Analysis of the essentiality of ROM2 genes in the pathogenic yeasts Candida glabrata and Candida albicans using temperature-sensitive mutants.

Journal of Applied Microbiology ISSN 1364-5072

ORIGINAL ARTICLE

Analysis of the essentiality of ROM2 genes in the pathogenic yeasts Candida glabrata and Candida albicans using temperature-sensitive mutants T. Kanno, D. Takekawa and Y. Miyakawa Division of Biotechnology, Interdisciplinary Graduate School of Medicine and Engineering, University of Yamanashi, Kofu, Yamanashi, Japan

Keywords antifungal targets, Candida albicans, Candida glabrata, cell lysis, essential genes, point mutation, ROM2, temperature-sensitive mutants. Correspondence Yozo Miyakawa, Division of Biotechnology, Interdisciplinary Graduate School of Medicine and Engineering, University of Yamanashi, 4-4-37 Takeda, Kofu, Yamanashi 400-8510, Japan. E-mail: [email protected] 2014/1848: received 8 September 2014, revised 26 November 2014 and accepted 2 January 2015 doi:10.1111/jam.12745

Abstract Aims: To analyse the essentiality of the ROM2 genes originating from the pathogenic yeasts Candida glabrata and Candida albicans by using temperature-sensitive (ts) mutants. Methods and Results: Based on the general concepts that ts mutations are generated by virtue of point mutation within essential genes, we have previously established a novel method (termed ‘ETS system’ for screening and identification of essential genes using ts mutants of C. glabrata). According to this ETS system, the present study successfully identified a putative C. glabrata ROM2 homologue as an essential gene that complements its point mutation (Cys-1275/Tyr substitution). The C. albicans ROM2 mutant (Cys-1281/Tyr), constructed patterned after this point mutation, also displayed ts phenotype. Both ts mutants recovered colony-forming ability, with concomitant suppression of lysis phenotype, at the elevated temperature in the presence of 1 mol l1 sorbitol as an osmotic stabilizer. Sequence alignment revealed that human genome possesses relatively low homology against Rom2 homologues, which are highly conserved among yeast species. Conclusions: ROM2 genes of C. glabrata and C. albicans are essential for viability, probably involved in cell wall integrity. Significance and Impact of the Study: ROM2 genes essential for both Candida species may be a potentially useful antifungal targets from chemotherapeutic viewpoint.

Introduction Candida is a yeast-like fungus that is part of the normal microflora in the gut, vagina, skin and oral cavity of humans. In immunocompromised individuals, however, Candida can cause life-threating systemic infections. In particular, the incidence of Candida infections among immunosuppressed elderly and AIDS patients has recently increased and is a serious medical problem (Cassone and Cauda 2012). Severely immunocompromised transplant patients also display higher susceptibility to invasive fungal infections that are often fatal (Parize et al. 2012). In addition, cancer patients admitted to the intensive care unit typically have multiple risk factors for invasive fungal infections (Sipsas and Kontoyiannis 2012).

Although a number of effective antifungal drugs have been developed, they are often associated with severe side effects (Laniado-Laborin and Cabrales-Vargas 2009), and many strains of drug-resistant fungi now exist (Pfaller 2012). Due to these problems, there is a strong clinical need for the development of new and effective antifungal agents (Ascioglu et al. 2002; Gupta and Tomas 2003; Pfaller and Diekema 2007; Andes et al. 2012; Gow and Hube 2012; Testoni et al. 2012). Among medically important yeasts, the whole-genomic sequences of the diploid Candida albicans (Jones et al. 2004) and haploid Candida glabrata (Dujon et al. 2004) have been determined, and both species are therefore the focus of considerable gene function analyses. Candida possesses a number of potential virulence factors, including

Journal of Applied Microbiology 118, 851--863 © 2015 The Society for Applied Microbiology

851

ROM2 essentiality using ts mutants

T. Kanno et al.

catalase, which is involved in intracellular parasitism; an adhesive factor that mediates adherence to epithelial cells; a protease that facilitates tissue invasion and the ability to resist phagocytosis by changing its morphology from yeast to hyphal growth in response to environmental conditions particularly in C. albicans (Mayer et al. 2013). Although one of the host defense countermeasures against candidal infection is to inactivate these virulence factors, none of these inactivators is able to completely suppress fungal growth. Therefore, the development of potent fungicidal agents that target essential fungal genes (or their products) is desired. We consider that one of the extremely useful tools for wide scope of screening and identification of essential genes from total genomic DNAs is temperaturesensitive (ts) mutants; each of the genes that possesses the complementing ability for each ts mutation could be identified as an essential gene, as has been reported by a number of investigators using ts mutants originating from a variety of micro-organisms (Lindahl et al. 1971; Miyakawa and Komano 1981; Miyakawa et al. 1982; Sherman et al. 1986; Sadaie et al. 1991; Takamatsu et al. 1992; Ben-Aroya et al. 2008). To this end, we previously established a novel method termed ‘ETS system’ for the screening and identification of essential genes using ts mutants of the haploid yeast C. glabrata (Miyakawa et al. 2009). The ETS system is based on the general concepts that ts mutations are generated by virtue of point mutation within essential genes in the genome. Using this ETS-based screening procedure, we have identified several essential genes by complementation analyses, in which a C. glabrata genomic DNA library was used as a transformation donor and various ts mutants isolated in our laboratory were used as recipients. It has been reported that a ts mutant (named cly; cell lysis) of Saccharomyces cerevisiae defective in osmotic integrity at the nonpermissive temperature was rescued by the addition 1 mol l1 sorbitol, accompanied by suppression of cell lysis (Paravicini et al. 1992). In the present study, we focused attention to selective toxicity, as Candida possesses a cell wall, in contrast with mammalian cells. For this purpose a ts mutant (designated W12) expected to be defective in one of the genes involved in cell wall integrity was selected among ts mutants, growing ability of which was rescued by 1 mol l1 sorbitol at the nonpermissive temperature. By the analyses for mutant W-12 using the ETS system, we successfully identified C. glabrata ROM2 (designated CgROM2), a putative homologue of the S. cerevisiae ROM2 (ScROM2; Ozaki et al. 1996; Bickle et al. 1998; Torres et al. 2002), as an essential gene by complementation of a point mutation (Cys-1275/Tyr) within its coding region. In addition, to demonstrate the applicability of this result for the 852

C. glabrata in the related yeast C. albicans, we introduced the similar Cys to Try point mutation into the C. albicans ROM2 (CaROM2) and tested for acquisition of the ts phenotype. The importance of essentiality and selective cytotoxicity related to the ROM2 genes in both Candida species are discussed, particularly from the viewpoint of their molecular biological and clinical significance. Materials and methods Organisms, primers and media The strains and primers we used are described in detail in Tables 1 and 2, respectively. Saccharomyces cerevisiae BY24967 was provided by the National Bio-Resource Project (NBRP) of the MEXT, Japan. The culture conditions for YPD medium (Miyakawa 2000), YNB plates (Miyakawa et al. 2009) and Sabouraud glucose agar (SA) plates (Kagaya et al. 1989) that contain a 1 mol l1 sorbitol as osmotic stabilizer were as described. The permissive and nonpermissive temperature of ts mutant is 27 and 39°C, respectively, similarly to our previous study (Miyakawa et al. 2009). The yeast culture was maintained as stock in 50% glycerol at 80°C, throughout the research. Mutagenesis and isolation of ts mutant The methods of mutagenesis and isolation of ts mutants from the parental strain of C. glabrata (2001HT) were as described (Sherman et al. 1986; Miyakawa et al. 2009). Among a number of C. glabrata ts mutants isolated to date, we selected W-12 in the present study, which was able to restore colony-forming ability at the nonpermissive temperature in the presence of 1 mol l1 sorbitol, from the viewpoint of selective toxicity. Construction for the genomic DNA library of the Candida glabrata wild-type strain The genomic DNA library of C. glabrata was constructed using the Escherichia coli/C. glabrata-shuttle vector pCgACH-3, possessing CgHIS3, CgARS and CgCEN (provided by Dr Kitada) (Kitada et al. 1996), as a cloning vector, as described (Miyakawa et al. 2009). This DNA library was used as donor DNAs in the transformation experiments according to the lithium acetate method (Ito et al. 1983) for isolating the gene that confers growing ability at the nonpermissive temperature, 39°C, on each ts mutant by complementing the ts mutation. Other microbiological and molecular techniques were according to the standard procedures (Sherman et al. 1986; Sambrook et al. 1989).



T. Kanno et al.

these strains constructed was confirmed by PCR (Fig. 5B, D).

Complementation test Complementation test was performed by transformation experiments, where the ts mutant W-12 was used as a host and each of the various subclones (see Legend for Fig. 1a) as a donor, which was constructed using the plasmid pCgACH-3 as a vector. For construction of the donor plasmid containing the ScROM2, the 46-kb insert fragment with ScROM2 ORF of 4071 bp and its 50 and 30 flanking regions was PCR-amplified with primer pair P19/P-20 (in Table 2) from S. cerevisiae strain BY24967, and then, ligated to the vector pCgACH-3. Construction of the tetracycline (tet)-regulated strains in Candida glabrata and Candida albicans To examine the essentiality of the CgROM2 and CaROM2, we constructed the tet-regulated strains (designated CgROM2 tet, and CaROM2 tet, respectively) according to the procedure as described (Nakayama et al. 1998, 2000) (described in detail in Fig. 5A,C). Correct homologous recombination with the targeting vectors in

Real time RT-PCR in the tet-regulated strains The tet-regulated strains (CgROM2 tet and CaROM2 tet) were cultured to logarithmic growth phase in YPD 20 ml at 30°C, respectively. Then, each culture was divided into two halves; to one was added tetracycline derivative, doxycycline (Dox, SIGMA, MO), at the final concentration of 10 lg ml1, the other was untreated, and both were continuously shaken for 2 h. The total RNA of the tet-regulated strains was then extracted from these cell pellets, and cDNA was synthesized by reverse transcription of these total RNA using commercial kit (NucleoSpinâ RNA, PrimeScriptâ RT reagent kit with gDNA Eraser; TAKARA BIO INC., Shiga, Japan). RT-PCR (Thermal Cycler Diceâ Real Time System TP800, TAKARA BIO INC.) was performed with SYBR Green assay using kit (SYBRâ Premix Ex TaqTM II, TAKARA BIO INC.). Relative quantification was conducted by DDCt method. The actin gene, ACT1, was used as the

Table 1 Strains used in this study Strains

Parent strain

Relevant genotype and/or description

Source or reference

Candida glabrata 2001HT W-12 V-WT1 V-W12 GSS-W12 SROM-W12 V-T3 ACG4

CBS138 2001HT 2001HT W-12 W-12 W-12 T-3 2001HT

his3::URA3 trp1 ura3 2001HT rom2ts 2001HT carring pCgACH-3* W-12 carring pCgACH-3 W-12 carring pCgACH-3 with CgROM2 W-12 carring pCgACH-3 with ScROM2 T-3 (2001HT tem1 ts) carring pCgACH-3 his3 trp1 PScHOPZ::tetR::GAL4AD::TRP1 (constitutive transactivator-expressing strain) his3 trp1 PScHOPZ::tetR::GAL4AD::TRP1 rom2::97t-ROM2-HIS3

Kitada et al. (1995) This study This study This study This study This study Miyakawa et al. (2009) Nakayama et al. (1998)

URA3/ura3::imm434 ura3::imm434/ura3::imm434 ura3::imm434/ura3::imm434 ROM2/rom2::hisG-URA3-hisG ura3::imm434/ura3::imm434 ROM2/rom2::hisG BlM-H rom2ts BlM-H ROM2 ade2::hisG/ade2::hisG ura3::imm434/ura3::imm434 ENO1/eno1::ENO1-tetR-ScHAP4AD-39HA-ADE2 ade2::hisG/ade2::hisG ura3::imm434/ura3::imm434 ENO1/eno1::ENO1-tetR-ScHAP4AD-39HA-ADE2 ROM2/rom2::hisG-URA3-hisG ade2::hisG/ade2::hisG ura3::imm434/ura3::imm434 ENO1/eno1::ENO1-tetR-ScHAP4AD-39HA-ADE2 ROM2/rom2::hisG ade2::hisG/ade2::hisG ura3::imm434/ura3::imm434 ENO1/eno1::ENO1-tetR-ScHAP4AD-39HA-ADE2 rom2::hisG/rom2::97t-ROM2-URA3

Fonzi and Irwin (1993) Fonzi and Irwin (1993) This study This study This study This study Nakayama et al. (2000)

MATa/MATa ura3/ura3 leu2/leu2 his3/his3 trp1/trp1

NBRP

CgROM2 Tet Candida albicans CAF2 CAI4 BlM-U BlM-H ROM2 C/Y-1 ROM2 X-1 THE1

ACG4

SC5314 CAF2 CAI4 BlM-U BlM-H BlM-H CAI8

TheM-U

THE1

TheM-H

TheM-U

CaROM2 Tet

TheM-H

Saccharomyces cerevisiae BY24967

This study

This study This study This study

*pCgACH-3 (Kitada et al. 1996) is a E. coli-C. glabrata shattle vector with CgARS-CEN-His3 on the plasmid pUC19.


853


T. Kanno et al.

Table 2 Primers used in this Study Primers

Sequences*

CgROM2 Tet TcW12A-F1 (P-1) gcgccgcggtaccATATGACGTAGAAGTTT TcW12A-R2 (P-2) ccgtctagaTGCAAGTACTGCTCAGATACT TcW12B-F1 (P-3) gccgaattcGGAGTAATGGTGGATAATGTG TcW12B-R2 (P-4) gccggtaccGACGACTTAGCATGATGCATA BlM-H/TheM-H (heterozygous mutant) CaROM2C-F1 (P-5) gccaagcttACTTCTTGGTGGTGGTAGACA CaROM2C-R2 (P-6) gccggatccAGTTGGGTAAGGTTGTTGCAT CaROM2D-F3 (P-7) gccagatctCTTACTTGCTATCATTTGAAC CaROM2D-R4 (P-8) gccggtaccAATTCATCTTGCTCTCTTATT CaROM2 Tet TcCaROM2A-F1 (P-9) gccggtaccATTAACCTCCAATAGAAGGTG TcCaROM2A-R2 (P-10) gccgtcgacTACGGTTCCTACTACTACTAC TcCaROM2B-F3 (P-11) gccactagtATAATAATGTCGAGTAATAGT TcCaROM2B-R4 (P-12) gccccgcggtaccTGGGGTGACTGCGGATA ROM2 C/Y-1 CaROM2C2-F21 (P-13) gccaagcttGGTTAGGTAGTAATCAAGTTC CaROM2C2-R22 (P-14) AAATTCAGAATAATACAATAAGAAATCACG CaROM2C2-F23 (P-15) GATTTCTTATTGTATTATTCTGAATTTGTA CaROM2C2-R24 (P-16) ccgctgcagAATTCATCTTGCTCTCTTATT CaROM2D2-F26 (P-17) gccagatctTACGCGCGACAATAATTGCAA CaROM2D2-R27 (P-18) gccgagctcaagcttCCCAAGTAGGAATTG SROM-W12 ScROM2-F1 (P-19) ggcggatccACGGCCGAGTCTGTGAAACTG ScROM2-R4 (P-20) ggcaagcttgcatgcGTCATCAATCATTTG RT-PCR (ROM2)† CgROM2mRNA-F1 AACGAGAATGGTGCTTCCAG CgROM2mRNA-R2 ATGTGCCTCCAGGATTTGAC CaROM2mRNA-F1 TTTTCCCACTCCCATACCAC CaROM2mRNA-R2 TATGGTTGCAGAGGTTGCAG Others TcCgW12A-F11 (P-21) CTCAGCACGAGCAACATATCATAT TcCgW12B-R12 (P-22) TTGCCGCCCGCAGCTTCTCCTGGT CaROM2C-F12 (P-23) gcctctagaCATCAAACAAACGAGTGAAAC CaROM2D-R5 (P-24) GTCATGAGTCAATATCTACGAGTC TcCaROM2A-F6 (P-25) GGTTAGACGATTAAAGTTGTAACG TcCaROM2B-R5 (P-26) GCGCAATGTATGGCTGTTGAAGTC

Bases with bold italics are the point mutation sites introduced. *Underlined sequences are restriction sites.

internal control, and ROM2 expression values were normalized against ACT1 expression. The sequences of the RT-PCR primers are listed in Table 2. Construction of a ROM2 point mutant in Candida albicans A CaROM2 point mutant was constructed. After a heterozygous mutant strain (ROM2/rom2), designated BlMH, was derived from the parental strain CAI4 by URAblaster techniques (Fonzi and Irwin 1993), we integrated a point mutation (Cys-1281/Tyr), patterned after that of †[Correction added on 24 March 2015, after online publication: RT-PCR (ROM2) section was added in the table body.]

854

C. glabrata (Cys-1275/Tyr), into the CaROM2 coding region on the another allele by transformation through homologous recombination to generate a mutant (designated ROM2 C/Y-1) (Fig. 8a), according to the standard procedure for site-directed mutagenesis (Ho et al. 1989). The correct integration by homologous recombination was proved by sequence analysis throughout the whole region of the CaROM2 ORF, where no other mutations were detected (see Results; Fig. 8b,c). Analysis of cell lysis in Candida albicans Cell lysis was examined for colonies developed on agar plate with or without 1 mol l1 sorbitol by assaying the alkaline phosphatase activity released from the colonies as described (Cabib and Duran 1975). Briefly, four types of strains of C. albicans (shown in the legend for Fig. 9) were inoculated on two SA plates without sorbitol and one SA plate with 1 mol l1 sorbitol, and cultured for 18 h at 27°C. Thereafter, one of the SA plates without sorbitol was continuously incubated for 18 h at 27°C and the other two plates (with or without sorbitol) were shifted to 39°C and incubated for 18 h. These three plates were then overlaid with a soft agar containing p-nitrophenylphosphate (Wako, Osaka, Japan) as a substrate, incubated at 37°C for 1 h, and photographs were then taken. Lysed cells liberate alkaline phosphatase which gives rise to a yellow-coloured halo on and around colonies. Results Isolation of Candida glabrata mutants and characterization of mutant W-12 As starting materials in ETS-based procedure for screening of essential genes, we have isolated a number of ts mutants of C. glabrata that do not form colonies at 39°C. In the present study, we focused on one of these ts mutants (W-12) from the viewpoint of selective toxicity. The loss of colony-forming ability at 39°C of this mutant was clearly confirmed in the transformant (designated VW12) carrying the plasmid vector pCgACH-3 alone in W-12, in contrast with the wild-type C. glabrata strain (V-WT1) (Fig. 1a). A characteristic feature of the V-W12 mutant was the recovery of colony-forming ability at 39°C in the presence of 1 mol l1 sorbitol as an osmotic stabilizer (termed ‘sorbitol recovery’). Next, we examined the effects of the temperature shiftup to 39°C on growth of strains V-WT1 and V-W12. Although the growth of both strains was almost similar at 27°C, the growth of the mutant strain was severely impaired after the temperature shift-up to 39°C (Fig. 2). The optical density of the ts mutant culture reached a



T. Kanno et al.

39°C

27°C

(a)

Sorbitol (–) (b)

V-W12 GSSW12

V-T3

(a)

SROMW12

V-WT1

Sorbitol (+) ROM2 X-1

CAI4

V-T3

BIM-H

(b)

ROM2 C/Y-1

Figure 1 Loss and recovery of colony-forming ability in the ts mutants and transformants, respectively. (a) Five types of strains (in Table 1) were streaked on YNB agar plates (deprived of histidine) and cultured at the permissive (27°C) and the nonpermissive (39°C) temperature for 24 h. VWT1, wild-type; V-T3, ts mutant, negative control; V-W12, ts mutant, deposited as the DDBJ accession no. AB901367; GSS-W12, transformant of W-12 carrying the subcloned plasmid pGW12-SS (possessing CgROM2 as the complementing gene on pCgACH-3; see Fig. 3); SROM-W12, transformant of W-12 carrying the plasmid pScROM2 (see Materials and methods). (b) Five types of strains (in Table 1) were streaked on YNB agar plates containing uridine and cultured as above. CAI4, Candida albicans wild-type strain; BlM-H, heterozygous mutant (CaROM2/Carom2); ROM2 C/Y-1, ts mutant, deposited as the DDBJ accession no. AB901368 (see Fig. 8); V-T3, the same strain shown in (a) (as a negative reference); ROM2 X-1, non-ts strain without any mutation (shown as a positive control) (see Fig. 8b, c).

plateau at 2 h after the temperature shift (Fig. 2a), and accompanied by marked decrease in the percent survival of the cells (Fig. 2b). Identification of the gene that complements the ts mutation We attempted to isolate a gene that complements the ts mutation of strain W-12 by performing transformation experiments using a C. glabrata genomic DNA library. Three positive clones with a His+ phenotype and colonyforming ability at 39°C were obtained among approx. 21 000 colonies that formed on YNB agar plates at 27°C. Restriction enzyme digestion of the plasmids isolated from the three positive clones revealed that they contained common insert DNA based on the similar restriction enzyme patterns observed (data not shown). The plasmid with the smallest insert size (72 kb), designated pG-W12, was used as a donor to re-transform mutant W-12 cells, and was confirmed to successfully complement the ts mutation. The partial nucleotide sequence of the 72 kb insert fragment within this plasmid was determined by the di-

deoxy sequencing method. A BLAST search of the EMBL and GenBank databases using this sequence as a query revealed that this fragment was located on C. glabrata chromosome G (accession no. CR380953) (Fig. 3a). Then, we performed complementation tests using several subclones derived from this plasmid and found that a 499 kb Sal I-digested insert DNA fragment, designated pGW12-SS, was able to complement the ts phenotype (Fig. 3b): the transformant (designated GSS-W12) carrying this plasmid clearly exhibited restored colony-forming ability at 39°C (Fig. 1a). DNA sequence analyses using GENETYX software (GENETYX Corporation, Tokyo, Japan) showed that the insert fragment of pGW12-SS contained an open reading frame (ORF) that corresponded to nucleotide positions 464644– 468750 on chromosome G and encoded a predicted peptide of 1369 amino acids (accession no. XP_446572). The amino acid sequence of the predicted protein was highly homologous (88% similarity and 65% identity) to ScRom2 (accession no. NP_013475), a protein which acts upon the cell wall damage or plasma membrane stress (Torres et al. 2002), suggesting that the inserted DNA in


855


T. Kanno et al.

the plasmid pGW12-SS encodes a putative CgROM2. This suggestion was supported by the result of our transformation experiment with W-12, in which the DNA fragment containing the ScROM2 ORF with its 50 and 30 flanking regions was used as a donor, showing that the ScROM2 gene also possesses the ability to complement the ts defect of our mutant W-12 (indicated as SROM-W12 in Fig. 1a).

(a)

OD600

1

0·1 0

(b)

1

2

3

Growth of the disrupted strain and the tet-regulated strain in Candida glabrata and Candida albicans

Survival ratio

10

1

0·1

0

1

2 3 Time after shift up (h)

4

Figure 2 Cell growth after temperature shift-up in liquid culture. The cultures of strains of wild-type (V-WT1) and ts mutant W-12 (V-W12) were logarithmically grown, with shaking at 27°C in YPD medium and half of each culture was shifted up to 39°C and another half left at 27°C (as a control) when the optical density (OD) at 600 nm of each culture reached 01 (at time 0). Then, the OD600 (a) and the percentage survival, calculated as (the CFU ml1 at the time indicated ⁄ the CFU ml1 at time 0 in each culture) 9 100 (b), were monitored during the cultivation for 4 h. (○) V-WT1-27°C; (M) V-W12-27°C; (●) V-WT1-39°C and (▲) V-W12-39°C. The CFU ml1 values of the strains V-WT1 and V-W12 at an OD600 of 01 correspond to 63 9 106 ml1 and 59 9 106 ml1, respectively. The values are from a single representative experiment in a series of three independent experiments.

856

We analysed the complete nucleotide sequence of the DNA region in mutant W-12 corresponding to the ORF of the ROM2 homologue and determined that the ORF contained a point mutation at nucleotide position 3824 (with nucleotide position 1 assigned to the Met start codon, as predicted using GENETYX software). Specifically, the sequence TGT (corresponding the codon Cys-1275 in the wild-type strain) was mutated to TAT (Tyr-1275) in W-12 (Fig. 4). To confirm that the DNA region surrounding this point mutation was important for the Rom2 function in C. glabrata, we aligned the amino acid sequences of putative Rom2 homologues from the yeast species C. glabrata, C. albicans, S. cerevisiae, Kluyveromyces lactis, including the Homo sapiens sequence, which possesses the highest similarity to that of CgRom2 among human genome sequences (Fig. 4). The alignment showed that the entire region of Rom2 homologues, including the region surrounding the point mutation site (indicated by the arrow in Fig. 4), was highly conserved among these yeast species, but less homologous to that of H. sapiens.

4

100

0·01

Alignment of CgRom2 with yeast homologues and identification of the ts mutation site

The above results suggested that CgROM2 was essential and that point mutation of this gene resulted in a severe growth defect at the elevated temperature. Therefore, we attempted to confirm the essentiality of this gene by the tet system using the tet-regulated strain (Fig. 5). However, this strain did not exhibit growth suppression in the presence of Dox (Fig. 6). A similar result was obtained in C. albicans (Fig. 6). These findings suggest a possibility that the ROM2 gene is nonessential in both Candida species. However, repeated attempts to disrupt ROM2 by homologous recombination for the generation of a null mutant (rom2/rom2) were unsuccessful, although a heterozygous (ROM2/ rom2) mutant was obtained at high frequency (data not shown). In addition, we examined by RT-PCR whether the tet-regulated strain suppresses ROM2 mRNA expression in the presence of Dox. The results showed that CgROM2 mRNA expression in the presence of Dox was suppressed to approx. 1/8 level as compared to that in the absence of Dox (Fig. 7a), suggesting the marked suppression of ROM2 mRNA expression by the addition of Dox. A marked suppression was also observed in the similar analyses for CaROM2 mRNA expression in the C. albicans tet-regulated strain: showing approx. 1/20-level of suppression



T. Kanno et al.

by the Dox addition (Fig. 7b). Therefore, ROM2 mRNA expression in the tet-regulated strains was confirmed to be markedly suppressed by the addition of Dox in both C. glabrata and C. albicans.

(a)

Construction of a Candida albicans ts mutant with a point mutation Based on the fact that the C. glabrata strain with a point mutation (Cys-1275/Tyr) exhibited temperature sensitivity

B S

pG-W12

SK

(b) Subclone

B

Cg ROM2 (4·1 kb)

S

Complementation +

S

pGW12-SS K pGW12-K

–

Figure 3 Restriction map of pG-W12 and results of complementation. (a) Restriction map of the pG-W12 insert: the ORF for CgROM2 (open box) with its flanking regions (horizontal thick bar, 72 kb in length). The arrow under the open box represents the orientation of the transcript. B, BamH I; S, Sal I; K, Kpn I. BamH I sites (located within the multicloning sites of the vector pCgACH-3) were represented only for those at the both ends of the pG-W12 insert. (b) Results of complementation. Each of the subclones derived from pG-W12 was used for complementation test. (+), complemented; (), not complemented.

Figure 4 Results of multiple alignments of the deduced amino acid sequences of CgRom2 with the putative Rom2 homologues of the other yeast species. The amino acid sequences of the homologues shown were derived from Cg, Candida glabrata, accession no. XP_446572; Ca, Candida albicans, accession no. XP_721146; Sc, Saccharomyces cerevisiae, accession no. NP_013475; Kl, Kluyveromyces lactis, accession no. XP_451877; Hs, Homo sapiens, accession no. NP_001040625. The identical amino acids among all of and more than three-fifths of the proteins aligned here are denoted by black and grey, respectively. The point mutation detected in the present study (indicated by a black arrow) was Cys (C)-1275 in the C. glabrata wild-type strain replaced to Tyr (Y) in the ts mutant strain W-12.


857


T. Kanno et al.

(A)

Transactivator P-21

(B)

ATG

TATA

CgROM2-ORF

(a) (b)

P-22

ACG4 A

TR promoter

CgHIS3

P-1

P-2

B

P-3

Homologous recombination

His+

P-21

P-4

kb 3·1 1·64

selection

ATG

TATA A

CgHIS3

TR promoter

B

CgROM2-ORF P-22

CgROM2 Tet (tet regulated strain) (C) Allele-1 Allele-2

C

hisG

CaURA3

hisG

D

ATG

TATA

CaROM2-ORF

TheM-U

5-FOA Selection

(D)

(c) (d) kb

P-23

1

C

hisG P-6 P-7

P-5 ATG

P-23 TATA

2

4·83 2·35

D P-24

P-8

CaROM2-ORF

P-24

TheM-H Substitution of endogeneous promoter with TR promoter (d) (e) C

1

hisG

kb

D

ATG

P-25

TATA

2

CaROM2-ORF P-26

3·0 1·49

TheM-H A P-9

TR promoter

CaURA3 P-10

Homologous recombination

1

C

TATA

A

P-12

Ura+ selection

hisG

D

P-25

2

B

P-11

CaURA3

TR promoter

ATG B

Ca ROM2-ORF P-26

CaROM2 Tet (tet regulated strain)

Figure 5 Generation of the tet-regulated strains in the Candida glabrata and Candida albicans. Schematic model of homologous recombination in C. glabrata (A) and C. albicans (C). Photographs for confirmation of the tet-regulated strain by PCR in C. glabrata (B) and C. albicans (D). Strains in each lane and PCR product length: (a), C. glabrata parent, ACG4. Product length amplified with primer pair P-21/P-22 (in Table 2), 164 kb; (b), CgROM2 Tet. Product length amplified with the same primer pair, 31 kb; (c), C. albicans parent, THE1. Product length amplified with primer pair P-23/P-24, 483 kb; (d), heterozygous mutant, TheM-H (CaROM2/Carom2). Product length amplified with P-23/P-24, 483 and 235 kb, and that with P-25/P-26, 149 kb; (e), CaROM2 Tet. Product length amplified with P-25/P-26, 30 kb.

858



T. Kanno et al.

and that the growth at the elevated temperature was recovered in the presence of 1 mol l1 sorbitol (Fig. 1a), we examined whether a similar point mutation in C. albicans would result in a ts phenotype. We constructed a C. albicans mutant (ROM2 C/Y-1) with a point mutation (Cys-1281/Tyr), patterned after that of C. glabrata (Cys1275/Tyr) (Fig. 8). The growth analysis showed that this mutant ROM2 C/Y-1(deposited as DDBJ accession no. AB901368) exhibited temperature sensitivity and concomitantly accompanied by ‘sorbitol recovery’ (Fig. 1b), similar to the case of the C. glabrata mutant (V-W12) (Fig. 1a). Taken together, these results suggest the essentiality of the ROM2 gene in these two Candida species and loss of function of the ROM2 gene product in these ts mutants at the elevated temperature, likely due to conformation changes in the relevant protein.

in contrast with the control strains without ts mutation, ROM2 X-1, heterozygous mutant BlM-H (CaROM2/ Carom2) and wild-type strain CAI4 (Fig. 9-a,b,d). However, lysis phenotype of this ts mutant was almost suppressed in the presence of 1 mol l1 sorbitol at 39°C. Moreover, such a lysis phenotype was clearly confirmed in C. glabrata ts mutant V-W12 (data not shown). Therefore, we consider that cell lysis in these ts mutants at the elevated temperature (Fig. 9) resulted in the growth defect, leading to the loss of colony-forming ability under the restrictive culture conditions (Fig. 1). Discussion In our previous study, we established a novel method (ETS system) for the screening and identification of essential genes in C. glabrata using ts mutants. Here, we focused on the ts mutant W-12, which is expected to be defective in a gene conferring cell wall integrity, and applied the efficacy of this system to identify suitable targets for selective toxicity. According to the procedure in the ETS system, we successfully identified a putative homologue of ScROM2, which was 41 kb in length (Fig. 3), and determined to be an essential gene by the complementation of a ts point mutation (TGT to TAT, corresponding to a Cys-1275/Tyr substitution).

Lysis phenotype in ts mutants As for the C. albicans ts mutant (ROM2 C/Y-1) mentioned above, we examined whether the growth defect at the elevated temperature of this strain was caused by cell lysis, according to the method for assaying the alkaline phosphatase activity released from the colonies developed on agar plates. The results showed that cells of this mutant (Fig. 9-c) released alkaline phosphatase at 39°C,

Dox (+)

Dox (–) Figure 6 Analysis of ROM2 essentiality by tet system in Candida glabrata and Candida albicans. CgROM2 Tet and CaROM2 Tet are tet strains constructed (see Fig. 5). CgTEF3, originally 99TEF3 (Nakayama et al. 1998) (gifted by Dr Nakayama) is a reference strain in which Dox exhibits suppressive effect on cell survival (‘Dox-positive’ strain). CCG5320 (gifted by Dr Chibana) is a reference strain for ‘Dox-negative’.

CaROM2 Tet CgTEF3

CgROM2 Tet

36 h

CCG5320

54 h

(b) 0·2

Relative quantity (2nd derivative max.)

Figure 7 Relative quantity of ROM2 expression by RT-PCR. Results of Candida glabrata (a) and Candida albicans (b) were shown. The values obtained are the average of three experiments. Error bars represent the corresponding standard error.

Relative quantity (2nd derivative max.)

(a)

0·16 0·12 0·08 0·04 0

Dox (–)


Dox (+)

0·2 0·16 0·12 0·08 0·04 0

Dox (–)

Dox (+)

859


T. Kanno et al.

sponding point mutation site (Fig. 4 arrow) is also highly conserved among the related yeast species (Fig. 4). The C. albicans mutant (ROM2 C/Y-1) with a point mutation Cys-1281/Tyr in CaRom2, constructed patterned after this C. glabrata ts mutant, also exhibited ts phenotype. Moreover, both ts mutants recovered colony-forming ability, concomitantly accompanied by suppression of cell lysis phenotype at the elevated temperature in the presence of 1 mol l1 sorbitol (Fig 1 and 9). In S. cerevisiae, rom2 mutant has been reported to exhibit cell lysis phenotype (Ozaki et al. 1996). These results suggest that rom2 mutation in C. glabrata and C. albicans is involved in cell wall integrity, similarly to the case of S. cerevisiae mutant of cly15ts, which also exhibited lysis phenotype (Paravicini et al. 1992). In addition, we failed to obtain a null mutant (rom2/rom2) of C. albicans using an URA-blaster technique (Fonzi and Irwin 1993) despite repeated attempts, although a heterozygous (ROM2/rom2) mutant was obtained at high frequency (data not shown). These lines of evidence suggest that ROM2 genes are essential in both C. glabrata and C. albicans. As ScRom2 is involved in cell wall integrity (Bickle et al. 1998), the ts mutants of C. glabrata and C. albicans are considered to be nonviable at 39°C, probably due to impaired regulation of cell wall integrity. However, based on the finding that ScROM2 (Ozaki et al. 1996) is not required for cell viability at lower temperature, an alternative interpretation may be possible that ROM2 is not essential in C. glabrata, and potentially act as suppressor of a specific gene. In S. cerevisiae, ScRom2 functions as a RHO1 multicopy suppressor (‘ROM’ means RHO1 multicopy suppressor), and RHO1 dominant-negative mutation is suppressed by overexpression of ROM2. Moreover, cells containing a double mutation in ROM1 and ROM2 are nonviable. These findings suggest that the C. glabrata mutant W-12 may have a RHO1 dominant-negative mutation or a defect in ROM1 in addition to the point mutation of ROM2. However, this possibility can be ruled out because a dominant-negative mutation could never occur

(a)

(b)

(c)

Figure 8 Construction of a Candida albicans mutant (ROM2 C/Y-1) with a point mutation (Cys-1281/Tyr; arrows), patterned after that of Candida glabrata (Cys-1275/Tyr). (a) Position of point mutation within CaROM2-ORF. A control strain without any mutation (ROM2 X-1) was also constructed by homologous recombination. Results of sequence analysis (b) and alignment (c) were shown. Bases with underlines and bold type on alignment (c) indicate the triplet codon and the site corresponding to the point mutation (Cys/Tyr), respectively (see Fig. 1b for the experimental results of the effect of this point mutation on cell growth and ‘sorbitol recovery’).

Amino acid sequence alignments showed that Rom2 homologues are highly conserved among yeast species and that the amino acid sequence surrounding the corre27°C

39°C

d

c

b

a

d

c

b

a

a

b

c

d

a

b

c

d

Sorbitol (–)

d

c

b

a

Sorbitol (+)

a

860

b

c

d

Figure 9 Cell lysis phenotype of Candida albicans examined by assaying the alkaline phosphatase activity released from the colonies: (a); CAI4, (b); BlM-H, (c); ROM2 C/ Y-1, (d); ROM2 X-1.



T. Kanno et al.

in a haploid yeast such as C. glabrata, and moreover, ROM1 does not exist in this organism (and also in C. albicans), according to the Candida Genome Database (http:// www.candidagenome.org/). The tet system (Nakayama et al. 1998, 2000) is a highly useful method to investigate the essentiality of target genes. Roemer and colleagues (Roemer et al. 2003; Becker et al. 2010) established a modified tet system termed GRACE, which has facilitated the rapid and large-scale analyses of the essentiality of a number of C. albicans target genes. In the present study, we applied the tet system to examine the essentiality of the CgROM2 and CaROM2 (Fig. 6); however, we obtained the results which were apparently conflicting to those obtained by using the ETS system (Fig. 1 and 8). The apparent inconsistency between these systems is most likely due to the fundamental differences between them. Namely, the tet system suppresses ‘expression’ of the target gene by the addition of tetracycline, whereas the ETS system suppresses the ‘function’ of the target gene product immediately after a temperature shift-up. Therefore, it is highly possible that the suppressive effect of Dox addition in the tet system on cell growth would require a long lag time if the target gene product has a large intracellular pool size, extremely slow turnover rate, or was only required in extremely low amounts to support growth. In contrast, in the ETS system, because the target gene product is inactivated by the temperature shift-up (likely due to a conformation change of the relevant gene product with a point mutation), its function is immediately and directly inhibited. Consistent with this speculation, the percent survival of mutant (W-12) cells started to decrease only at 1 h after the temperature shift-up (Fig. 2b). However, further experiments are required for more strict understanding for the difference in time effect between tet and ETS analyses; e.g., the experiments to test the pool size or the turnover rate of the relevant Rom2 protein. Our results of RT-PCR analyses described above, showing the marked suppression of ROM2 mRNA expression by Dox addition (Fig. 7a, b), suggest that approx. 90 and 95% loss of ROM2 mRNA expression does not cause growth suppression in the tet-regulated strains of both C. glabrata and C. albicans, respectively. The results also showed that relative expression level of ROM2 mRNA was significantly lower than that of ACT1 mRNA both in the presence or absence of Dox, suggesting a possibility that quite a low level of Rom2 protein molecules is enough to maintain viability in these Candida species. These results suggest, at least in part, a reason why ROM2 essentiality could not be proved under the experimental conditions for the present tet system. Finally, we would like to emphasize that our present study showed that the temperature-sensitive phenotype of

the C. glabrata and C. albicans ROM2 gene mutants and their lysis phenotype at the elevated temperature were recovered by 1 mol l1 sorbitol addition, suggesting that the ROM2 gene is involved in cell wall integrity in both yeast species. Moreover, sequence alignment of CgRom2 with the human polypeptide (deposited as accession no. NP_001040625), which possesses the highest similarity to the CgRom2 among human genome sequences, revealed that only 2/5 part of the entire CgRom2 sequence has relatively high (approx. 60%) similarity to the human polypeptide sequence and the remaining 3/5 part has almost no similarity. Sequence alignment also revealed that none of the homologous region is observed between the human polypeptide sequence mentioned above and the region surrounding the point mutation sites detected in the present study. This region with the point mutation is highly conserved among fungal species (Fig. 4). Based on these lines of evidence, ROM2 is considered to be a potentially useful antifungal target from the viewpoint of selective toxicity. Therefore, some compounds that possess the ability to suppress the expression of ROM2 or the function of the gene product would be chemotherapeutically invaluable candidates for antifungal agents. Acknowledgements We sincerely thank Dr W. A. Fonzi (Georgetown University) for providing the strains CAI4 and CAF2, Dr H. Nakayama (Suzuka University of Medical Science) for providing the strain 99TEF3, Dr K. Kitada (Chugai Pharmaceutical Co. Ltd.) for providing the strains 2001HT, ACG4 and THE1, and the plasmid pCgACH-3 and Dr H. Chibana (Chiba University) for providing the strain CCG5320. Conflict of Interest The authors declare that they have no conflicts of interest. References Andes, D.R., Safdar, N., Baddley, J.W., Playford, G., Reboli, A.C., Rex, J.H., Sobel, J.D., Pappas, P.G. et al. (2012) Impact of treatment strategy on outcomes in patients with candidemia and other forms of invasive candidiasis: a patient-level quantitative review of randomized trials. Clin Infect Dis 54, 1110–1122. Ascioglu, S., Rex, J.H., de Pauw, B., Bennett, J.E., Bille, J., Crokaert, F., Denning, D.W., Donnelly, J.P. et al. (2002) Defining opportunistic invasive fungal infections in immunocompromised patients with cancer and hematopoietic stem cell transplants: an international consensus. Clin Infect Dis 34, 7–14.


861


T. Kanno et al.

Becker, J.M., Kauffman, S.J., Hauser, M., Huang, L., Lin, M., Sillaots, S., Jiang, B., Xu, D. et al. (2010) Pathway analysis of Candida albicans survival and virulence determinants in a murine infection model. Proc Natl Acad Sci U S A 107, 22044–22049. Ben-Aroya, S., Coombes, C., Kwok, T., O’Donnell, K.A., Boeke, J.D. and Hieter, P. (2008) Toward a comprehensive temperature-sensitive mutant repository of the essential genes of Saccharomyces cerevisiae. Mol Cell 30, 248–258. Bickle, M., Delley, P.A., Schmidt, A. and Hall, M.N. (1998) Cell wall integrity modulates RHO1 activity via the exchange factor ROM2. EMBO J 17, 2235–2245. Cabib, E. and Duran, A. (1975) Simple and sensitive procedure for screening yeast mutants that lyse at nonpermissive temperatures. J Bacteriol 124, 1604–1606. Cassone, A. and Cauda, R. (2012) Candida and candidiasis in HIV-infected patients: where commensalism, opportunistic behavior and frank pathogenicity lose their borders. AIDS 26, 1457–1472. Dujon, B., Sherman, D., Fischer, G., Durrens, P., Casaregola, S., Lafontaine, I., De Montigny, J., Marck, C. et al. (2004) Genome evolution in yeasts. Nature 430, 35–44. Fonzi, W.A. and Irwin, M.Y. (1993) Isogenic strain construction and gene mapping in Candida albicans. Genetics 134, 717–728. Gow, N.A. and Hube, B. (2012) Importance of the Candida albicans cell wall during commensalism and infection. Curr Opin Microbiol 15, 406–412. Gupta, A.K. and Tomas, E. (2003) New antifungal agents. Dermatol Clin 21, 565–576. Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K. and Pease, L.R. (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59. Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol 153, 163–168. Jones, T., Federspiel, N.A., Chibana, H., Dungan, J., Kalman, S., Magee, B.B., Newport, G., Thorstenson, Y.R. et al. (2004) The diploid genome sequence of Candida albicans. Proc Natl Acad Sci U S A 101, 7329–7334. Kagaya, K., Miyakawa, Y., Fujihara, H., Suzuki, M., Soe, G. and Fukazawa, Y. (1989) Immunologic significance of diverse specificity of monoclonal antibodies against mannans of Candida albicans. J Immunol 143, 3353– 3358. Kitada, K., Yamaguchi, E. and Arisawa, M. (1995) Cloning of the Candida glabrata TRP1 and HIS3 genes, and construction of their disruptant strains by sequential integrative transformation. Gene 165, 203–206. Kitada, K., Yamaguchi, E. and Arisawa, M. (1996) Isolation of a Candida glabrata centromere and its use in construction of plasmid vectors. Gene 175, 105–108. Laniado-Laborin, R. and Cabrales-Vargas, M.N. (2009) Amphotericin B: side effects and toxicity. Rev Iberoam Micol 26, 223–227.

862

Lindahl, G., Hirota, Y. and Jacob, F. (1971) On the process of cellular division in Escherichia coli: replication of the bacterial chromosome under control of prophage P2. Proc Natl Acad Sci U S A 68, 2407–2411. Mayer, F.L., Wilson, D. and Hube, B. (2013) Candida albicans pathogenicity mechanisms. Virulence 4, 119–128. Miyakawa, Y. (2000) Identification of a Candida albicans homologue of the PHO85 gene, a negative regulator of the PHO system in Saccharomyces cerevisiae. Yeast 16, 1045– 1051. Miyakawa, Y. and Komano, T. (1981) Study on the cell cycle of Bacillus subtilis using temperature-sensitive mutants. I. Isolation and genetic analysis of the mutants defective in septum formation. Mol Gen Genet 181, 207–214. Miyakawa, Y., Komano, T. and Maruyama, Y. (1982) Timed action of the gene products required for septum formation in the cell cycle of Bacillus subtilis. J Bacteriol 149, 673–680. Miyakawa, Y., Hara, T. and Iimura, Y. (2009) Establishment of a screening system for essential genes from the pathogenic yeast Candida glabrata: identification of a putative TEM1 homologue. Lett Appl Microbiol 49, 317–323. Nakayama, H., Izuta, M., Nagahashi, S., Sihta, E.Y., Sato, Y., Yamazaki, T., Arisawa, M. and Kitada, K. (1998) A controllable gene-expression system for the pathogenic fungus Candida glabrata. Microbiology 144(Pt 9), 2407– 2415. Nakayama, H., Mio, T., Nagahashi, S., Kokado, M., Arisawa, M. and Aoki, Y. (2000) Tetracycline-regulatable system to tightly control gene expression in the pathogenic fungus Candida albicans. Infect Immun 68, 6712–6719. Ozaki, K., Tanaka, K., Imamura, H., Hihara, T., Kameyama, T., Nonaka, H., Hirano, H., Matsuura, Y. et al. (1996) Rom1p and Rom2p are GDP/GTP exchange proteins (GEPs) for the Rho1p small GTP binding protein in Saccharomyces cerevisiae. EMBO J 15, 2196–2207. Paravicini, G., Cooper, M., Friedli, L., Smith, D.J., Carpentier, J.L., Klig, L.S. and Payton, M.A. (1992) The osmotic integrity of the yeast cell requires a functional PKC1 gene product. Mol Cell Biol 12, 4896–4905. Parize, P., Rammaert, B. and Lortholary, O. (2012) Emerging invasive fungal diseases in transplantation. Curr Infect Dis Rep 14, 668–675. Pfaller, M.A. (2012) Antifungal drug resistance: mechanisms, epidemiology, and consequences for treatment. Am J Med 125, S3–S13. Pfaller, M.A. and Diekema, D.J. (2007) Epidemiology of invasive candidiasis: a persistent public health problem. Clin Microbiol Rev 20, 133–163. Roemer, T., Jiang, B., Davison, J., Ketela, T., Veillette, K., Breton, A., Tandia, F., Linteau, A. et al. (2003) Large-scale essential gene identification in Candida albicans and applications to antifungal drug discovery. Mol Microbiol 50, 167–181. Sadaie, Y., Takamatsu, H., Nakamura, K. and Yamane, K. (1991) Sequencing reveals similarity of the wild-type div+



T. Kanno et al.

gene of Bacillus subtilis to the Escherichia coli secA gene. Gene 98, 101–105. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Sherman, F., Fink, G.R. and Hicks, J.B. (1986) Laboratory Course Manual for Methods in Yeast Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Sipsas, N.V. and Kontoyiannis, D.P. (2012) Invasive fungal infections in patients with cancer in the intensive care unit. Int J Antimicrob Agents 39, 464–471.

Takamatsu, H., Fuma, S., Nakamura, K., Sadaie, Y., Shinkai, A., Matsuyama, S., Mizushima, S. and Yamane, K. (1992) In vivo and in vitro characterization of the secA gene product of Bacillus subtilis. J Bacteriol 174, 4308–4316. Testoni, D., Smith, P.B. and Benjamin, D.K. Jr (2012) The use of antifungal therapy in neonatal intensive care. Clin Perinatol 39, 83–98. Torres, J., Di Como, C.J., Herrero, E. and De La Torre-Ruiz, M.A. (2002) Regulation of the cell integrity pathway by rapamycin-sensitive TOR function in budding yeast. J Biol Chem 277, 43495–43504.


863

In vitro effect of amphotericin B on Candida albicans, Candida glabrata and Candida parapsilosis biofilm formation.

Virulence of Candida albicans mutants.

Disruption analysis of metallothionein-encoding genes in Candida glabrata.

Effect of tyrosol on adhesion of Candida albicans and Candida glabrata to acrylic surfaces.

Differential response of Candida albicans and Candida glabrata to oxidative and nitrosative stresses.

Genome-Wide Chromatin Immunoprecipitation in Candida albicans and Other Yeasts.

Propargyl-linked antifolates are dual inhibitors of Candida albicans and Candida glabrata.

Analysis of the Candida albicans Phosphoproteome.

Codon utilisation in the pathogenic yeast, Candida albicans.

Candida glabrata Binding to Candida albicans Hyphae Enables Its Development in Oropharyngeal Candidiasis.

Exploring ecological modelling to investigate factors governing the colonization success in nosocomial environment of Candida albicans and other pathogenic yeasts.

The transcriptome of Candida albicans mitochondria and the evolution of organellar transcription units in yeasts.

Neutrophil activation by Candida glabrata but not Candida albicans promotes fungal uptake by monocytes.

Stress response and expression of fluconazole resistance associated genes in the pathogenic yeast Candida glabrata deleted in the CgPDR16 gene.

Pathogenicity of Candida albicans auxotrophic mutants in experimental infections.

Two echinocandin-resistant Candida glabrata FKS mutants from South Africa.

Fibronectin-, vitronectin- and laminin-binding proteins at the cell walls of Candida parapsilosis and Candida tropicalis pathogenic yeasts.

Susceptibility of Candida albicans and Candida glabrata biofilms to silver nanoparticles in intermediate and mature development phases.

Molecular epidemiology of Candida albicans and Candida glabrata strains isolated from intensive care unit patients in Poland.

Candida glabrata perinephric abscess.

Comparative phenotypic analysis of the major fungal pathogens Candida parapsilosis and Candida albicans.

Genetic interactions among homologous recombination mutants in Candida albicans.

Comparative antifungal susceptibility analysis of Candida albicans versus non-albicans Candida corneal isolates.

Mechanism underlying renal failure caused by pathogenic Candida albicans infection.