Proc. Nati. Acad. Sci. USA Vol. 88, pp. 6853-6857, August 1991 Genetics
Analysis of the enhancer element that controls expression of sevenless in the developing Drosophila eye (eye development/gene regulation/protein-tyrosine kinase/receptor)
DAVID D. L. BOWTELL*, THOMAS LILA, W. MATTHEW MICHAEL, DAVID HACKETT, AND GERALD M. RUBIN Howard Hughes Medical Institute and Department of Molecular and Cell Biology, University of California at Berkeley, Berkeley, CA 94720
Contributed by Gerald M. Rubin, May 10, 1991
The sevenless gene encodes a protein-tyrosine ABSTRACT kinase receptor expressed in a complex pattern during the development of the Drosophila melanogaster eye. We have previously shown that this pattern is regulated transcriptionally by an enhancer located in the body of the sevenless gene. Here we extend our analysis of the sevenless enhancer, defining a 475-base-pair fragment that contains elements necessary for the correct qualitative and quantitative expression of the sevenless gene. Within this fragment are sequence elements conserved in the sevenless gene of a distantly related Drosophila species and protected from DNase I digestion by nuclear extracts isolated from adult heads and imaginal discs. Partial deletions of the 475-base-pair fragment result in preferential loss of expression in different subsets of cells. These results suggest that the normal pattern of expression is generated by the combined action of separate cell-specific regulatory elements.
Pattern formation can be studied at the level of individual cells in the developing eye of Drosophila melanogaster. The adult eye consists of several hundred unit eyes or ommatidia, each containing eight photoreceptor cells and nonneuronal support cells. The precursors of photoreceptor and nonneuronal cells can be identified and their expression of specific genes can be correlated with their ultimate differentiated cell fates (for review, see ref. 1). Several genes involved in eye development have been identified and characterized, including sevenless, which is required for R7 photoreceptor cell development. The sevenless gene encodes a member of the protein-tyrosine kinase superfamily that is thought to transduce the intercellular signals required to direct a cell into the R7 photoreceptor pathway (for review, see ref. 2). The sevenless protein is expressed transiently in a subset of cells, with the onset of expression coincident with the earliest stages of ommatidial formation (3, 4). Conditional expression of the sevenless gene using the heat shock protein 70 (hsp7O) promoter has shown that there is only a brief period in which the precursor of the R7 cell requires and can utilize sevenless protein (5, 6). Thus, although some aspects of the complex pattern of sevenless expression appear to be dispensible for proper development of the R7 cell, it is clear that the timing of expression in the R7 precursor is critical. The expression patterns of a number of genes required for Drosophila eye development, seven-up (7), rough (8), and scabrous (9), share with sevenless certain basic features: a sharp onset of expression at or just prior to the first overt signs of pattern formation and maintained expression in a more restricted subset of cells. An understanding of the way in which sevenless expression is regulated could provide a model for how complex patterns of gene expression are generated in the developing Drosophila eye. In addition, The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
dissection of sevenless cis-regulatory sequences should provide a route to the isolation of transcription factors that regulate some of the earliest stages of cellular differentiation in the eye. To determine initially whether the pattern of sevenless expression is regulated transcriptionally or post-transcriptionally, we (10) and others (11) coupled sevenless regulatory sequences to the reporter gene lacZ and showed that transcriptional regulation of the sevenless gene could account fully for the pattern of sevenless protein expression in the developing eye. In addition, these experiments identified an enhancer located in the body of the sevenless gene that is necessary for correct qualitative and quantitative expression of sevenless protein and sufficient to confer this expression pattern on a heterologous promoter. Here we present a further analysis of the cis-regulatory sequences present in the enhancer. We have identified a region of 475 base pairs (bp) that confers the correct pattern of expression on a reporter gene. This fragment contains sequence elements conserved in the sevenless gene of a distantly related Drosophila species and sites that are protected from DNase I digestion by proteins present in Drosophila tissue-specific nuclear extracts. Our mutational analysis of this 475-bp fragment suggests that the sevenless pattern of expression is generated by the combined contributions of cell-specific regulatory elements within the enhancer fragment.
MATERIALS AND METHODS DNA Manipulations. Fragments of an 8.2-kilobase (kb) EcoRV genomic fragment containing the enhancer element (10) were first cloned between the Not I sites of the vector pHSX (K. Jones and G.M.R., unpublished data). For the initial deletion series (constructs 1-9), fragments were isolated from this genomic fragment using convenient restriction enzyme sites. Smaller fragments (constructs 10-19) were generated by the polymerase chain reaction (PCR; ref. 12). Site-directed mutagenesis of the enhancer-containing fragment (constructs 20-24) was performed using a two-step PCR protocol (13). Mutagenesis of DNase I-protected regions 1-4 (see Fig. 4) was performed using oligonucleotides that maximized the number of mismatches without altering the nucleotide number or composition of the region. For regions 5 to 6, the protected sequences shown in Fig. 4 were deleted and replaced with a 6-bp linker that included the Xba I restriction enzyme site. The structures of PCR-derived fragments were confirmed by DNA sequencing and they were cloned between the Not I sites of pHSX. Not I fragments were isolated and introduced into the Not I site of a modified version of the P-element vector pDM30, which contains a hsp7O promoter fused to lacZ (10). Germ-line transformants bearing the above *Present address: Howard Florey Institute of Experimental Physiology and Medicine, University of Melbourne, Victoria 3052, Australia.
6853
Genetics: Bowtell et al.
6854
Proc. Natl. Acad. Sci. USA 88 (1991)
constructs were obtained as described (10). A minimum of three transformant lines were examined for each construct. Histochemistry and Immunochemistry. Eye discs from late third instar larvae were removed and stained either histochemically with 5-bromo-4-chloro-3-indolyl /3-D-galactopyranoside or with an anti-,f-galactosidase antibody (Promega) as described (10). DNase I Protection Analysis. The fragments 181-521 and 499-733 (numbers refer to coordinates described in Fig. 1 where 0 is the first adenine of the Bgl II site) were end-labeled (14). Nuclear extracts, crude or enriched using heparin sulfate chromatography, were prepared from adult Drosophila heads or mass-isolated third instar imaginal discs (15) essentially as described (14). DNase I protection reactions were performed by first incubating probe DNA (20 counts per sec) with total nuclear extract protein (10-100 ,g) in a solution consisting of 4% (vol/vol) poly(vinyl alcohol), 25 mM Hepes (pH 7.6), 50 mM KCI, 0.05 mM EDTA, 6.25 mM MgCl2, 5% (vol/vol) glycerol, and 0.05 mM dithiothreitol for 5 min at 0°C. Digestions with DNase I were performed at a concentration empirically determined to give partial cleavage of the probe DNA at 0°C for 1 min in a solution containing 5 mM MgCl2 and 2.5 mM CaC12. The reaction was halted and the products were analyzed as described (14).
RESULTS AND DISCUSSION Deletion Analysis Defmes a Minimal Enhancer Fragment in the Body of the sevenless Gene. To localize the enhancer A
PRIMARY DELETION SERIES
Starting fragment El
C
Reporter construct
E3-E7_
E2
r
ATG 7.
element within the 8.2-kb EcoRV fragment, a series of deletion constructs was assayed for the ability to confer the sevenless pattern of expression on a lacZ reporter gene (Fig. LA). Eye imaginal discs were removed from late third instar larvae, a stage when sevenless protein is strongly expressed in a complex pattern throughout the posterior half of the eye disc (3, 10). To estimate the level of lacZ expression, eye imaginal discs from the individual transformant lines were analyzed by histochemical staining with 5-bromo-4-chloro3-indolyl f-D-galactopyranoside. It was possible to clearly distinguish larvae heterozygous from those homozygous for each construct, indicating that differences of 50% or more in expression could be detected readily using this assay. The cell specificity of expression was analyzed using antibodies to (3-galactosidase. This primary deletion series localized essential sequences in the enhancer element to a 1-kb fragment including the 3' end of intron 2, exon 3, and intron 3 (Fig. 1A). These results are consistent with our previous observation that the absence of these introns results in poor sevenless expression (16). A second series of deletions was then constructed to further define the sevenless enhancer. The starting DNA for these experiments was a 2168-bp Bgl II-EcoRV fragment in which the EcoRV site corresponds to the 3' end of the original 8.2-kb EcoRV fragment; the Bgl II site was assigned coordinate 0. The results of this analysis are summarized in Fig. 1B. The cell specificity of S3-galactosidase expression in the eye discs of transformant larvae bearing a 475-bp fragment
lacZ
hsp 70 9302 -
1 053
3233
2: WILD TYPE
3851
3: WILD TYPE
5493 3233-3851 6305 7134 3233 81 52
1053
5: WILD TYPE 6: WILD TYPE 7: WILD TYPE
8: NO EXPRESSION 9: NO EXPRESSION
2 4622
6
E
4: WILD TYPE
6305
4
1: WILD TYPE
CRITICAL BASES
B
SECONDARY DELETION SERIES
Ii
423-499
E4
BgflI 0 (7134)
E5
--
151 5 866
N
N
EcoRV E 21 68 10: WILD TYPE
11: WILD TYPE
-
584
E7
1131-1527 1593-1833 --- ---- 1899--- -in
.
447
E6
955-1021
H ,N
- 1KW111
12: WILD TYPE
6399 13: WILD TYPE 14: REDUCED, ESPECIALLY IN R3 & R4 15: NO EXPRESSION
258
3 16: WILD TYPE 341
423
*
49
19: EXPRESSION REDUCED AND LIMITED TO UNKNOWN CELL TYPE
CRITICAL BASES 181
17: [VARIABLE, REDUCED ESPECIALLY 18: [IN R7 &CONE CELLS
521 FRAGMENTS USED FOR DNASE
499
733
PROTECTION ASSAYS
FIG. 1. Identification of a minimal enhancer fragment by deletion analysis. (A) Primary deletion series of enhancer fragment shown (10) to confer the correct pattern of sevenless expres.0 on a hsp7O promoter-lacZ reporter gene. *sion e ; Deletions in the 8.2-kb EcoRV starting fragment, which extends from exon 1 to exon 7 of the sevenless gene, were initially made in 1- to 2-kb steps. Critical enhancer sequences appear to be located in sequences flanking exon 3, in the region common to constructs 6 and 7. (B) A second round of deletions made at 100-bp intervals identified a minimal fragment of 475 bp (construct 16). The vertical bars indicate regions with a high degree of sequence similarity to D. virilis (see text and Fig. 4). (C) Histochemical staining to detect expression of ,3-galactosidase in a whole-mount eye imaginal disc from a third instar larva bearing the 475-bp fragment (construct 16). Arrows here and in D and E indicate the position of a furrow (morphogenetic furrow) '410 ^ *v^ _ found at the boundary between the developing ommatidia and the remaining unpatterned epithelium. Expression is limited to posterior to the morphogenetic furrow as with the 8.2-kb EcoRV fragment (see ref. 10). Although difficult to quantitate precisely, the level of expression was the same or slightly less than with the 8.2-kb fragment. (D and E) Comparison of the patterns of /3-galactosidase expression in eye imaginal discs from larvae bearing the 8.2-kb fragment (D) and the 475-bp enhancer fragment (E) as determined by anti-/3-galactosidase antibody staining. The cell-specific pattern of expression in the larva bearing the 475-bp fragment is indistinguishable from that obtained with the 8.2-kb fragment. (C, x70; D and E, x550.)
Genetics: Bowtell
et
al.
Proc. Natl. Acad. Sci. USA 88 (1991)
(construct 16) was indistinguishable from those carrying the 8.2-kb EcoRV fragment; expression was temporally modulated and limited to a subset of cells, beginning with the so-called "mystery cells" (3) and cells R3 and R4, followed by cell R7 and finally the cone cells (Fig. 1 D and E). This pattern corresponds closely to the normal distribution of sevenless protein (3), indicating that the cis-regulatory enhancer elements necessary and sufficient for correct quantitative and qualitative expression of the sevenless gene in eye imaginal discs are located between coordinates 259 and 733. Further deletion of sequences contained in this 475-bp enhancer fragment reduced expression preferentially in subsets of expressing cells. Deletion of an additional 115 bp from the 3' end of the enhancer fragment (construct 14) resulted in a preferential decrease in expression in R3, R4, and the mystery cells (Fig. 2 B and G). Eye imaginal discs from larvae bearing one copy of construct 14 showed an almost complete absence of staining with 5-bromo-4-chloro-3-indolyl /-Dgalactopyranoside adjacent to the morphogenetic furrow, consistent with loss of the contribution that cells R3, R4, and the mystery cells make to the expression pattern in this region of the disc (compare Fig. 2 A and B). Antibody staining confirmed that expression was substantially reduced in R3, R4, and the mystery cells, although some residual expression remained (Fig. 2G). Deletion of a further 137 bp (construct 15) abolished expression in all cells (Fig. 2C). An 83-bp deletion made from the 5' boundary of the 475-bp fragment (construct 17) altered the cell-specific pattern of expression in a roughly reciprocal manner. Eye discs from larvae bearing construct 17 showed a general reduction of expression, particularly in R7 and the cone cells. Activity staining was strongest adjacent to the morphogenetic furrow and faded out near the posterior edge ofthe eye disc (compare Fig. 2 E and D). Antibody staining revealed that 83-galacto-
At
6855
sidase was mainly expressed in R3 and R4, although some residual expression persisted in other cell types (Fig. 2H). Deletion of an additional 82 bp (construct 18) did not substantially effect the activity of the enhancer element further. Deletion of a further 76 bp (construct 19) altered the pattern of expression in an unexpected way. Activity staining was most intense in the region of the morphogenetic furrow, suggesting that expression was limited to R3 and R4 (Fig. 2F). However, antibody staining revealed that the IacZ reporter gene was expressed in a previously unidentified cell type that sends a cytoplasmic extension to the apical surface forming a "V" shape adjacent to R3 and R4 (Fig. 21). The nuclei of these cells are located at the basal surface, where they are arranged in imprecisely spaced pairs (Fig. 2J). This staining pattern was observed in all four lines examined and was also found, expressed at a higher level, in two lines bearing a construct containing three copies of this fragment in tandem (data not shown). This effect of deleting nucleotides 423-499 was unexpected since this deletion removes only the third exon of sevenless and none of the flanking intronic sequences (see Fig. 1B). This observation suggests either that regulatory sequences and protein coding sequences are contained within exon 3 or that bringing the enhancer sequence closer to flanking DNA in the P-element vector affects the activity of the enhancer. The high degree of reproducibility with which this pattern was obtained in different transformant lines excludes the possibility that it is due to the position of insertion in the genome of the transgene. The final developmental fate of the expressing cells has not been determined. DNase I Protection Analysis of the 475-bp Enhancer Identifies Several Protected Regions. Nuclear extracts were prepared from two sources: adult heads, where sevenless is normally expressed, and mass isolated imaginal discs, of which eye discs represented 5-10% of the total. These
D
{*"'iV;.
'K.. I
AM^ C.i... t's;.XE Aw
F
^
:1
J
t FIG. 2. Comparison of p-galactosidase expression in the eye discs of larvae bearing constructs in which the 475-bp enhancer fragment (coordinates 258-733) has been progressively deleted. In A-F expression of P-galactosidase was analyzed by histochemical staining and in G-J expression was analyzed using anti-,3-galactosidase antibodies. The arrows mark the position of the morphogenetic furrow. (A-C) Progressive deletion from 3' end. (A) Eye disc from a larva bearing construct 13 (coordinates 0-699; see Fig. 1B) showed a normal pattern of expression. (B) Eye disc from a larva bearing construct 14 (coordinates 0-584) showed a marked decrease in staining immediately posterior to the morphogenetic furrow. Antibody staining (G) showed that this corresponds to reduced expression in mystery cell(s) and cells R3 and R4 (see Fig. 1E for comparison). (C) Further deletion construct 15 (coordinates 0-447) abolished expression. (D-F) Progressive deletion from the 5' end. (D) Eye disc from larva bearing construct 16 (coordinates 258-733) showed a normal pattern of expression. (E) Deletion of 83 bp (construct 17; coordinates 341-733) resulted in a large reduction in expression with staining fading out toward the posterior edge of the disc. Antibody staining (H) showed that expression of f3-galactosidase was only clearly detectable in cells R3 and R4. The overall level of expression in the eye discs of larvae bearing this construct was greatly reduced; staining was barely detectable in heterozygous larvae. This pattern was detected in two out of three lines examined. Deletion of an additional 82 bp (construct 18) did not substantially affect expression further; four out of six lines displayed the pattern shown in H. (F) Further deletion (construct 19; coordinates 499-733) resulted in an unusual pattern of expression. Staining was apparent immediately posterior to the morphogenetic furrow; however, antibody staining showed that this was due to expression in an unidentified cell type that sends cytoplasmic extensions to the apical surface, just anterior to R3 and R4 (I) (open arrow). The nuclei of these cells lie basally in the eye disc (J) and are found in imprecisely spaced pairs (open arrow). All eye discs shown, except those in A and H, are from larvae heterozygous for the construct. (A-F, x90; C-J, x350.)
6856
Genetics: Bowtell
et
al.
.-
Proc. Natl. Acad. Sci. USA 88 (1991)
extracts were used in DNase I-protection studies on two fragments that together encompass the 475-bp enhancer fragment (see Fig. 1B). Six protected regions were identified using the adult head extract (Fig. 3) and two of these were also weakly protected with the total imaginal disc extract. The sequences of the protected regions are not homologous to any previously identified transcription factor binding sites and are not repeated within the enhancer fragment. Comparison of D. melanogaster and Drosophila viruis sevenless Genes Reveals Conserved Sequences Within the 475-bp Enhancer. The sequence of sevenless gene from the distantly related Drosophila species D. virilis and D. melanogaster were compared to detect any conservation within the enhancer. This approach has been very useful in identifying important cis-regulatory regions in other Drosophila genes (17, 18). The second and third introns of D. virilis are several times larger than those in D. melanogaster and bear little overall sequence similarity (ref. 19 and data not shown). However, within the 475-bp enhancer, there are several regions with a high degree of similarity to sequences in the third intron of D. virilis. The three areas with the highest degrees of similarity, excluding exon 3, coincide with protected regions 1-3 (Fig. 4). The largest block extends more than 74 bp near the 3' end of the enhancer and includes the region that when deleted results in reduced expression in R3, R4, and the mystery cells (Figs. 2B and 4). The regions of similarity in the D. virilis third intron occur in the same order as those in the D. melanogaster fragment but are imbedded in large blocks of nonhomologous sequences. Comparison of the available intron 2 sequences from D. virilis and D. melanogaster identified weaker similarities for protected regions 4 and 5 but not in adjacent sequences of intron 2 (Fig. 4). There are no areas of obvious sequence conservation that were not protected in the DNase I footprinting experiments. Site-Directed Mutagenesis of Sequences Within the Enhancer. Protection of the above regions and their conservation in D. virilis suggests that these sequences play an important role as cis-acting elements required for enhancer function. To test this possibility, we performed site-directed mutagenesis on the individual protected areas, using a 928-bp fragment (coordinates 0-928; see Fig. 1B) as the template. The altered sequences are shown in Fig. 4. Larvae bearing the mutagenized fragments were tested for changes in their expression patterns both histochemically and using anti-,3galactosidase antibodies. Despite their sequence conservation and protection with nuclear extracts, mutation in any one
Hezad A C-
a? >E Z
Total disc
G:
2
C
Z
No 4 -
1
....... ._...
o
G
B
5
2~= 6
5
_
4uk."" *A-
......
...
;615K I-R
.. .
I
_
V_-_1 ~_
St...
a
II
I# -
_
.
'!'4Eb.' _
_
-
4
-...._
....
'...... FIG. 3. DNase I protection of two fragments encompassing the 475-bp enhancer region. (A) Four protected regions were apparent using the end-labeled fragment 499-733 (see Fig. 1B for position of this fragment relative to the enhancer fragment) and 100 ,ug or 10 ,g of total nuclear protein extract made from adult heads. (B) Two additional protected regions were seen with the probe 181-521 (see Fig. 1B). (C and D) Protection of regions 5 and 6 by the addition of 100 ,g of heparin sulfate-enriched nuclear protein from total imaginal discs to the probe 181-521, labeled on its 3' end (C) or 5' end (D). Protection of regions 1-4 was not apparent with imaginal disc extracts (data not shown). The nucleotide sequence of these protected regions is shown in Fig. 4. Lanes: NP, no protein control; M, marker lane; 100 ,g and 10 ,ug, amount of extract added. Areas of protection are indicated by vertical lines and are numbered; arrows indicate regions with increased sensitivity to cleavage with DNase I.
of the six protected regions failed to have any discernable effect on either the level or cell specificity of expression (data not shown). This result is particularly surprising given that
259 t
#16-wild
#17-reduced, especially
Q
type
TTTATATGGCCATTGCTATATTGTTTTLT
AATATATjgjA
GAC
in R7 and cone cells (D TCAGCTTTTTCCCACGCAAACTCACCdCAACTTCCGTTCCCAAGTGACCAAAAT;AATAC
TTcTATATAaGCtCAatTATATGT 208 231
(72
AA-TACTAAA
389 EXON 3 ITCTTTcACATTTTCATTGTAATTA.T' TCCTTTCCCCTTTTCCAGGAGGATCTGTTTCTGGACGAATTTGGAATACAGTGCGAAAAGGCGGACAATGGCGAGAAGTGCTACAAAACACGAG 411- n r,expression
4358
_
1
1
#14-reduced especially in R3 & R4
1
TAAGTCGAAGACATTGGGGAGCCGGCATTGAAATGGGATAGGATCGTTAAGTCGGGTAATCCGATACCATTGTTCGCTTTGGATTAACCATCAATTGGACA TTTGGATTAACCACaCCAGTT AAGTCGcGTAATtgGAaACCAcctTTCa 2086 Q 2107 26 641c I9 2686
( ) r
|CTCAAAGTGCA
J
#13-wild type
TGAGGAAGCCATCGAAGAGGATCTTCATGAGC TCCCTCTT 1pTCCTCTGCCAGTP PTTCTCCTTCTCAGCAA U .
CTCAAAGTGCATcAggCgCgGCCAaTCGTgCTCCagCTCCAgaCAgCaaAGGAAaCCgTCGAA 2874
CTTGT
TTGcAtACGAA 2801
TCGATCTTGTCGTCCTGG
GAaCTCCCTCTTtCT-GTT 3427 3444
~~~~~~~~~~~~~~~~~~~733
FIG. 4. Nucleotide sequence of the minimal enhancer fragment (coordinates 259-733) is shown. Boxed regions indicate protected regions on the sense (upper box) or opposite strand (lower box) of DNA for each of the regions shown in Fig. 3. Regions with a high degree of similarity to the D. virilis gene are shown below the D. melanogaster sequence. Their numbers indicate their position in the available D. virilis sequence for this region (ref. 19; GenBank accession no. M34544), which starts 1896 bp from the 5' end of exon 3. Regions with a high degree of similarity were found predominantly within the 475-bp enhancer fragment; the three most similar (excluding the coding sequences of exon 3) encompass protected regions 1-3. Deletion of this portion of the enhancer resulted in decreased expression preferentially in R3, R4, and the mystery cells (see text and Fig. 2B). Solid and open arrows indicate the boundaries of 5' -* 3' and 3' -* 5' deletions, respectively; their construct number and resultant phenotypes are indicated. Heavy underlines indicate the bases that were altered in the site-directed mutant constructs (see text).
Genetics: Bowtell
et
al.
protected regions 1-3 cover a large part of the region that when deleted results in reduced R3 and R4 expression and that this region is also highly conserved in D. virilis (see Fig. 4). These results suggest that there is a degree of redundancy in the enhancer element so that changes in a single site do not have any discernable effect, that the assays used are not sufficiently sensitive to detect changes in expression, or that essential sites for expression in eye imaginal discs were not identified by DNase I protection and sequence comparisons with D. viriis. Concluding Remarks. We have localized sequences necessary for the correct level and pattern of expression of the sevenless gene to a 475-bp region spanning the third exon. Sequences within this fragment are conserved in D. virilis and protected from DNase I digestion by nuclear extracts, suggesting that they bind trans-acting factors required for enhancer function. Deletion of several of these sites and some flanking sequences, but not mutation of individual sites alone, resulted in a preferential reduction of the normal pattern of expression either in the mystery cells, R3, and R4 or in R7 and the cone cells. Although imperfect, this reciprocal reduction in expression suggests that elements at each end of the enhancer confer expression predominantly in a subset of sevenless-expressing cells and that it is the combined action of these elements that generates the dynamic cell-specific expression pattern of the sevenless gene. In this respect, the organization of the sevenless enhancer appears to resemble the modular structure of enhancer elements in genes such as fushi tarazu (20), even-skipped (21), and alcohol dehydrogenase (22). In these cases, the combined effect of several elements produces in the developing animal a complex pattern of gene expression. We are indebted to Karen Perkins, Betsy O'Neill, and Ulrike Heberlein for advice and for providing the adult head and imaginal disc nuclear extracts. We thank members of the Rubin laboratory for
Proc. Natl. Acad. Sci. USA 88 (1991)
6857
their helpful comments during the preparation of this manuscript. D.D.L.B. is a C. J. Martin Fellow. 1. Tomlinson, A. (1988) Development 104, 183-193. 2. Rubin, G. M. (1989) Cell 57, 519-520. 3. Tomlinson, A., Bowtell, D. D. L., Hafen, E. & Rubin, G. M. (1987) Cell 51, 143-150. 4. Banerjee, U., Renfranz, P. J., Hinton, D. R., Rabin, B. A. & Benzer, S. (1987) Cell 51, 151-158. 5. Bowtell, D. D. L., Simon, M. A. & Rubin, G. M. (1989) Cell 56, 931-936. 6. Basler, K. & Hafen, E. (1989) Science 243, 931-934. 7. Mlodzik, M., Hiromi, Y., Weber, U., Goodman, C. S. & Rubin, G. M. (1990) Cell 60, 211-224. 8. Kimmel, B. E., Heberlein, U. & Rubin, G. M. (1990) Genes Dev. 4, 712-727. 9. Mlodzik, M., Baker, N. E. & Rubin, G. M. (1990) Genes Dev. 4, 1848-1861. 10. Bowtell, D. D. L., Kimmel, B. E., Simon, M. A. & Rubin, G. M. (1989) Proc. Natl. Acad. Sci. USA 86, 6245-6249. 11. Basler, K., Siegrist, P. & Hafen, E. (1989) EMBO J. 8, 2381-2386. 12. Saiki, R., Scharf, S., Faloona, F., Mullis, K., Horn, G., Erlich, H. A. & Amheim, N. (1985) Science 230, 1350. 13. Higuchi, R., Krummel, B. & Saiki, R. K. (1988) Nucleic Acids Res. 16, 7351. 14. Heberlein, U., England, B. & Tjian, R. (1989) Cell 41, 965-977. 15. Eugene, 0. E., Yund, M. A. & Fristrom, J. W. (1979) Tissue Cult. Assoc. Man. 5, 1053-1062. 16. Bowtell, D. D. L., Simon, M. A. & Rubin, G. M. (1988) Genes Dev. 2, 620-634. 17. Scholnick, S. B., Bray, S. J., Morgan, B. A., McCormick, C. A. & Hirsh, J. (1986) Science 234, 998-1002. 18. Fortini, M. E. & Rubin, G. M. (1990) Genes Dev. 4, 444-463. 19. Michael, W. M., Bowtell, D. D. L. & Rubin, G. M. (1990) Proc. Natl. Acad. Sci. USA 87, 5351-5353. 20. Hiromi, Y. & Gehring, W. J. (1987) Cell 50, 963-974. 21. Goto, T., Macdonald, P. & Maniatis, T. (1989) Cell 57, 413-422. 22. Fischer, J. A. & Maniatis, T. (1988) Cell 53, 451-461.
Analysis of the enhancer element that controls expression of sevenless in the developing Drosophila eye (eye development/gene regulation/protein-tyrosine kinase/receptor)
DAVID D. L. BOWTELL*, THOMAS LILA, W. MATTHEW MICHAEL, DAVID HACKETT, AND GERALD M. RUBIN Howard Hughes Medical Institute and Department of Molecular and Cell Biology, University of California at Berkeley, Berkeley, CA 94720
Contributed by Gerald M. Rubin, May 10, 1991
The sevenless gene encodes a protein-tyrosine ABSTRACT kinase receptor expressed in a complex pattern during the development of the Drosophila melanogaster eye. We have previously shown that this pattern is regulated transcriptionally by an enhancer located in the body of the sevenless gene. Here we extend our analysis of the sevenless enhancer, defining a 475-base-pair fragment that contains elements necessary for the correct qualitative and quantitative expression of the sevenless gene. Within this fragment are sequence elements conserved in the sevenless gene of a distantly related Drosophila species and protected from DNase I digestion by nuclear extracts isolated from adult heads and imaginal discs. Partial deletions of the 475-base-pair fragment result in preferential loss of expression in different subsets of cells. These results suggest that the normal pattern of expression is generated by the combined action of separate cell-specific regulatory elements.
Pattern formation can be studied at the level of individual cells in the developing eye of Drosophila melanogaster. The adult eye consists of several hundred unit eyes or ommatidia, each containing eight photoreceptor cells and nonneuronal support cells. The precursors of photoreceptor and nonneuronal cells can be identified and their expression of specific genes can be correlated with their ultimate differentiated cell fates (for review, see ref. 1). Several genes involved in eye development have been identified and characterized, including sevenless, which is required for R7 photoreceptor cell development. The sevenless gene encodes a member of the protein-tyrosine kinase superfamily that is thought to transduce the intercellular signals required to direct a cell into the R7 photoreceptor pathway (for review, see ref. 2). The sevenless protein is expressed transiently in a subset of cells, with the onset of expression coincident with the earliest stages of ommatidial formation (3, 4). Conditional expression of the sevenless gene using the heat shock protein 70 (hsp7O) promoter has shown that there is only a brief period in which the precursor of the R7 cell requires and can utilize sevenless protein (5, 6). Thus, although some aspects of the complex pattern of sevenless expression appear to be dispensible for proper development of the R7 cell, it is clear that the timing of expression in the R7 precursor is critical. The expression patterns of a number of genes required for Drosophila eye development, seven-up (7), rough (8), and scabrous (9), share with sevenless certain basic features: a sharp onset of expression at or just prior to the first overt signs of pattern formation and maintained expression in a more restricted subset of cells. An understanding of the way in which sevenless expression is regulated could provide a model for how complex patterns of gene expression are generated in the developing Drosophila eye. In addition, The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
dissection of sevenless cis-regulatory sequences should provide a route to the isolation of transcription factors that regulate some of the earliest stages of cellular differentiation in the eye. To determine initially whether the pattern of sevenless expression is regulated transcriptionally or post-transcriptionally, we (10) and others (11) coupled sevenless regulatory sequences to the reporter gene lacZ and showed that transcriptional regulation of the sevenless gene could account fully for the pattern of sevenless protein expression in the developing eye. In addition, these experiments identified an enhancer located in the body of the sevenless gene that is necessary for correct qualitative and quantitative expression of sevenless protein and sufficient to confer this expression pattern on a heterologous promoter. Here we present a further analysis of the cis-regulatory sequences present in the enhancer. We have identified a region of 475 base pairs (bp) that confers the correct pattern of expression on a reporter gene. This fragment contains sequence elements conserved in the sevenless gene of a distantly related Drosophila species and sites that are protected from DNase I digestion by proteins present in Drosophila tissue-specific nuclear extracts. Our mutational analysis of this 475-bp fragment suggests that the sevenless pattern of expression is generated by the combined contributions of cell-specific regulatory elements within the enhancer fragment.
MATERIALS AND METHODS DNA Manipulations. Fragments of an 8.2-kilobase (kb) EcoRV genomic fragment containing the enhancer element (10) were first cloned between the Not I sites of the vector pHSX (K. Jones and G.M.R., unpublished data). For the initial deletion series (constructs 1-9), fragments were isolated from this genomic fragment using convenient restriction enzyme sites. Smaller fragments (constructs 10-19) were generated by the polymerase chain reaction (PCR; ref. 12). Site-directed mutagenesis of the enhancer-containing fragment (constructs 20-24) was performed using a two-step PCR protocol (13). Mutagenesis of DNase I-protected regions 1-4 (see Fig. 4) was performed using oligonucleotides that maximized the number of mismatches without altering the nucleotide number or composition of the region. For regions 5 to 6, the protected sequences shown in Fig. 4 were deleted and replaced with a 6-bp linker that included the Xba I restriction enzyme site. The structures of PCR-derived fragments were confirmed by DNA sequencing and they were cloned between the Not I sites of pHSX. Not I fragments were isolated and introduced into the Not I site of a modified version of the P-element vector pDM30, which contains a hsp7O promoter fused to lacZ (10). Germ-line transformants bearing the above *Present address: Howard Florey Institute of Experimental Physiology and Medicine, University of Melbourne, Victoria 3052, Australia.
6853
Genetics: Bowtell et al.
6854
Proc. Natl. Acad. Sci. USA 88 (1991)
constructs were obtained as described (10). A minimum of three transformant lines were examined for each construct. Histochemistry and Immunochemistry. Eye discs from late third instar larvae were removed and stained either histochemically with 5-bromo-4-chloro-3-indolyl /3-D-galactopyranoside or with an anti-,f-galactosidase antibody (Promega) as described (10). DNase I Protection Analysis. The fragments 181-521 and 499-733 (numbers refer to coordinates described in Fig. 1 where 0 is the first adenine of the Bgl II site) were end-labeled (14). Nuclear extracts, crude or enriched using heparin sulfate chromatography, were prepared from adult Drosophila heads or mass-isolated third instar imaginal discs (15) essentially as described (14). DNase I protection reactions were performed by first incubating probe DNA (20 counts per sec) with total nuclear extract protein (10-100 ,g) in a solution consisting of 4% (vol/vol) poly(vinyl alcohol), 25 mM Hepes (pH 7.6), 50 mM KCI, 0.05 mM EDTA, 6.25 mM MgCl2, 5% (vol/vol) glycerol, and 0.05 mM dithiothreitol for 5 min at 0°C. Digestions with DNase I were performed at a concentration empirically determined to give partial cleavage of the probe DNA at 0°C for 1 min in a solution containing 5 mM MgCl2 and 2.5 mM CaC12. The reaction was halted and the products were analyzed as described (14).
RESULTS AND DISCUSSION Deletion Analysis Defmes a Minimal Enhancer Fragment in the Body of the sevenless Gene. To localize the enhancer A
PRIMARY DELETION SERIES
Starting fragment El
C
Reporter construct
E3-E7_
E2
r
ATG 7.
element within the 8.2-kb EcoRV fragment, a series of deletion constructs was assayed for the ability to confer the sevenless pattern of expression on a lacZ reporter gene (Fig. LA). Eye imaginal discs were removed from late third instar larvae, a stage when sevenless protein is strongly expressed in a complex pattern throughout the posterior half of the eye disc (3, 10). To estimate the level of lacZ expression, eye imaginal discs from the individual transformant lines were analyzed by histochemical staining with 5-bromo-4-chloro3-indolyl f-D-galactopyranoside. It was possible to clearly distinguish larvae heterozygous from those homozygous for each construct, indicating that differences of 50% or more in expression could be detected readily using this assay. The cell specificity of expression was analyzed using antibodies to (3-galactosidase. This primary deletion series localized essential sequences in the enhancer element to a 1-kb fragment including the 3' end of intron 2, exon 3, and intron 3 (Fig. 1A). These results are consistent with our previous observation that the absence of these introns results in poor sevenless expression (16). A second series of deletions was then constructed to further define the sevenless enhancer. The starting DNA for these experiments was a 2168-bp Bgl II-EcoRV fragment in which the EcoRV site corresponds to the 3' end of the original 8.2-kb EcoRV fragment; the Bgl II site was assigned coordinate 0. The results of this analysis are summarized in Fig. 1B. The cell specificity of S3-galactosidase expression in the eye discs of transformant larvae bearing a 475-bp fragment
lacZ
hsp 70 9302 -
1 053
3233
2: WILD TYPE
3851
3: WILD TYPE
5493 3233-3851 6305 7134 3233 81 52
1053
5: WILD TYPE 6: WILD TYPE 7: WILD TYPE
8: NO EXPRESSION 9: NO EXPRESSION
2 4622
6
E
4: WILD TYPE
6305
4
1: WILD TYPE
CRITICAL BASES
B
SECONDARY DELETION SERIES
Ii
423-499
E4
BgflI 0 (7134)
E5
--
151 5 866
N
N
EcoRV E 21 68 10: WILD TYPE
11: WILD TYPE
-
584
E7
1131-1527 1593-1833 --- ---- 1899--- -in
.
447
E6
955-1021
H ,N
- 1KW111
12: WILD TYPE
6399 13: WILD TYPE 14: REDUCED, ESPECIALLY IN R3 & R4 15: NO EXPRESSION
258
3 16: WILD TYPE 341
423
*
49
19: EXPRESSION REDUCED AND LIMITED TO UNKNOWN CELL TYPE
CRITICAL BASES 181
17: [VARIABLE, REDUCED ESPECIALLY 18: [IN R7 &CONE CELLS
521 FRAGMENTS USED FOR DNASE
499
733
PROTECTION ASSAYS
FIG. 1. Identification of a minimal enhancer fragment by deletion analysis. (A) Primary deletion series of enhancer fragment shown (10) to confer the correct pattern of sevenless expres.0 on a hsp7O promoter-lacZ reporter gene. *sion e ; Deletions in the 8.2-kb EcoRV starting fragment, which extends from exon 1 to exon 7 of the sevenless gene, were initially made in 1- to 2-kb steps. Critical enhancer sequences appear to be located in sequences flanking exon 3, in the region common to constructs 6 and 7. (B) A second round of deletions made at 100-bp intervals identified a minimal fragment of 475 bp (construct 16). The vertical bars indicate regions with a high degree of sequence similarity to D. virilis (see text and Fig. 4). (C) Histochemical staining to detect expression of ,3-galactosidase in a whole-mount eye imaginal disc from a third instar larva bearing the 475-bp fragment (construct 16). Arrows here and in D and E indicate the position of a furrow (morphogenetic furrow) '410 ^ *v^ _ found at the boundary between the developing ommatidia and the remaining unpatterned epithelium. Expression is limited to posterior to the morphogenetic furrow as with the 8.2-kb EcoRV fragment (see ref. 10). Although difficult to quantitate precisely, the level of expression was the same or slightly less than with the 8.2-kb fragment. (D and E) Comparison of the patterns of /3-galactosidase expression in eye imaginal discs from larvae bearing the 8.2-kb fragment (D) and the 475-bp enhancer fragment (E) as determined by anti-/3-galactosidase antibody staining. The cell-specific pattern of expression in the larva bearing the 475-bp fragment is indistinguishable from that obtained with the 8.2-kb fragment. (C, x70; D and E, x550.)
Genetics: Bowtell
et
al.
Proc. Natl. Acad. Sci. USA 88 (1991)
(construct 16) was indistinguishable from those carrying the 8.2-kb EcoRV fragment; expression was temporally modulated and limited to a subset of cells, beginning with the so-called "mystery cells" (3) and cells R3 and R4, followed by cell R7 and finally the cone cells (Fig. 1 D and E). This pattern corresponds closely to the normal distribution of sevenless protein (3), indicating that the cis-regulatory enhancer elements necessary and sufficient for correct quantitative and qualitative expression of the sevenless gene in eye imaginal discs are located between coordinates 259 and 733. Further deletion of sequences contained in this 475-bp enhancer fragment reduced expression preferentially in subsets of expressing cells. Deletion of an additional 115 bp from the 3' end of the enhancer fragment (construct 14) resulted in a preferential decrease in expression in R3, R4, and the mystery cells (Fig. 2 B and G). Eye imaginal discs from larvae bearing one copy of construct 14 showed an almost complete absence of staining with 5-bromo-4-chloro-3-indolyl /-Dgalactopyranoside adjacent to the morphogenetic furrow, consistent with loss of the contribution that cells R3, R4, and the mystery cells make to the expression pattern in this region of the disc (compare Fig. 2 A and B). Antibody staining confirmed that expression was substantially reduced in R3, R4, and the mystery cells, although some residual expression remained (Fig. 2G). Deletion of a further 137 bp (construct 15) abolished expression in all cells (Fig. 2C). An 83-bp deletion made from the 5' boundary of the 475-bp fragment (construct 17) altered the cell-specific pattern of expression in a roughly reciprocal manner. Eye discs from larvae bearing construct 17 showed a general reduction of expression, particularly in R7 and the cone cells. Activity staining was strongest adjacent to the morphogenetic furrow and faded out near the posterior edge ofthe eye disc (compare Fig. 2 E and D). Antibody staining revealed that 83-galacto-
At
6855
sidase was mainly expressed in R3 and R4, although some residual expression persisted in other cell types (Fig. 2H). Deletion of an additional 82 bp (construct 18) did not substantially effect the activity of the enhancer element further. Deletion of a further 76 bp (construct 19) altered the pattern of expression in an unexpected way. Activity staining was most intense in the region of the morphogenetic furrow, suggesting that expression was limited to R3 and R4 (Fig. 2F). However, antibody staining revealed that the IacZ reporter gene was expressed in a previously unidentified cell type that sends a cytoplasmic extension to the apical surface forming a "V" shape adjacent to R3 and R4 (Fig. 21). The nuclei of these cells are located at the basal surface, where they are arranged in imprecisely spaced pairs (Fig. 2J). This staining pattern was observed in all four lines examined and was also found, expressed at a higher level, in two lines bearing a construct containing three copies of this fragment in tandem (data not shown). This effect of deleting nucleotides 423-499 was unexpected since this deletion removes only the third exon of sevenless and none of the flanking intronic sequences (see Fig. 1B). This observation suggests either that regulatory sequences and protein coding sequences are contained within exon 3 or that bringing the enhancer sequence closer to flanking DNA in the P-element vector affects the activity of the enhancer. The high degree of reproducibility with which this pattern was obtained in different transformant lines excludes the possibility that it is due to the position of insertion in the genome of the transgene. The final developmental fate of the expressing cells has not been determined. DNase I Protection Analysis of the 475-bp Enhancer Identifies Several Protected Regions. Nuclear extracts were prepared from two sources: adult heads, where sevenless is normally expressed, and mass isolated imaginal discs, of which eye discs represented 5-10% of the total. These
D
{*"'iV;.
'K.. I
AM^ C.i... t's;.XE Aw
F
^
:1
J
t FIG. 2. Comparison of p-galactosidase expression in the eye discs of larvae bearing constructs in which the 475-bp enhancer fragment (coordinates 258-733) has been progressively deleted. In A-F expression of P-galactosidase was analyzed by histochemical staining and in G-J expression was analyzed using anti-,3-galactosidase antibodies. The arrows mark the position of the morphogenetic furrow. (A-C) Progressive deletion from 3' end. (A) Eye disc from a larva bearing construct 13 (coordinates 0-699; see Fig. 1B) showed a normal pattern of expression. (B) Eye disc from a larva bearing construct 14 (coordinates 0-584) showed a marked decrease in staining immediately posterior to the morphogenetic furrow. Antibody staining (G) showed that this corresponds to reduced expression in mystery cell(s) and cells R3 and R4 (see Fig. 1E for comparison). (C) Further deletion construct 15 (coordinates 0-447) abolished expression. (D-F) Progressive deletion from the 5' end. (D) Eye disc from larva bearing construct 16 (coordinates 258-733) showed a normal pattern of expression. (E) Deletion of 83 bp (construct 17; coordinates 341-733) resulted in a large reduction in expression with staining fading out toward the posterior edge of the disc. Antibody staining (H) showed that expression of f3-galactosidase was only clearly detectable in cells R3 and R4. The overall level of expression in the eye discs of larvae bearing this construct was greatly reduced; staining was barely detectable in heterozygous larvae. This pattern was detected in two out of three lines examined. Deletion of an additional 82 bp (construct 18) did not substantially affect expression further; four out of six lines displayed the pattern shown in H. (F) Further deletion (construct 19; coordinates 499-733) resulted in an unusual pattern of expression. Staining was apparent immediately posterior to the morphogenetic furrow; however, antibody staining showed that this was due to expression in an unidentified cell type that sends cytoplasmic extensions to the apical surface, just anterior to R3 and R4 (I) (open arrow). The nuclei of these cells lie basally in the eye disc (J) and are found in imprecisely spaced pairs (open arrow). All eye discs shown, except those in A and H, are from larvae heterozygous for the construct. (A-F, x90; C-J, x350.)
6856
Genetics: Bowtell
et
al.
.-
Proc. Natl. Acad. Sci. USA 88 (1991)
extracts were used in DNase I-protection studies on two fragments that together encompass the 475-bp enhancer fragment (see Fig. 1B). Six protected regions were identified using the adult head extract (Fig. 3) and two of these were also weakly protected with the total imaginal disc extract. The sequences of the protected regions are not homologous to any previously identified transcription factor binding sites and are not repeated within the enhancer fragment. Comparison of D. melanogaster and Drosophila viruis sevenless Genes Reveals Conserved Sequences Within the 475-bp Enhancer. The sequence of sevenless gene from the distantly related Drosophila species D. virilis and D. melanogaster were compared to detect any conservation within the enhancer. This approach has been very useful in identifying important cis-regulatory regions in other Drosophila genes (17, 18). The second and third introns of D. virilis are several times larger than those in D. melanogaster and bear little overall sequence similarity (ref. 19 and data not shown). However, within the 475-bp enhancer, there are several regions with a high degree of similarity to sequences in the third intron of D. virilis. The three areas with the highest degrees of similarity, excluding exon 3, coincide with protected regions 1-3 (Fig. 4). The largest block extends more than 74 bp near the 3' end of the enhancer and includes the region that when deleted results in reduced expression in R3, R4, and the mystery cells (Figs. 2B and 4). The regions of similarity in the D. virilis third intron occur in the same order as those in the D. melanogaster fragment but are imbedded in large blocks of nonhomologous sequences. Comparison of the available intron 2 sequences from D. virilis and D. melanogaster identified weaker similarities for protected regions 4 and 5 but not in adjacent sequences of intron 2 (Fig. 4). There are no areas of obvious sequence conservation that were not protected in the DNase I footprinting experiments. Site-Directed Mutagenesis of Sequences Within the Enhancer. Protection of the above regions and their conservation in D. virilis suggests that these sequences play an important role as cis-acting elements required for enhancer function. To test this possibility, we performed site-directed mutagenesis on the individual protected areas, using a 928-bp fragment (coordinates 0-928; see Fig. 1B) as the template. The altered sequences are shown in Fig. 4. Larvae bearing the mutagenized fragments were tested for changes in their expression patterns both histochemically and using anti-,3galactosidase antibodies. Despite their sequence conservation and protection with nuclear extracts, mutation in any one
Hezad A C-
a? >E Z
Total disc
G:
2
C
Z
No 4 -
1
....... ._...
o
G
B
5
2~= 6
5
_
4uk."" *A-
......
...
;615K I-R
.. .
I
_
V_-_1 ~_
St...
a
II
I# -
_
.
'!'4Eb.' _
_
-
4
-...._
....
'...... FIG. 3. DNase I protection of two fragments encompassing the 475-bp enhancer region. (A) Four protected regions were apparent using the end-labeled fragment 499-733 (see Fig. 1B for position of this fragment relative to the enhancer fragment) and 100 ,ug or 10 ,g of total nuclear protein extract made from adult heads. (B) Two additional protected regions were seen with the probe 181-521 (see Fig. 1B). (C and D) Protection of regions 5 and 6 by the addition of 100 ,g of heparin sulfate-enriched nuclear protein from total imaginal discs to the probe 181-521, labeled on its 3' end (C) or 5' end (D). Protection of regions 1-4 was not apparent with imaginal disc extracts (data not shown). The nucleotide sequence of these protected regions is shown in Fig. 4. Lanes: NP, no protein control; M, marker lane; 100 ,g and 10 ,ug, amount of extract added. Areas of protection are indicated by vertical lines and are numbered; arrows indicate regions with increased sensitivity to cleavage with DNase I.
of the six protected regions failed to have any discernable effect on either the level or cell specificity of expression (data not shown). This result is particularly surprising given that
259 t
#16-wild
#17-reduced, especially
Q
type
TTTATATGGCCATTGCTATATTGTTTTLT
AATATATjgjA
GAC
in R7 and cone cells (D TCAGCTTTTTCCCACGCAAACTCACCdCAACTTCCGTTCCCAAGTGACCAAAAT;AATAC
TTcTATATAaGCtCAatTATATGT 208 231
(72
AA-TACTAAA
389 EXON 3 ITCTTTcACATTTTCATTGTAATTA.T' TCCTTTCCCCTTTTCCAGGAGGATCTGTTTCTGGACGAATTTGGAATACAGTGCGAAAAGGCGGACAATGGCGAGAAGTGCTACAAAACACGAG 411- n r,expression
4358
_
1
1
#14-reduced especially in R3 & R4
1
TAAGTCGAAGACATTGGGGAGCCGGCATTGAAATGGGATAGGATCGTTAAGTCGGGTAATCCGATACCATTGTTCGCTTTGGATTAACCATCAATTGGACA TTTGGATTAACCACaCCAGTT AAGTCGcGTAATtgGAaACCAcctTTCa 2086 Q 2107 26 641c I9 2686
( ) r
|CTCAAAGTGCA
J
#13-wild type
TGAGGAAGCCATCGAAGAGGATCTTCATGAGC TCCCTCTT 1pTCCTCTGCCAGTP PTTCTCCTTCTCAGCAA U .
CTCAAAGTGCATcAggCgCgGCCAaTCGTgCTCCagCTCCAgaCAgCaaAGGAAaCCgTCGAA 2874
CTTGT
TTGcAtACGAA 2801
TCGATCTTGTCGTCCTGG
GAaCTCCCTCTTtCT-GTT 3427 3444
~~~~~~~~~~~~~~~~~~~733
FIG. 4. Nucleotide sequence of the minimal enhancer fragment (coordinates 259-733) is shown. Boxed regions indicate protected regions on the sense (upper box) or opposite strand (lower box) of DNA for each of the regions shown in Fig. 3. Regions with a high degree of similarity to the D. virilis gene are shown below the D. melanogaster sequence. Their numbers indicate their position in the available D. virilis sequence for this region (ref. 19; GenBank accession no. M34544), which starts 1896 bp from the 5' end of exon 3. Regions with a high degree of similarity were found predominantly within the 475-bp enhancer fragment; the three most similar (excluding the coding sequences of exon 3) encompass protected regions 1-3. Deletion of this portion of the enhancer resulted in decreased expression preferentially in R3, R4, and the mystery cells (see text and Fig. 2B). Solid and open arrows indicate the boundaries of 5' -* 3' and 3' -* 5' deletions, respectively; their construct number and resultant phenotypes are indicated. Heavy underlines indicate the bases that were altered in the site-directed mutant constructs (see text).
Genetics: Bowtell
et
al.
protected regions 1-3 cover a large part of the region that when deleted results in reduced R3 and R4 expression and that this region is also highly conserved in D. virilis (see Fig. 4). These results suggest that there is a degree of redundancy in the enhancer element so that changes in a single site do not have any discernable effect, that the assays used are not sufficiently sensitive to detect changes in expression, or that essential sites for expression in eye imaginal discs were not identified by DNase I protection and sequence comparisons with D. viriis. Concluding Remarks. We have localized sequences necessary for the correct level and pattern of expression of the sevenless gene to a 475-bp region spanning the third exon. Sequences within this fragment are conserved in D. virilis and protected from DNase I digestion by nuclear extracts, suggesting that they bind trans-acting factors required for enhancer function. Deletion of several of these sites and some flanking sequences, but not mutation of individual sites alone, resulted in a preferential reduction of the normal pattern of expression either in the mystery cells, R3, and R4 or in R7 and the cone cells. Although imperfect, this reciprocal reduction in expression suggests that elements at each end of the enhancer confer expression predominantly in a subset of sevenless-expressing cells and that it is the combined action of these elements that generates the dynamic cell-specific expression pattern of the sevenless gene. In this respect, the organization of the sevenless enhancer appears to resemble the modular structure of enhancer elements in genes such as fushi tarazu (20), even-skipped (21), and alcohol dehydrogenase (22). In these cases, the combined effect of several elements produces in the developing animal a complex pattern of gene expression. We are indebted to Karen Perkins, Betsy O'Neill, and Ulrike Heberlein for advice and for providing the adult head and imaginal disc nuclear extracts. We thank members of the Rubin laboratory for
Proc. Natl. Acad. Sci. USA 88 (1991)
6857
their helpful comments during the preparation of this manuscript. D.D.L.B. is a C. J. Martin Fellow. 1. Tomlinson, A. (1988) Development 104, 183-193. 2. Rubin, G. M. (1989) Cell 57, 519-520. 3. Tomlinson, A., Bowtell, D. D. L., Hafen, E. & Rubin, G. M. (1987) Cell 51, 143-150. 4. Banerjee, U., Renfranz, P. J., Hinton, D. R., Rabin, B. A. & Benzer, S. (1987) Cell 51, 151-158. 5. Bowtell, D. D. L., Simon, M. A. & Rubin, G. M. (1989) Cell 56, 931-936. 6. Basler, K. & Hafen, E. (1989) Science 243, 931-934. 7. Mlodzik, M., Hiromi, Y., Weber, U., Goodman, C. S. & Rubin, G. M. (1990) Cell 60, 211-224. 8. Kimmel, B. E., Heberlein, U. & Rubin, G. M. (1990) Genes Dev. 4, 712-727. 9. Mlodzik, M., Baker, N. E. & Rubin, G. M. (1990) Genes Dev. 4, 1848-1861. 10. Bowtell, D. D. L., Kimmel, B. E., Simon, M. A. & Rubin, G. M. (1989) Proc. Natl. Acad. Sci. USA 86, 6245-6249. 11. Basler, K., Siegrist, P. & Hafen, E. (1989) EMBO J. 8, 2381-2386. 12. Saiki, R., Scharf, S., Faloona, F., Mullis, K., Horn, G., Erlich, H. A. & Amheim, N. (1985) Science 230, 1350. 13. Higuchi, R., Krummel, B. & Saiki, R. K. (1988) Nucleic Acids Res. 16, 7351. 14. Heberlein, U., England, B. & Tjian, R. (1989) Cell 41, 965-977. 15. Eugene, 0. E., Yund, M. A. & Fristrom, J. W. (1979) Tissue Cult. Assoc. Man. 5, 1053-1062. 16. Bowtell, D. D. L., Simon, M. A. & Rubin, G. M. (1988) Genes Dev. 2, 620-634. 17. Scholnick, S. B., Bray, S. J., Morgan, B. A., McCormick, C. A. & Hirsh, J. (1986) Science 234, 998-1002. 18. Fortini, M. E. & Rubin, G. M. (1990) Genes Dev. 4, 444-463. 19. Michael, W. M., Bowtell, D. D. L. & Rubin, G. M. (1990) Proc. Natl. Acad. Sci. USA 87, 5351-5353. 20. Hiromi, Y. & Gehring, W. J. (1987) Cell 50, 963-974. 21. Goto, T., Macdonald, P. & Maniatis, T. (1989) Cell 57, 413-422. 22. Fischer, J. A. & Maniatis, T. (1988) Cell 53, 451-461.
