Pharmaceutical Science, Khon Kaen University, Khon Kaen, Thailand d Synchrotron Light Research Institute (Public organization), Nakhon Ratchasima, Thailand e Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand f Centre for Research and Development in Medical Diagnostic Laboratory, Faculty of Associated Medical Sciences, Khon Kaen University, Khon Kaen, Thailand g Department of Pathology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand h Plant Breeding Research Center for Sustainable Agriculture, Faculty of Agricultural Science, Khon Kaen University, Khon Kaen, Thailand b

A R T I C L E

I N F O

Article history: Received 17 June 2014 Accepted 29 September 2014 Available online 13 October 2014 Keywords: Anthocyanin complex Purple waxy corn cobs Blue butterfly pea Curcumin Anti-inflammatory effect Opisthorchis viverrini

A B S T R A C T

The pharmacological activities of herbal extracts can be enhanced by complex formation. In this study, we manipulated cyanidin and delphinidin-rich extracts to form an anthocyanin complex (AC) with turmeric and evaluated activity against inflammation and periductal fibrosis in Opisthorchis viverriniinfected hamsters. The AC was prepared from anthocyanins extracted from cobs of purple waxy corn (70%), petals of blue butterfly pea (20%) and turmeric extract (10%), resulting in an enhanced free-radical scavenging capacity. Oral administration of AC (175 and 700 mg/kg body weight) every day for 1 month to O. viverrini-infected hamsters resulted in reduced inflammatory cells and periductal fibrosis. Fourier transform infrared spectroscopy and partial least square discriminant analysis suggested nucleic acid changes in the O. viverrini-infected liver samples, which were partially prevented by the AC treatment. AC reduced 8-oxodG formation, an oxidative DNA damage marker, significantly decreased levels of nitrite in the plasma and alanine aminotransferase activity and increased the ferric reducing ability of plasma. AC also decreased the expression of oxidant-related genes (NF-κB and iNOS) and increased the expression of antioxidant-related genes (CAT, SOD, and GPx). Thus, AC increases free-radical scavenging capacity, decreases inflammation, suppresses oxidative/nitrative stress, and reduces liver injury and periductal fibrosis in O. viverrini-infected hamsters. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Chemoprevention by phytochemicals is now considered a viable approach for cancer control and management (Priyadarsini and Nagini, 2012; Surh, 2003). Anthocyanins are polyphenols found in pigmented plants (Wu et al., 2006). Their consumption has increased since their potential health benefits were recognized (Scalbert and Williamson, 2000). Anthocyanins contain antioxidant, anti-inflammatory and anti-carcinogenic properties (He and Giusti, 2010; Wang and Stoner, 2008). Clinical studies have demonstrated the beneficial effects of anthocyanins in human

* Corresponding author. Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002, Thailand. Tel.: +66 43 348 387; fax: +66 43 202 475. E-mail address: [email protected] (S. Pinlaor). http://dx.doi.org/10.1016/j.fct.2014.09.021 0278-6915/© 2014 Elsevier Ltd. All rights reserved.

diseases such as increased HDL-cholesterol concentrations, decreased LDL-cholesterol concentrations in dyslipidemic subjects (Qin et al., 2009) and reduced risk of myocardial infarction in young and middle-aged women (Cassidy et al., 2013). Recently, Alvarez-Suarez and colleagues also reported that strawberry-rich anthocyanin consumption for 1 month has a beneficial role in reducing the risk for cardiovascular diseases (Alvarez-Suarez et al., 2014). Purple corn (Zea mays L.) is a large grain plant of the Poaceae family which has been cultivated for centuries in South America (Pedreschi and Cisneros-Zevallos, 2007). Several anthocyanins have been found in purple corn cobs including cyanidin-3glucoside, pelargonidin-3-glucoside and peonidin-3-glucoside (de Pascual-Teresa et al., 2002). The blue butterfly pea (Clitoria ternatea L.), a member of the Fabaceae family, contains high levels of anthocyanins (Kazuma et al., 2004; Ramos-Escudero et al., 2012) and has been used for centuries as a food colorant.

K. Intuyod et al./Food and Chemical Toxicology 74 (2014) 206–215

207

Fig. 1. Characteristics of anthocyanin complex and its individual components. (A) FTIR spectroscopy and (B) DSC were used to study the FTIR fingerprint and thermal properties of anthocyanin complex and its individual components from (CT) blue butterfly pea and (CC) purple waxy corn cobs.

Recently, purple waxy corn (Z. mays L. ceritina Kulesh), a popular edible, sweet-tasting corn, has been developed in northeast Thailand as an anthocyanin-rich nutraceutical (Ketthaisong et al., 2013). The cobs of purple corn (Z. mays L., cv Zihei) are an abundant agricultural waste though they are anthocyanin-rich and have higher antioxidant activity than seeds of the same plant (Yang and Zhai, 2010). Cyanidin and delphinidin are among the most studied anthocyanins with pharmacological properties (Meiers et al., 2001) and has been found in both purple corn (el Abdel-Aal et al., 2006) and in blue petals of the butterfly pea (Terahara et al., 1996). In addition, turmeric, dried rhizome powder of Curcuma longa has been used for centuries as Ayurveda and as traditional medicine (Gupta et al., 2013). Turmeric exerts numerous biological properties including antioxidant, anti-inflammatory, anti-cancer, antiarthritic, anti-atherosclerotic, anti-aging, antidiabetic, antimicrobial, wound healing and memory-enhancing activities (Aggarwal et al., 2013). In Opisthorchis viverrini infection-associated cholangiocarcinoma (CCA) through chronic inflammation, turmeric reduces inflammation and prevents liver injury in hamsters (Boonjaraspinyo et al., 2009). Thus, anthocyanins and turmeric may be used as a secondary chemoprevention in opisthorchiasis-associated CCA. The stability and pharmacological activity of anthocyanins can be affected by many factors such as pH, light, temperature, oxygen and enzymes (Kırca et al., 2007; McGhie and Walton, 2007). Interestingly, this stability could be enhanced when they are formed into complexes with other substances such as flavonoids and tannic acid

Table 1 Characteristics of AC and its individual components. Zea mays L. ceritina Kulesh (CC)

Clitoria ternatea L. (CT)

Anthocyanin complex (AC)

Calories (mJ) Onset (°C) Melting point (°C) Total anthocyanin content (μg/ml)a IC50 (μg/ml)b

4401.78 136.83 138.03 0.89 ± 0.03

559.16 150.59 152.32 1.25 ± 0.07

179.00 155.82 165.70 3.51 ± 0.07

b

16.25

59.15

Values are expressed as mean ± standard deviation (n = 6). IC50 equivalent to total anthocyanin content.

2. Materials and methods 2.1. Anthocyanin complex preparation Dried petals of blue butterfly pea (C. ternatea L.; CT), dried rhizomes of turmeric (C. longa; Tur) and dried purple waxy corn cobs (Z. mays L. ceritina Kulesh; CC) were collected in Khon Kaen province, Thailand. Aqueous extracts of CC, CT and Tur, at a respective volume ratio of 7:2:1, were homogenized and followed by adding 0.1 M of caffeic acid (Sigma-Aldrich, St. Louis, MO, USA), 0.1 M of piperine (SigmaAldrich) and 2 mM of zinc sulfate (Ajax Finechem, Australia). The mixture was cooled, filtered, precipitated and dried to obtain AC powder (7% yields). AC powder was stored in an amber glass bottle at 25 °C and 45% RH. 2.2. Fourier transform infrared spectroscopy (FTIR) analysis of CC, CT and AC CC, CT and AC were separately mixed with potassium bromide (KBr) (Ajax Finechem), compressed with a hydraulic pressure (10 tons) and then spectra were recorded using an FTIR spectrometer (PerkinElmer Inc., Spectrum One program, MA, USA). 2.3. Differential scanning calorimetry (DSC) assay

Parameter

a

(Clifford, 2000). Therefore, we hypothesize that the activity and stability of anthocyanins may increase when they form a complex with turmeric and other trace elements. In this study, anthocyanins derived from purple waxy corn cobs and petals of blue butterfly pea were manipulated to form an anthocyanin complex (AC) with phenolic compound(s) in turmeric extract (Kim et al., 2011) and trace elements. The physicochemical properties and free radical scavenging capacity of AC were investigated in vitro. The protective effects of AC on inflammation, fibrosis and DNA damage induced by O. viverrini infection were tested on a hamster model. In addition oxidant/anti-oxidant related genes were also investigated in the hamsters’ livers.

5.74

Powder extracts of CC, CT and AC powder were placed on aluminum pans and heated at a rate of 5 °C min−1 from 25 to 200 °C using a blank aluminum pan as a reference. A DSC thermogram was recorded using a DSC822e Differential Scanning Calorimeter (Mettler-Toledo Inc, Columbus, OH, USA). 2.4. Total anthocyanin content Total anthocyanin content was determined according to AOAC method 2005.02 (Lee et al., 2005). In brief, samples were diluted with 0.25M KCl (pH 1) or 0.004 M sodium acetate (pH 4.5). The absorbance of the diluted samples were recorded at 520 and 700 nm using UV-Visible spectrophotometry (Shimadzu, Japan)

208

K. Intuyod et al./Food and Chemical Toxicology 74 (2014) 206–215

Fig. 2. Anti-inflammatory effects of AC on hamster bile ducts induced by O. viverrini infection. Representative case showing histopathology of inflammation at intrahepatic bile ducts in (A) normal hamster, (B) O. viverrini-infected and (C, D) O. viverrini-infected hamster supplemented with AC 175 and 700 mg/kg, respectively. Number of inflammatory cells infiltration per high power field (HPF) was counted and represented as mean ± SD. H&E stain, 100× magnification. Ov = O. viverrini.

and calculated for total anthocyanin content in equivalence to cyanidin-3glucoside.

was fixed in 10% buffered formalin for histopathological study and immunofluorescent staining.

2.5. Free radical scavenging capacity assay

2.8. Analysis of biochemical parameters

Free radical scavenging capacity of CC, CT and AC was determined by 2, 2-diphenylpicrylhydrazyl (DPPH) assay using L-ascorbic acid as a standard. L-ascorbic acid in water and 100 μl of the sample were mixed with equal volume of 0.2 mM DPPH in methanol and stored for 30 minutes in the dark. Absorbance of the reactant was recorded at 540 nm in comparison to the blank using a microplate reader (Sunrise, Tecan Group, Switzerland). IC50 was obtained from a 50% reduction of the absorbance in comparison to the blank. The free radical scavenging capacity of the hamster plasma was accessed by the ferric reducing ability of plasma (FRAP) assay as previously described (Pinlaor et al., 2009).

Alanine aminotransferase (ALT) activity in plasma, indicative of liver injury, was analyzed by automated analyzer (LX20Pro, Beckman Coulter, CA, USA). The concentration of nitrite, indicative of NO production in plasma, was determined by Griess assay (Pinlaor et al., 2009).

2.6. Experimental animals Male golden hamsters (4–6 weeks) were purchased from the Animal Unit, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand. The hamsters were housed under conventional conditions and fed a stock murine diet (CP-SWT, Thailand) and water ad libitum. Twenty hamsters were divided into four groups (n = 5 per group): normal control (N), O. viverrini-infected (OV), O. viverrini infected followed by supplemented with low dose (175 mg/kg body weight; OV + 175) or high dose (700 mg/kg body weight; OV + 700) of AC. In the O. viverrini-infected group, metacercariae were collected from natural fresh water fish as previously described (Pinlaor et al., 2009). Hamsters were infected with 50 metacercariae of O. viverrini by a gastric intubation method. In treatment groups, AC was weighed and dissolved in distilled water and given to hamsters once a day orally for 1 month. The Animal Ethics Committee of Khon Kaen University approved this study (AEKKU32/ 2554).

2.7. Specimen collection Thirty days p.i., hamsters were euthanized by diethyl ether. Blood was collected from the heart onto EDTA in vacutainers and centrifuged at 4500 rpm for 15 minutes for plasma collection. Liver tissues were excised and treated with TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) for total RNA isolation. A second piece of liver was snap-frozen in liquid nitrogen for Western blot analysis. The residual liver tissue

2.9. FTIR analysis of liver samples Paraffin sections of liver (4 μm thick) on low-e slides (MirrIR, Kevley Technologies, Chesterland, OH, USA) were deparaffinized and vacuum dried for FTIR analysis. FTIR spectra were recorded using Tensor 27 FTIR spectrometer coupled with a Bruker Hyperion 2000 IR microscope (Bruker Optics, Ettlingen, Germany). Data were collected using OPUS 6.5 software (Bruker Optics) with reflection mode at spectral resolution of 4 cm−1 with 64 scans, in comparison to background spectra of the same low-e slide. Raw spectra were normalized with extended multiplicative signal correction (EMSC) for correction of differences in sample thickness and to allow for easy visual comparison. Variation between spectra was determined by partial least squares discriminant analysis (PLS-DA) using Unscrambler 10.1 (CAMO, Oslo, Norway) based on non-linear iterative projections by alternating least-squares (NIPALS) algorithm.

2.10. Histopathology and immunofluorescent staining Liver tissue sections (4 μm thick) derived from the middle lobe of the hamsters’ liver were stained with H&E and Picrosirius Red (Polysciences, Inc., Warrington, PA, USA) to visualize histological changes and collagen deposition, respectively. The number of inflammatory cell infiltrations per high power field (HPF) was accessed (10 fields per hamster liver) and presented as mean ± SD. The collagen tissue in periductal fibrosis was graded into five stages as previously described (Prakobwong et al., 2009). Immunofluorescent staining of liver tissues was performed as previously described (Charoensuk et al., 2011). Sections were blocked and incubated with 1:100 mouse anti-8-oxodG antibody (Japan Institute for the Control of Aging, Fukuroi, Japan)

K. Intuyod et al./Food and Chemical Toxicology 74 (2014) 206–215

209

Fig. 3. Anti-fibrotic effect of AC in liver induced by O. viverrini infection. (A–D) Representative cases showing the various grading scores of periductal fibrosis by Picosirius Red stain, (A) grade 0 in normal hamster liver; (B) grade 2 in liver of O. viverrini-infected hamster and (C, D) grade 1 in O. viverrini-infected and treated with AC 175 and 700 mg/kg, respectively. (E) Western blot analysis expression of α-SMA and (F) relative band intensity was measured using ImageQuant TL software. A–D, 100× magnification. Ov = O. viverrini. *p < 0.05 vs. the normal group and #p < 0.05 vs. the O. viverrini-infected group.

overnight at 4 °C. After three washes with PBS buffer, sections were incubated with 1:400 Alexa 488-conjugated goat anti-mouse IgG (Life Technologies, Grand Island, NY, USA) in the dark for 60 min at room temperature. The stained sections were washed, mounted and examined under fluorescence microscopy (Nikon Corporation, Tokyo, Japan). 8-oxodG positive cells per HPF were counted (10 fields per hamster liver) and presented as mean ± SD.

2.11. Western blot analysis Liver protein preparation, quantitation, separation and blotting were performed as previously described (Charoensuk et al., 2011). Protein (30 μg) was loaded and separated on 12% SDS-PAGE and transferred to a polyvinylidene difluoride membrane. Membranes were blocked and incubated with either 1:1000 rabbit polyclonal anti-p65 (Abcam, Cambridge, MA, USA), 1:1000 rabbit polyclonal anti-α-SMA (Abcam) or 1:2000 mouse monoclonal anti-actin antibody (Abcam) overnight at 4 °C. After washing three times, membranes were incubated with 1:2000 horseradish peroxidaseconjugated donkey anti-rabbit or 1:3000 goat anti-mouse IgG antibody (GE Healthcare, Piscataway, NJ, USA). Finally, a chemiluminescence reaction was developed using ECL™ Prime blotting detection reagent (GE Healthcare) and immunoreactive material was visualized under an ImageQuant LAS4000 mini (GE Healthcare). Relative band intensity was measured using ImageQuant TL 7.0 software (Non-Linear Dynamics, Durham, NC, USA).

2.12. RNA isolation and quantification by real-time polymerase chain reaction Total RNA extraction and cDNA synthesis was performed and oligonucleotidespecific primers for SOD1, SOD2, SOD3, CAT, GPx, and GAPDH were designed as previously described (Pinlaor et al., 2009). Primer for NF-κB and iNOS were designed based on Genbank accession number M61909.1 for NF-κB and DQ355357.1 for iNOS. The primer sequences were: for NF-κB, forward (GCTCAAGATCTGCCGAGTAA), reverse (TGAGAAAAGGAGCCTCGTG); for iNOS, forward: (GACCTCAACAAAGCTCTCAG), reverse (GTGAAGGACAATCCACAACT). Relative mRNA expression was determined in duplicate by ABI7500 thermal cycler (Applied Biosystems, Foster City, CA, USA) using FastStart Universal SYBR Green Master (ROX, Roche Applied Science, Mannheim, Germany) following the manufacturer’s protocol. Amplification conditions were 1 cycle at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s, 55 °C for 30 s and 72 °C for 1 min. Data were analyzed using Rotor Gene 5 software (Corbett Research, Sydney, NSW, Australia). Relative quantification of target mRNA expression was calculated by the 2−ΔΔCt method using GAPDH for calibration.

2.13. Statistical analysis Analysis of Variance (ANOVA) and Tukey’s test were performed to test differences among experimental groups using SPSS 13 software (SPSS Inc, Chicago, IL, USA). Statistical significance is defined as p < 0.05.

210

K. Intuyod et al./Food and Chemical Toxicology 74 (2014) 206–215

3. Results 3.1. Characteristics of AC FTIR spectra of AC was characterized and differentiated from its components, extracts of CC and CT (Fig. 1A). Peaks between 1640 and 1700 cm−1 of AC were shifted from those of the CC and CT, indicating the alterations in conjugated carbonyl groups. At 3250– 3650 cm−1, the peak of AC was narrower than those of CC or CT, potentially due to intra-molecular with inter-molecular interactions at hydroxyl groups. Aromatic ring vibration around 1600– 1500 cm−1 was observed with AC while C-H stretching around 3200– 2700 cm−1 was not observed in AC, suggesting that complexation of anthocyanins had occurred. Thermographs by DSC of AC, CC and CT indicated a reduction in endothermic properties of CT and CC after formation of AC (Fig. 1B and Table 1). Phase behavior changes of CC and CT started at 136.8 and 150.6 °C, respectively, while that of AC started at 155.8 °C, suggesting that thermal stabilized by complexation which requires further thorough testing. Table 1 shows the total anthocyanin content and free-radical scavenging capacity of each compound. AC showed higher total anthocyanin content than CC or CT. Interestingly, AC exhibited a lower IC50 than CC (2.8-fold) or CT (10.3-fold), indicating the highest freeradical scavenging capacity of AC. 3.2. Anti-inflammatory and anti-fibrotic effects of AC in hamsters infected with O. viverrini Since AC showed a higher free-radical scavenging capacity than individual extracts, we further investigated the anti-inflammatory (Fig. 2) and anti-fibrotic (Fig. 3) effects of AC in hamsters infected with O. viverrini compared with those with a normal liver (Fig. 2A). In O. viverrini-infected hamsters without AC treatment, histology of the liver showed dilation and an accumulation of inflammatory cells around the bile duct whether or not they were inhabited by adult flukes (Fig. 2B). In contrast, AC treatment significantly decreased inflammatory cell infiltration in both AC-treated groups at 175 (44.47 ± 15.82 cells/HPF; Fig. 2C) and 700 (42.13 ± 12.52 cells/ HPF; Fig. 2D) mg/kg body weight compared with the untreated group (81.07 ± 15.10 cells/HPF; Fig. 2B) (p < 0.05). Although fibrotic tissue was somewhat apparent in normal hamster liver (Fig. 3A), the thickening of periductal fibrosis around the bile duct was observed to be increased in O. viverrini-infected hamsters without AC treatment (Fig. 3B). In contrast, accumulation of fibrous tissue in both AC-treated groups at 175 (1.42 ± 0.51; Fig. 3C) and 700 (1.38 ± 0.50; Fig. 3D) mg/kg body weight significantly decreased compared to O. viverrini-infected hamsters without AC treatment (2.25 ± 0.75, p < 0.05). The result of Picosirius Red staining was supported by the expression of fibrotic marker, α-SMA (Fig. 3E and F). In addition, treatment of O. viverrini-infected hamsters with AC at 175 and 700 mg/kg body weight were equivalent to 21 and 84 mg per day (based on 120 gm body weight). There were no liver alterations or deaths among infected and treated hamsters. In agreement with other models, the highest dose of anthocyanin (400 mg/kg body weight) had no effect on motor function (Tall et al., 2004).

Fig. 4. Effect of AC on biochemical properties of O. viverrini-infected hamsters. (A) Plasma levels of ALT activity, (B) nitrite and (C) FRAP were measured as described (Materials and Methods). N = Normal control, OV = O. viverrini-infected group, OV + 175 = O. viverrini-infected and treatment with AC 175 mg/kg, OV + 700 = O. viverrini-infected and treatment with AC 700 mg/kg. *p < 0.05 vs. the normal group and #p < 0.05 vs. the O. viverrini-infected group (n = 5 per group).

antioxidant capacity in the plasma, FRAP level (at 700 mg/kg body weight of AC, Fig. 4C).

3.3. Effect of AC on biochemical parameter changes

3.4. Effect of AC on biomolecular changes

In O. viverrini-infected hamsters, ALT activity and nitrite levels in plasma significantly increased while FRAP was significantly decreased compared with normal hamsters (p < 0.05). Notably, AC treatment significantly decreased plasma ALT activity (Fig. 4A) and nitrite (Fig. 4B) levels, but significantly increased the total

Several studies report that O. viverrini infection causes biomolecular changes in DNA, and its adduct is the initiating step in cholangiocarcinogenesis (Pinlaor et al., 2004; Yongvanit et al., 2012). To investigate whether AC treatment can prevent changes in biomolecules, FTIR was performed in hamster livers in the range

K. Intuyod et al./Food and Chemical Toxicology 74 (2014) 206–215

211

Fig. 5. Effect of AC on biomolecules in O. viverrini-infected hamster livers. Hamster liver was prepared as described in Materials and Methods and analyzed using FTIR analysis. (A) Average spectra from experiments after baseline and normalized with EMSC at (A) wavenumber 1800–800 cm−1 and (B) at wavenumber 3600–2800 cm−1. (C) PLSDA analysis of FTIR spectra analyzed at wavenumber 1800–800 cm−1 and (D) at wavenumber 3600–2800 cm−1. Abbreviations of experimental animal groups are in Fig. 4 legend.

of 3600–800 cm−1, which represents the profiles of protein and nucleic acid (1800–800 cm−1, Fig. 5A) and lipid (3600–2800 cm−1, Fig. 5B) (Dreissig et al., 2009). Infrared (IR) absorbance of the livers from O. viverrini infected hamsters decreased in wavenumber 1240 cm−1 compared to livers of normal hamsters, indicating the difference of PO2 asymmetric stretching in nucleic acid (Fig. 5A). However, the average IR absorbance of livers from AC-treated hamsters also differed from those of normal and O. viverrini-infected hamster in wavenumber 1240 cm−1. PLS-DA analysis of spectra from livers of O. viverrini-infected hamsters between wavenumbers 1800 and 800 cm−1 was deviated from those of normal livers and livers from O. viverrini-infected hamster supplemented with AC (Fig. 5C). In contrast, FTIR and PLS-DA analysis revealed that spectra in wavenumber between 3600 and 2800 cm−1 of liver among normal, O. viverrini-infected and AC-treated groups were slightly different (Fig. 5B and D). To confirm FTIR result, immunofluorescent staining for 8-oxodG was performed. An immunoreactivity of 8-oxodG showed a faint stain in the liver of normal hamsters (Fig. 6A). In

the O. viverrini-infected group, 8-oxodG formation was found in the nucleus of bile duct epithelium and inflammatory cells around the bile duct (Fig. 6B). Formation of 8-oxodG significantly decreased in a dose-dependent manner in O. viverrini-infected hamsters supplemented with AC at 175 (76.13 ± 19.58 cells/HPF; Fig. 6C) and 700 (47.50 ± 17.59 cells/HPF; Fig. 6D) mg/kg body weight compared with untreated group (121.70 ± 25.57 cells/HPF; Fig. 6B) (p < 0.05).

3.5. Effect of AC on oxidant-related genes/protein expression The effect of AC on oxidant-related genes/protein was investigated by real time RT-PCR and Western blotting. In O. viverriniinfected hamsters, expression of NF-κB and iNOS were significantly increased compared with normal hamsters (p < 0.05). Both low and high doses of AC significantly suppressed the expression of NF-κB and iNOS genes (p < 0.05) (Fig. 7A and B), as well as expression of NF-κB protein (p < 0.05) (Fig. 7C and D).

212

K. Intuyod et al./Food and Chemical Toxicology 74 (2014) 206–215

Fig. 6. Effect of AC on pro-mutagenic oxidative DNA damage in liver of O. viverrini-infected hamsters. Representative image shows 8-oxodG formation in liver tissues of (A) normal hamster, (B) O. viverrini-infected and (C, D) O. viverrini-infected hamster supplemented with AC 175 and 700 mg/kg. Immunoreactive 8-oxodG was found in the nucleus of bile duct epithelium (arrowhead) and inflammatory cells (arrows) in O. viverrini-infected hamster and found only in nucleus of inflammatory cells (arrows) in ACtreated groups. 8-oxodG positive cell per HPF was counted and represented as mean ± SD. Magnification is 400×. Ov = O. viverrini.

Fig. 7. Effect of AC on oxidant-related genes expression. Relative mRNA expression of iNOS and NF-κB to GAPDH were investigated using Real Time-PCR (A, B). NF-κB protein expression was measured using Western blot analysis (C, D). See Fig. 4 legend for abbreviations of experimental animal groups and statistical significance.

K. Intuyod et al./Food and Chemical Toxicology 74 (2014) 206–215

213

Fig. 8. Effect of AC on antioxidant-related genes expression. mRNA expression of antioxidant-related genes to GAPDH was investigated using Real Time-RT-PCR. CAT = catalase, GPx = glutathione peroxidase and SOD = superoxide dismutase. See Fig. 4 legend for abbreviations of experimental animal groups and statistical significance.

3.6. Effect of AC on antioxidant-related genes expression Expression of antioxidant-related genes was investigated by real time RT-PCR. In livers of O. viverrini-infected hamster, mRNA expression of CAT, SOD2 and SOD3 was significantly decreased (p < 0.05) while expression of GPX and SOD1 was slightly decreased compared to normal control. In contrast, mRNA expression of CAT, GPx and SOD1, SOD2, SOD3 was significantly increased in AC-treated groups, dose-dependently (p < 0.05) (Fig. 8). 4. Discussion In this study, we derived an anthocyanin complex (AC) composed of anthocyanins (cyanidin and delphinidin), turmeric and trace amounts of others such as caffeic acid, piperine and zinc sulfate, and its stability was enhanced (data not shown) and increased free radical scavenging capacity. This is in agreement with a report on the synergistic effect of delphinidin and cyanidin (Zhu et al., 2013). Moreover, addition of caffeic acid (Scapagnini et al., 2010) and turmeric, which contains curcumin and other phenolic compounds (Gupta et al., 2013) to the AC could have additive effects in mediating antiinflammatory response. AC shows anti-inflammatory effects, inhibits oxidative/nitrative stress, and reduces liver injury and periductal fibrosis in hamsters infected with O. viverrini. In Southeast Asia, principally Thailand, Lao PDR, South Vietnam and Cambodia, at least 6 million people are currently infected with O. viverrini (Sripa et al., 2012). Infection is caused by eating raw, semicooked or fermented fish contaminated with infective stage metacercariae of O. viverrini. Several evidence revealed that chronic and re-infection with O. viverrini is the major risk factor for CCA (IARC, 2012). Infection-associated CCA genesis is addressed via chronic inflammation-mediated DNA damage (Yongvanit et al., 2012). Using

secondary chemoprevention in infected patients such as AC may reduce the risk of opisthorchiasis-associated CCA. The previous study reported that bile duct and portal area of O. viverrini-infected hamster markedly infiltrated with inflammatory cells (Bhamarapravati et al., 1978). Furthermore, O. viverrini infection induces inflammationmediated oxidative and nitrative DNA damage through activation of NF-κB and iNOS expression leading to NO production (Pinlaor et al., 2004), which may contribute to initiate step of CCA development. In this study, our in vivo results showed that AC suppressed inflammatory cells infiltration around the bile ducts at 1 month postinfection. Moreover, AC possesses anti-inflammatory properties partly via inhibiting NF-κB and iNOS expression. Reduction of iNOS expression contributes to a lower NO generation as demonstrated by a reduction of nitrite level in plasma, suggesting that AC reduces nitrative stress. AC also exerted anti-inflammatory activity via enhancing the expression of genes encoding anti-oxidant enzymes including CAT, GPx, and SOD in liver and increased free radical scavenging capacity in the plasma. These results suggest that reduction of inflammation and oxidative/nitrative stress by AC supplement might reduce the risk of CCA genesis caused by O. viverrini infection. Modification of biomolecules caused by O. viverrini infection may contribute to CCA development (Yongvanit et al., 2012). FTIR analysis is a powerful method to differentiate the biochemical components of cells or tissues such as carbohydrates, lipids, proteins and nucleic acids (Holman et al., 2010). In this study, analysis of liver tissue by FTIR and PLS-DA reveals that O. viverrini infection mainly affected nucleic acids. The marked increase in formation of 8-oxodG supports the FTIR data, and indicates that AC treatment in O. viverrini-induced inflammation could partially prevent changes in nucleic acids in affected cells. A decrease in inflammation and less nucleic acid alteration in liver tissues of

214

K. Intuyod et al./Food and Chemical Toxicology 74 (2014) 206–215

O. viverrini-infected hamsters suggests a chemopreventive effect of AC in O. viverrini-associated CCA. The beneficial effect of AC on suppression of NF-κB-dependent oxidative DNA damage in O. viverriniinfected hamsters was similar to many models of protective effects of anthocyanins (Aiyer et al., 2008; Calvo-Castro et al., 2013; Ramirez-Tortosa et al., 2001). O. viverrini infection does not only cause inflammation-mediated DNA damage, but also induces periductal fibrosis, a major risk for CCA development (Sripa et al., 2012). Our results also showed that AC exerted anti-fibrotic effect in O. viverrini-infected hamsters. Protective effect of AC on fibrosis may be supported by a reduction of α-SMA expression. Relevantly, anti-fibrotic effect of anthocyanins has been previously reported in dimethylnitrosamine-induced liver fibrosis (Choi et al., 2010). However, ALT activity could not be recovered to a normal level after AC treatment, suggesting that viable liver flukes in the bile duct lumens might continue to cause liver injury. Thus, combining AC with effective drug treatment such as praziquantel for worm elimination might effectively prevent liver injury. In conclusion, we have developed and characterized a novel anthocyanin complex with a higher free radical scavenging capacity than CC and CT alone in vitro. In O. viverrini-infected hamster, AC showed an anti-inflammatory effect, suppressed oxidative/nitrative stress, reduced liver injury, and decreased periductal fibrosis, suggesting that AC is a promising chemopreventive agent to prevent CCA caused by O. viverrini infection especially where re-infection with liver fluke is rapidly found. In addition, using purple waxy corn cobs as a source of anthocyanins for AC production by the ecoindustry could generate value from agricultural wastes. Further study is required, particularly clinical trials in opisthorchiasis patients. Conflict of interest statement The authors declare that there are no conflicts of interest. Transparency document The Transparency document associated with this article can be found in the online version. Acknowledgments This work was supported by the Royal Golden Jubilee Ph.D. Program (to KI and SP) and Thai Agricultural Research Development Agency (Public Organization, grant no. CRP5605010310). We also thank Synchrotron Light Research Institute, Nakhon Ratchasima, Thailand, for FTIR spectroscopy and Miss Sucharat Limsitthichaikoon, for her assistance in characterization of the anthocyanin complex. We thank Dr. Alan Rogerson and Dr. Justin Reese for their advice during manuscript preparation. References Aggarwal, B.B., Yuan, W., Li, S., Gupta, S.C., 2013. Curcumin-free turmeric exhibits anti-inflammatory and anticancer activities: identification of novel components of turmeric. Mol. Nutr. Food Res. 57, 1529–1542. Aiyer, H.S., Kichambare, S., Gupta, R.C., 2008. Prevention of oxidative DNA damage by bioactive berry components. Nutr. Cancer 60 (Suppl. 1), 36–42. Alvarez-Suarez, J.M., Giampieri, F., Tulipani, S., Casoli, T., Di Stefano, G., Gonzalez-Paramas, A.M., et al., 2014. One-month strawberry-rich anthocyanin supplementation ameliorates cardiovascular risk, oxidative stress markers and platelet activation in humans. J. Nutr. Biochem. 25, 289–294. Bhamarapravati, N., Thammavit, W., Vajrasthira, S., 1978. Liver changes in hamsters infected with a liver fluke of man, Opisthorchis viverrini. Am. J. Trop. Med. Hyg. 27, 787–794. Boonjaraspinyo, S., Boonmars, T., Aromdee, C., Srisawangwong, T., Kaewsamut, B., Pinlaor, S., et al., 2009. Turmeric reduces inflammatory cells in hamster opisthorchiasis. Parasitol. Res. 105, 1459–1463.

Calvo-Castro, L., Syed, D.N., Chamcheu, J.C., Vilela, F.M., Perez, A.M., Vaillant, F., et al., 2013. Protective effect of tropical highland blackberry juice (Rubus adenotrichos Schltdl.) against UVB-mediated damage in human epidermal keratinocytes and in a reconstituted skin equivalent model. Photochem. Photobiol. 89, 1199–1207. Cassidy, A., Mukamal, K.J., Liu, L., Franz, M., Eliassen, A.H., Rimm, E.B., 2013. High anthocyanin intake is associated with a reduced risk of myocardial infarction in young and middle-aged women. Circulation 127, 188–196. Charoensuk, L., Pinlaor, P., Prakobwong, S., Hiraku, Y., Laothong, U., Ruangjirachuporn, W., et al., 2011. Curcumin induces a nuclear factor-erythroid 2-related factor 2-driven response against oxidative and nitrative stress after praziquantel treatment in liver fluke-infected hamsters. Int. J. Parasitol. 41, 615–626. Choi, J.H., Hwang, Y.P., Choi, C.Y., Chung, Y.C., Jeong, H.G., 2010. Anti-fibrotic effects of the anthocyanins isolated from the purple-fleshed sweet potato on hepatic fibrosis induced by dimethylnitrosamine administration in rats. Food Chem. Toxicol. 48, 3137–3143. Clifford, M.N., 2000. Anthocyanins – nature, occurrence and dietary burden. J. Sci. Food Agric. 80, 1063–1072. de Pascual-Teresa, S., Santos-Buelga, C., Rivas-Gonzalo, J.C., 2002. LC-MS analysis of anthocyanins from purple corn cob. J. Sci. Food Agric. 82, 1003–1006. Dreissig, I., Machill, S., Salzer, R., Krafft, C., 2009. Quantification of brain lipids by FTIR spectroscopy and partial least squares regression. Spectrochim. Acta A. Mol. Biomol. Spectrosc. 71, 2069–2075. el Abdel-Aal, S.M., Young, J.C., Rabalski, I., 2006. Anthocyanin composition in black, blue, pink, purple, and red cereal grains. J. Agric. Food Chem. 54, 4696–4704. Gupta, S.C., Sung, B., Kim, J.H., Prasad, S., Li, S., Aggarwal, B.B., 2013. Multitargeting by turmeric, the golden spice: from kitchen to clinic. Mol. Nutr. Food Res. 57, 1510–1528. He, J., Giusti, M.M., 2010. Anthocyanins: natural colorants with health-promoting properties. Annu. Rev. Food Sci. Technol. 1, 163–187. Holman, H.Y., Bechtel, H.A., Hao, Z., Martin, M.C., 2010. Synchrotron IR spectromicroscopy: chemistry of living cells. Anal. Chem. 82, 8757–8765. IARC, 2012. A review of human carcinogens: Opisthorchis viverrini and Clonorchis sinensis. IARC Monogr. Eval. Carcinog. Risks Hum. 100B, 341–370. Kazuma, K., Kogawa, K., Noda, N., Kato, N., Suzuki, M., 2004. Identification of delphinidin 3-O-(6’’-O-malonyl)-beta-glucoside-3’-O-beta-glucoside, a postulated intermediate in the biosynthesis of ternatin C5 in the blue petals of Clitoria ternatea (butterfly pea). Chem. Biodivers. 1, 1762–1770. Ketthaisong, D., Suriharn, B., Tangwongchai, R., Lertrat, K., 2013. Changes in physicochemical properties of waxy corn starches at different stages of harvesting. Carbohydr. Polym. 98, 241–248. Kim, I.-S., Yang, M.-R., Lee, O.-H., Kang, S.-N., 2011. Antioxidant activities of hot water extracts from various spices. Int. J. Mol. Sci. 12, 4120–4131. Kırca, A., Özkan, M., Cemeroğlu, B., 2007. Effects of temperature, solid content and pH on the stability of black carrot anthocyanins. Food Chem. 101, 212–218. Lee, J., Durst, R.W., Wrolstad, R.E., 2005. Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: collaborative study. J. AOAC Int. 88, 1269–1278. McGhie, T.K., Walton, M.C., 2007. The bioavailability and absorption of anthocyanins: towards a better understanding. Mol. Nutr. Food Res. 51, 702–713. Meiers, S., Kemeny, M., Weyand, U., Gastpar, R., von Angerer, E., Marko, D., 2001. The anthocyanidins cyanidin and delphinidin are potent inhibitors of the epidermal growth-factor receptor. J. Agric. Food Chem. 49, 958–962. Pedreschi, R., Cisneros-Zevallos, L., 2007. Phenolic profiles of Andean purple corn (Zea mays L.). Food Chem. 100, 956–963. Pinlaor, S., Hiraku, Y., Ma, N., Yongvanit, P., Semba, R., Oikawa, S., et al., 2004. Mechanism of NO-mediated oxidative and nitrative DNA damage in hamsters infected with Opisthorchis viverrini: a model of inflammation-mediated carcinogenesis. Nitric Oxide 11, 175–183. Pinlaor, S., Yongvanit, P., Prakobwong, S., Kaewsamut, B., Khoontawad, J., Pinlaor, P., et al., 2009. Curcumin reduces oxidative and nitrative DNA damage through balancing of oxidant-antioxidant status in hamsters infected with Opisthorchis viverrini. Mol. Nutr. Food Res. 53, 1316–1328. Prakobwong, S., Pinlaor, S., Yongvanit, P., Sithithaworn, P., Pairojkul, C., Hiraku, Y., 2009. Time profiles of the expression of metalloproteinases, tissue inhibitors of metalloproteases, cytokines and collagens in hamsters infected with Opisthorchis viverrini with special reference to peribiliary fibrosis and liver injury. Int. J. Parasitol. 39, 825–835. Priyadarsini, R.V., Nagini, S., 2012. Cancer chemoprevention by dietary phytochemicals: promises and pitfalls. Curr. Pharm. Biotechnol. 13, 125–136. Qin, Y., Xia, M., Ma, J., Hao, Y., Liu, J., Mou, H., et al., 2009. Anthocyanin supplementation improves serum LDL- and HDL-cholesterol concentrations associated with the inhibition of cholesteryl ester transfer protein in dyslipidemic subjects. Am. J. Clin. Nutr. 90, 485–492. Ramirez-Tortosa, C., Andersen, O.M., Cabrita, L., Gardner, P.T., Morrice, P.C., Wood, S.G., et al., 2001. Anthocyanin-rich extract decreases indices of lipid peroxidation and DNA damage in vitamin E-depleted rats. Free Radic. Biol. Med. 31, 1033–1037. Ramos-Escudero, F., Munoz, A.M., Alvarado-Ortiz, C., Alvarado, A., Yanez, J.A., 2012. Purple corn (Zea mays L.) phenolic compounds profile and its assessment as an agent against oxidative stress in isolated mouse organs. J. Med. Food 15, 206–215. Scalbert, A., Williamson, G., 2000. Dietary intake and bioavailability of polyphenols. J. Nutr. 130, 2073S–2085S. Scapagnini, G., Caruso, C., Calabrese, V., 2010. Therapeutic potential of dietary polyphenols against brain ageing and neurodegenerative disorders. Adv. Exp. Med. Biol. 698, 27–35.

K. Intuyod et al./Food and Chemical Toxicology 74 (2014) 206–215

Sripa, B., Brindley, P.J., Mulvenna, J., Laha, T., Smout, M.J., Mairiang, E., et al., 2012. The tumorigenic liver fluke Opisthorchis viverrini – multiple pathways to cancer. Trends Parasitol. 28, 395–407. Surh, Y.J., 2003. Cancer chemoprevention with dietary phytochemicals. Nat. Rev. Cancer 3, 768–780. Tall, J.M., Seeram, N.P., Zhao, C., Nair, M.G., Meyer, R.A., Raja, S.N., 2004. Tart cherry anthocyanins suppress inflammation-induced pain behavior in rat. Behav. Brain Res. 153, 181–188. Terahara, N., Oda, M., Matsui, T., Osajima, Y., Saito, N., Toki, K., et al., 1996. Five new anthocyanins, ternatins A3, B4, B3, B2, and D2, from Clitoria ternatea flowers. J. Nat. Prod. 59, 139–144. Wang, L.S., Stoner, G.D., 2008. Anthocyanins and their role in cancer prevention. Cancer Lett. 269, 281–290.

215

Wu, X., Beecher, G.R., Holden, J.M., Haytowitz, D.B., Gebhardt, S.E., Prior, R.L., 2006. Concentrations of anthocyanins in common foods in the United States and estimation of normal consumption. J. Agric. Food Chem. 54, 4069–4075. Yang, Z., Zhai, W., 2010. Identification and antioxidant activity of anthocyanins extracted from the seed and cob of purple corn (Zea mays L.). Innovat. Food Sci. Emerg. Tech. 11, 169–176. Yongvanit, P., Pinlaor, S., Bartsch, H., 2012. Oxidative and nitrative DNA damage: key events in opisthorchiasis-induced carcinogenesis. Parasitol. Int. 61, 130–135. Zhu, Y., Ling, W., Guo, H., Song, F., Ye, Q., Zou, T., et al., 2013. Anti-inflammatory effect of purified dietary anthocyanin in adults with hypercholesterolemia: a randomized controlled trial. Nutr. Metab. Cardiovasc. Dis. 23, 843–849.