CED
Experimental dermatology • Original article
Clinical and Experimental Dermatology
Analysis of KIT mutations and c-KIT expression in Chinese Uyghur and Han patients with melanoma X.-J. Kang,1 X.-H. Shi,2 W.-J. Chen,1 X.-M. Pu,1 Z.-Z. Sun,3 Y. Halifu,1 X.-J. Wu,1 S.-R. Yu,1 W.-X. Liu,1 J.-Q. Liang,1 D. Luo1 and D.-Y. Ren4 Departments of 1Dermatology and 3Pathology, People’s Hospital of Xinjiang, Uyghur Autonomous Region, Urumqi, Xinjiang, China; 2Department of Dermatology, People’s Hospital of Liaocheng, Liaocheng, Shandong, China; and 4Department of Dermatology, Central Hospital of China National Petroleum Corporation, Langfang, Hebei, China doi:10.1111/ced.12659
Summary
Background. The KIT gene plays an important role in the pathogenesis of malignant melanoma (MM). In recent years, activating mutations in KIT have been recognized as oncogenic. A number of therapies have been established, which provide significant clinical benefits for patients with MM with KIT mutations. Thus, detection of KIT mutations can have profound therapeutic implications. Aim. To investigate KIT gene expression in MMs in Chinese Uyghur and Han patients with mutations in KIT, and to identify the clinical features associated with KIT mutations and c-KIT expression. Methods. In total, 105 MMs (56 from Uyghur and 49 from Han patients) were selected from patients in the Uyghur Autonomous region. Formalin-fixed, paraffin wax-embedded tumour sections were analysed for c-KIT expression using immunohistochemistry. Exons 11 and 13 of KIT were analysed for the presence of mutations using PCR amplification and DNA sequencing. Results. Of the 105 MMs, 13 (10 Han and 3 Uyghur) were found to have mutations in KIT. Thus, the frequency of KIT mutations in Han patients was significantly higher than that in Uyghur patients (P = 0.02). We detected c-KIT expression in 71.4% and 42.9% of the tumour tissue samples collected from the Uyghur and Han patients, respectively. Conclusion. In the Xinjiang Uyghur Autonomous Region in China, chronic suninduced damage MM is the most prevalent MM among Chinese Uyghur patients, whereas acral and mucosal MMs are the most prevalent in Uyghur patients. Mutations in the KIT gene do not correlate with c-KIT expression.
Introduction Malignant melanoma (MM) is a highly aggressive tumour with poor prognosis in the metastatic stages. The prevalence of MM has steadily increased in recent decades.1 MMs are classified into the following four Correspondence: Dr Xiao-Jing Kang, Department of Dermatology, People’s Hospital of Xinjiang, Uyghur Autonomous Region, 91 Tianchi Road, Urumqi, Xinjiang 830001, China E-mail: [email protected] Conflict of interest: the authors declare that they have no conflicts of interest. Accepted for publication 6 November 2014
ª 2015 British Association of Dermatologists
subtypes based on anatomical site and degree of sun exposure: skin MM with chronic sun-induced damage (CSD), skin MM without CSD (non-CSD), acral MM and mucosal MM.2 In MM in white patients, CSD is the major MM subtype. By contrast, mucosal and acral MMs account for the majority of MM cases in Chinese and other East Asian patients.3–5 The Xinjiang Uyghur Autonomous Region comprises approximately one-sixth of the geographic area of China. It is a multiethnic region, with the Uyghur and Han ethnic groups predominating. These two ethnic groups display distinct differences in physical features, language, history and cultural practices.6
Clinical and Experimental Dermatology (2016) 41, pp81–87
81
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
Previous studies have shown that mutations in the KIT and BRAF genes are associated with specific MM subtypes. KIT mutations are more common in the mucosal, acral and CSD subtypes, whereas BRAF mutations are more common in non-CSD MMs.2,7,8 KIT is an important oncogene in MM, which encodes c-KITa receptor tyrosine kinase which regulates a variety of biological responses, such as cell proliferation, apoptosis and cell adhesion, in various cell types including melanocytes. Mutations in KIT can activate c-KIT expression, which has been shown to contribute to tumour growth and progression.9 In recent years, a number of therapies have been developed for treating patients with MM with activating mutations in the KIT oncogene. The use of receptor protein kinase inhibitors has demonstrated significant clinical benefits for the treatment of MMs with KIT mutations.10,11 There is increasing evidence that the presence of KIT mutations, rather than genomic amplification, is a better predictor of tumour response to small-molecule KIT inhibitors.12 Therefore, early detection of KIT mutations is of considerable clinical relevance. Previous studies have melanomas in Chinese Han patients,3,13 but similar studies in Chinese Uyghur patients are scant. The purpose of our current study was to investigate the clinicopathology of melanomas in Chinese Uyghur and Han patients in Xinjiang Province, and to analyse KIT mutations and c-KIT expression in these patients in order to determine whether either of them correlates with the clinical features of melanoma.
Methods Our study was approved by the ethics committee of the People’s Hospital of the Xinjiang Uyghur Autonomous Region (PHXUAR) and conducted according to the principles of the Declaration of Helsinki. All patients provided written informed consent. Patient selection
In total, 105 patients (55 men, 50 women), who had received a histologically confirmed diagnosis of MM at PHXUAR between September 2006 and June 2013, were enrolled. The patients comprised 56 Uyghur and 49 Han individuals. The demographic and clinicopathological characteristics analysed included age, ethnicity, sex, MM subtype, ulceration and regional lymph node metastasis.
82
Clinical and Experimental Dermatology (2016) 41, pp81–87
Mutational analysis
Stored samples of formalin-fixed, paraffin wax-embedded tumours were obtained from the Departments of Dermatology and Pathology, People’s Hospital of Xinjiang. The tissue was cut into serial sections 5 lm thick, then eight sections of tumour-rich areas were collected. Genomic DNA was extracted from the samples using a QIAamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. The genomic DNA was used as template for separate PCR amplifications of the DNA sequences, encompassing exons 11 and 13 of KIT. The primers used for the PCR amplification are shown in Table 1. PCR was performed using 2 lL of genomic DNA, 1 lL of each primer (20 lmol/L) and 25 lL of Master Mix (TaKaRa-Bio, Shiga, Japan) in a total volume of 50 lL. Thermal cycling for the amplification of exon 11 was performed at 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 57 °C for 30 °s and 72 °C for 45 s, with a final extension at 57 °C for 7 min. Conditions for amplification of exon 13 were 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 56°C for 30 s and 72 °C for 40 s, with a final extension at 57 °C for 7 min. The PCR products were stored at 4 °C. The PCR products were separated by electrophoresis in a 1.5% agarose gel (Sangon Biotech Shanghai Co. Ltd, Shanghai, China), and the PCR products were confirmed by DNA sequencing (Sangon).
Immunohistochemistry
Dewaxed and rehydrated sections in 10 mmol/L sodium citrate buffer (pH 6.0) were boiled in a microwave for antigen retrieval. Immunohistochemistry for detection of c-KIT was performed using a DAB chromogenic kit (Dako, Carpinteria, CA, USA) and a 1 : 400 dilution of a polyclonal rabbit anti-human c-KIT antibody (Dako). The c-KIT staining procedure produced brown cytoplasmic particles in the c-KIT-positive cells. The proportion of c-KIT- positive MM cells was scored as: < 5% = 0 (negative), 5–50% = 1 (+), 51–5% = 2 (++) and > 95% = 3 (+++).
Statistical analysis
Statistical analysis was performed using the SPSS software (v17.0; IBM, Armonk, NY, USA). Associations between the demographic and clinicopathological characteristics and the KIT mutation status or level of c-KIT expression were evaluated using the v² test or
ª 2015 British Association of Dermatologists
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
Table 1 Primers used for amplification. Primer
Direction
Sequence 50 ?30
Exon 11
Forward Reverse Forward Reverse
CCAGAGTGCTCTAATGACTG TGACATGGAAAGCCCCTGTT GCTTGACATCAGTTTGCCAG AAAGGCAGCTTGGACACGGCTTTA
Exon 13
Fisher exact test. P < 0.05 was considered statistically significant.
Results Demographic and clinicopathological characteristics
The patients’ demographic and clinicopathological characteristics are listed in Table 2. The median age of the Uyghur and Han patients was 62 and 68 years (range 6–95 and 34–81). respectively. Ulceration was present in 45 patients, while 39 patients (37.1%) had regional lymph node metastases. As shown in Fig. 1, CSD MMs were the most common tumour subtype (n = 18) in Uyghur patients, followed by mucosal (n = 16), acral (n = 14) and non-CSD (n = 6) MMs. In addition, two Uyghur patients had primary MMs of an unknown subtype. In the Han group, acral MMs were the most common tumour subtype (n = 21), followed by mucosal (n = 15), non-CSD (n = 10) and CSD (n = 3) MMs. Statistical analysis confirmed that CSD MMs were more common in Uyghur than in Han patients (P = 0.001), whereas acral and mucosal MMs were predominant in Han patients (P = 0.04).
Table 2 Clinicopathological features of the patients with MMs with KIT mutation.
Figure 1 Distribution of malignant melanomas in Uyghur and
Han patients. CSD, chronic sun-induced damage; UP, unknown primary.
KIT mutational status
Of the 105 patients, 13 had KIT mutations, giving an overall mutation rate of 12.4%. Ten of the patients with KIT mutations were aged ≥ 60 years at diagnosis, and the other three were younger than 60 years. The male : female ratio was 0.63 (five men, eight women). Of these 13 patients, 12 had exon 11 mutations (11 with L576P mutations and 1 with a W557R mutation), and 1 had an exon 13 mutation (K642E) (Fig. 2). All of the Han patients had the L576P mutation, while the three mutations in Uyghur patients comprised one L576P and one W557R in exon 11, and one K642E in exon 13. KIT mutations were more common in Han (n = 10) than in Uyghur (n = 3) patients, with overall frequen-
Mutation Patient
Ethnic group
Melanoma subtype
Sex
Age, years
Exon
Nucleotide
Amino acid
1 2 3 4 5 6 7 8 9 10 11 12 13
Han Han Han Han Han Han Han Han Han Han Uyghur Uyghur Uyghur
Acral Acral Acral Acral Acral Mucosal Mucosal Mucosal CSD Non-CSD Acral Mucosal CSD
M M F F F F F F M F F M M
70 57 48 74 76 64 73 34 76 63 67 60 62
11 11 11 11 11 11 11 11 11 11 13 11 11
T1727C T1727C T1727C T1727C T1727C T1727C T1727C T1727C T1727C T1727C G1924A T1669C T1727C
L576P L576P L576P L576P L576P L576P L576P L576P L576P L576P K642E W557R L576P
CSD, chronic sun-induced damage.
ª 2015 British Association of Dermatologists
Clinical and Experimental Dermatology (2016) 41, pp81–87
83
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
(a) L576P mutation
(c) W557R mutation
(e) K642E mutation
(b) KIT exon 11 sequence
(d) KIT exon 11 sequence
(f) KIT exon 13 sequence Figure 2 (a) The mutation corresponding
to L576P. (b) The wild-type sequence of KIT exon 11. (c) The mutation corresponding toW557R. (d), The wild-type sequence of KIT exon 11. (e) The mutation corresponding to K642E. (f) The wild-type sequence of KIT exon 13.
Table 3 KIT gene mutation in melanoma with clinicopathological characteristics.
tion status and age, sex, tumour subtype, ulceration status or lymph node metastases (Table 3).
KIT gene mutation Variable
n
Age, years < 60 47 ≥ 60 58 Sex Male 50 Female 55 Ethnicity Han 49 Uyghur 56 Tumour subtype Acral 35 Mucosal 31 CSD 21 Other 18 Ulceration Yes 45 No 60 Lymph node metastases Yes 39 No 66
Positive
Negative
P*
3 10
44 48
0.09
5 8
45 47
0.48
10 3
39 53
0.02
6 4 2 1
29 27 19 17
0.64
5 8
40 52
0.73
4 9
35 57
0.61
CSE, Chronic sun-induced damage. *v² test or Fisher exact test.
cies of 20.4% (10/49) and 5.36% (3/56), respectively (P = 0.02). The frequencies of KIT mutations in Uyghur patients with acral, mucosal and CSD MMs were 7.14% (1/14), 6.25% (1/16) and 5.56% (1/18), respectively. None of the Uyghur patients with nonCSD MMs had mutations. The frequencies of KIT mutations in Han patients with acral, mucosal, CSD and non-CSD MMs were 23.8% (5/21), 20% (3/15), 33.3% (1/3) and 10% (1/10), respectively (Table 2). No significant correlation existed between KIT muta-
84
Clinical and Experimental Dermatology (2016) 41, pp81–87
Analysis of c-KIT expression
We detected c-KIT expression in 71.4% (40/56) and 42.9% (21/49) of the tumour tissue samples collected from the Uyghur and Han patients, respectively. Of the c-KIT-positive patients, staining scores of 1, 2 and were seen in 18, 16 and 6 of the Uyghur patients and 7, 9 and 5 of the Han patients, respectively (Fig. 3). Of the 13 patients who had MM with KIT mutations, 3, 2 and 2 patients had c-KIT-staining scores of 1, 2 and 3, respectively. No significant correlation existed between the extent of c-KIT staining and the ethnicity or KIT mutation status of the patients with MM (P < 0.05; Table 4).
Discussion MM is associated with demographic characteristics and ethnicity.11 Previous studies have suggested that MM subtype is associated with KIT mutation frequency.14 In East Asian patients with MMs, mucosal and acral MMs are the prominent subtypes.3–5 This is the first comparative study of MM in Chinese Uyghur and Han patients, to our knowledge, and we found that the most prevalent subtype in Uyghur patients was CSD MM, whereas acral and mucosal MMs were the most prevalent subtypes in Chinese Han patients. These findings may be influenced by the fact that Uyghurs are of both East Asian and white descent. KIT mutations have been shown to be common in acral and mucosal MMs.4,15 In a previous study, the mutation rate was 10.8% in Chinese Han patients.3
ª 2015 British Association of Dermatologists
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
(a)
(b)
Figure 3 Immunohistochemical staining for c-KIT in malignant melanomas (MMs) (9400). (a) MM has c-KIT expression, but no c-kit mutation. (b) MMs have c-KIT expression with the c-kit mutation L576P in exon 11.
Table 4 Relationship between c-KIT expression and KIT gene mutation status in Uyghur and Han ethnic group KIT mutational status Ethnicity
c-KIT IHC-positive cells, %
Positive
Negative
Pa
Han
95 95
5 2 2 1 1 1 0 1
13 5 7 4 15 17 16 5
0.98
Uyghur
a
0.49
Fisher exact test. IHC, immunochemistry.
We limited our screening to exons 11 and 13 because most KIT mutations reported in previous studies occurred in these exons, and because mutations in exons 11 and 13 have been shown to correlate with imatinib sensitivity.10,11 We identified 13 patients with KIT mutations in our cohort, giving a mutation rate of 12.4%. The overall KIT mutation rate was significantly higher in the Han (20.4%) than the Uyghur (5.36%) patients (P = 0.02). The relatively high mutation rates observed for mucosal and acral MMs, which are the most prominent subtypes in Chinese Han patients,3 contributed to the higher overall mutation rate in the Han group. The frequencies of KIT mutations in the acral, mucosal and CSD MMs was higher than that of non-CSD MMs in both the Han and Uyghur groups, which is consistent with the findings of previous studies.2,3 Guo et al.11 found that treatment of patients with metastatic MM harbouring KIT mutations or amplifications is a promising approach in advanced MM. Thus, our results give a basis for selecting patients for whom treatment with KIT inhibitors is
ª 2015 British Association of Dermatologists
appropriate, and the study indicates that Chinese Han patients are more likely to benefit from this treatment. Previous studies have shown that the most common KIT mutation is L576P in exon 11.16,17 This mutation was also the most common mutation in the Han patients in our current study, comprising 84.6% (11/ 13) of the mutations detected. However, we also identified an L576P mutation in a Chinese Han patient with non-CSD MM, reports of which are rare in the literature. This patient was a 63-year-old Han woman with a lesion on her back. In the Uyghur patients in our study, we identified three different point mutations in KIT: L576P and W557R in exon 11 and K642E in exon 13, all of which have been reported in previous studies.18,19 It is interesting that the three mutations identified in the Uyghur patients occurred at different nucleotide positions in KIT, whereas all of the Han patients had identical mutations (L576P). Future studies are warranted to clarify the differences in KIT mutation frequencies between Chinese Han and Uyghur patients. Previous studies of c-KIT protein expression in patients with MM have reported frequencies of 37.3– 81% in acral MMs and 23–91% in mucosal MMs.13,17 In the current study, we found that c-KIT was expressed in 42.9% and 71.4% of the tumour specimens collected from Han and Uyghur patients, respectively. We also found that no correlation existed between the expression of c-KIT and the KIT mutation status in either patient group (P > 0.05). Our findings are consistent with those of two previous studies,2,19 which also found that KIT mutation status did not correlate with c-KIT expression. Taken together, these data suggest that analysis of c-KIT expression cannot be used in place of genetic screening for detection of KIT mutations. Possible causes for the lack of concordance between c-KIT mutation and expression in our study could be differences in immunohistochemistry qualities and protocols. In addition, our mutational
Clinical and Experimental Dermatology (2016) 41, pp81–87
85
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
screening was focused on exons 11 and 23, and this may have influenced the results. However, previous immunohistochemical studies17,20,21 reported a significantly higher level of c-KIT expression in mucosal MMs harbouring a potentially activating KIT mutation, compared with tumours without a KIT mutation. Such differences between our findings and those of other studies may be the result of differences in data sources, sample sizes, ethnicities and environmental factors. Several small-molecule inhibitors that target KIT, such as imatinib and sunitinib, have been used to treat patients with MM. Treatment with imatinib has been shown to significantly improve survival in patients with gastrointestinal stromal tumour.22 Carvajal et al23 found that the therapeutic response rate was better in cases with mutations affecting recurrent hotspots and mutations with a mutant to wild-type allele ratio of > 1. Studies in China have also shown significantly better therapeutic response in patients with MM harbouring KIT mutations.11 Our limited clinical experience suggests that MMs in Chinese Uyghur patients are less responsive to imatinib, compared with those of Chinese Han patients. The results from the current study suggest that the lower KIT mutation rate in Uyghur patients may be related to such differences in therapeutic response between Han and Uyghur patients. Therefore, genetic testing should facilitate the identification of patients who are most appropriate for KIT-targeted therapy, and assist in developing individualized therapies while reducing the financial burden and conserving medical resources. Our findings are limited by the relatively small size of our MM cohort (n = 105). Future studies of larger sample sizes are warranted to fully clarify the role of KIT mutations and c-KIT expression in the tumorigenesis of MMs.
Acknowledgement This work was supported by the International Science and Technology Cooperation Project of Xinjiang Uyghur Autonomous Region (grant no. 20146022).
What’s already known about this topic? KIT is an established therapeutic target in
patients with MM harbouring activating mutations in these oncogenes.
86
Clinical and Experimental Dermatology (2016) 41, pp81–87
Several studies of KIT gene mutations and c-
KIT expression in Chinese Han patients with MM have been performed, but similar studies in Chinese Uyghur patients are lacking.
What does this study add? The prevalent MM types are CSD in Uyghur
and acral and mucosal MMs in Chinese Han patients from the Xinjiang region of China. KIT mutations are more common in Han than Uyghur patients with MM. Treatment may need to be tailored for different populations with specific mutational loci.
References 1 Siegel R, Ward E, Brawley O et al. The impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin 2011; 61: 212–36. 2 Curtin JA, Busam K, Pinkel D et al. Somatic activation of KIT in distinct subtypes of melanoma. J Clin Oncol 2006; 24: 4340–6. 3 Kong Y, Si L, Zhu Y et al. Large-scale analysis of KIT aberrations in Chinese patients with melanoma. Clin Cancer Res 2011; 17: 1684–91. 4 Ashida A, Uhara H, Kiniwa Y et al. Assessment of BRAF and KIT mutations in Japanese melanoma patients. J Dermatol Sci 2012; 66: 240–2. 5 Chi Z, Li S, Sheng X et al. Clinical presentation, histology, and prognoses of malignant melanoma in ethnic Chinese: a study of 522 consecutive cases. BMC Cancer 2011; 11: 1–10. 6 Guo F, Kang X-J, Tang X-H, Sun Z-Z. Analysis BRAF gene mutation in 80 cases of malignant melanomas in Xinjiang. Chin J Dermatol 2014; 46: 33–6. 7 Beadling C, Jacobson-Dunlop E, Hodi FS et al. KIT gene mutations and copy number in melanoma subtypes. Clin Cancer Res 2008; 14: 6821–8. 8 Maldonado JL, Fridlyand J, Patel H et al. Determinants of BRAF mutations in primary melanomas. J Natl Cancer Inst 2003; 95: 1878–90. 9 Mehnert JM, Kluger HM. Driver mutations in melanoma: lessons learned from bench-to-bedside studies. Curr Oncol Rep 2012; 14: 449–57. 10 Garrido MC, Bastian BC. KIT as a therapeutic target in melanoma. J Invest Dermatol 2010; 130: 20–7. 11 Guo J, Si L, Kong Y et al. Phase II, open-label, single-arm trial of imatinib mesylate in patients with metastatic
ª 2015 British Association of Dermatologists
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
12
13
14 15
16
17
melanoma harboring c-Kit mutation or amplification. J Clin Oncol 2011; 29: 2904–9. Woodman SE, Davies MA. Targeting KIT in melanoma: a paradigm of molecular medicine and targeted therapeutics. Biochem Pharmcol 2010; 80: 568–74. Dai B, Cai X, Kong YY et al. Analysis of KIT expression and gene mutation in human acral melanoma: with a comparison between primary tumors and corresponding metastases/recurrences. Hum Pathol 2013; 44: 1472–8. Si L, Guo J. C-kit-mutated melanomas: the Chinese experience. Curr Opin Oncol 2013; 25: 160–5. Hodi FS, Corless CL, Giobbie-Hurder A et al. Imatinib for melanomas harboring mutationally activated or amplified KIT arising on mucosal, acral, and chronically sun-damaged skin. J Clin Oncol 2013; 31: 3182–90. Torres-Cabala CA, Wang W-L, Trent J et al. Correlation between KIT expression and KIT mutation in melanoma: a study of 173 cases with emphasis on the acral-lentiginous/ mucosal type. Mod Pathol 2009; 22: 1446–56. Satzger I, Schaefer T, Kuettler U et al. Analysis of c-KIT expression and KIT gene mutation in human mucosal melanomas. Br J Cancer 2008; 99: 2065–9.
ª 2015 British Association of Dermatologists
18 Abysheva SN, Iyevleva AG, Efimova NV et al. KIT mutations in Russian patients with mucosal melanoma. Melanoma Res 2011; 21: 555–9. 19 Ni S, Huang D, Chen X et al. c-kit gene mutation and CD117 expression in human anorectal melanomas. Human Pathol 2011; 43: 801–7. 20 Antonescu CR, Busam KJ, Francone TD et al. L576P KIT mutation in anal melanomas correlates with KIT protein expression and is sensitive to specific kinase inhibition. Int J Cancer 2007; 121: 257–64. 21 Rivera RS, Nagatsuka H, Gunduz M et al. C-kit protein expression correlated with activating mutations in KIT gene in oral mucosal melanoma. Virchows Arch 2008; 452: 27–32. 22 Blanke CD, Demetri GD, von Mehren M et al. Long-term results from a randomized phase II trial of standardversus higher-dose imatinib mesylate for patients with unresectable or metastatic gastrointestinal stromal tumors expressing KIT. J Clin Oncol 2008; 26: 620–5. 23 Carvajal RD, Antonescu CR, Wolchok JD et al. KIT as a therapeutic target in metastatic melanoma. JAMA 2010; 305: 2327–34.
Clinical and Experimental Dermatology (2016) 41, pp81–87
87
Experimental dermatology • Original article
Clinical and Experimental Dermatology
Analysis of KIT mutations and c-KIT expression in Chinese Uyghur and Han patients with melanoma X.-J. Kang,1 X.-H. Shi,2 W.-J. Chen,1 X.-M. Pu,1 Z.-Z. Sun,3 Y. Halifu,1 X.-J. Wu,1 S.-R. Yu,1 W.-X. Liu,1 J.-Q. Liang,1 D. Luo1 and D.-Y. Ren4 Departments of 1Dermatology and 3Pathology, People’s Hospital of Xinjiang, Uyghur Autonomous Region, Urumqi, Xinjiang, China; 2Department of Dermatology, People’s Hospital of Liaocheng, Liaocheng, Shandong, China; and 4Department of Dermatology, Central Hospital of China National Petroleum Corporation, Langfang, Hebei, China doi:10.1111/ced.12659
Summary
Background. The KIT gene plays an important role in the pathogenesis of malignant melanoma (MM). In recent years, activating mutations in KIT have been recognized as oncogenic. A number of therapies have been established, which provide significant clinical benefits for patients with MM with KIT mutations. Thus, detection of KIT mutations can have profound therapeutic implications. Aim. To investigate KIT gene expression in MMs in Chinese Uyghur and Han patients with mutations in KIT, and to identify the clinical features associated with KIT mutations and c-KIT expression. Methods. In total, 105 MMs (56 from Uyghur and 49 from Han patients) were selected from patients in the Uyghur Autonomous region. Formalin-fixed, paraffin wax-embedded tumour sections were analysed for c-KIT expression using immunohistochemistry. Exons 11 and 13 of KIT were analysed for the presence of mutations using PCR amplification and DNA sequencing. Results. Of the 105 MMs, 13 (10 Han and 3 Uyghur) were found to have mutations in KIT. Thus, the frequency of KIT mutations in Han patients was significantly higher than that in Uyghur patients (P = 0.02). We detected c-KIT expression in 71.4% and 42.9% of the tumour tissue samples collected from the Uyghur and Han patients, respectively. Conclusion. In the Xinjiang Uyghur Autonomous Region in China, chronic suninduced damage MM is the most prevalent MM among Chinese Uyghur patients, whereas acral and mucosal MMs are the most prevalent in Uyghur patients. Mutations in the KIT gene do not correlate with c-KIT expression.
Introduction Malignant melanoma (MM) is a highly aggressive tumour with poor prognosis in the metastatic stages. The prevalence of MM has steadily increased in recent decades.1 MMs are classified into the following four Correspondence: Dr Xiao-Jing Kang, Department of Dermatology, People’s Hospital of Xinjiang, Uyghur Autonomous Region, 91 Tianchi Road, Urumqi, Xinjiang 830001, China E-mail: [email protected] Conflict of interest: the authors declare that they have no conflicts of interest. Accepted for publication 6 November 2014
ª 2015 British Association of Dermatologists
subtypes based on anatomical site and degree of sun exposure: skin MM with chronic sun-induced damage (CSD), skin MM without CSD (non-CSD), acral MM and mucosal MM.2 In MM in white patients, CSD is the major MM subtype. By contrast, mucosal and acral MMs account for the majority of MM cases in Chinese and other East Asian patients.3–5 The Xinjiang Uyghur Autonomous Region comprises approximately one-sixth of the geographic area of China. It is a multiethnic region, with the Uyghur and Han ethnic groups predominating. These two ethnic groups display distinct differences in physical features, language, history and cultural practices.6
Clinical and Experimental Dermatology (2016) 41, pp81–87
81
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
Previous studies have shown that mutations in the KIT and BRAF genes are associated with specific MM subtypes. KIT mutations are more common in the mucosal, acral and CSD subtypes, whereas BRAF mutations are more common in non-CSD MMs.2,7,8 KIT is an important oncogene in MM, which encodes c-KITa receptor tyrosine kinase which regulates a variety of biological responses, such as cell proliferation, apoptosis and cell adhesion, in various cell types including melanocytes. Mutations in KIT can activate c-KIT expression, which has been shown to contribute to tumour growth and progression.9 In recent years, a number of therapies have been developed for treating patients with MM with activating mutations in the KIT oncogene. The use of receptor protein kinase inhibitors has demonstrated significant clinical benefits for the treatment of MMs with KIT mutations.10,11 There is increasing evidence that the presence of KIT mutations, rather than genomic amplification, is a better predictor of tumour response to small-molecule KIT inhibitors.12 Therefore, early detection of KIT mutations is of considerable clinical relevance. Previous studies have melanomas in Chinese Han patients,3,13 but similar studies in Chinese Uyghur patients are scant. The purpose of our current study was to investigate the clinicopathology of melanomas in Chinese Uyghur and Han patients in Xinjiang Province, and to analyse KIT mutations and c-KIT expression in these patients in order to determine whether either of them correlates with the clinical features of melanoma.
Methods Our study was approved by the ethics committee of the People’s Hospital of the Xinjiang Uyghur Autonomous Region (PHXUAR) and conducted according to the principles of the Declaration of Helsinki. All patients provided written informed consent. Patient selection
In total, 105 patients (55 men, 50 women), who had received a histologically confirmed diagnosis of MM at PHXUAR between September 2006 and June 2013, were enrolled. The patients comprised 56 Uyghur and 49 Han individuals. The demographic and clinicopathological characteristics analysed included age, ethnicity, sex, MM subtype, ulceration and regional lymph node metastasis.
82
Clinical and Experimental Dermatology (2016) 41, pp81–87
Mutational analysis
Stored samples of formalin-fixed, paraffin wax-embedded tumours were obtained from the Departments of Dermatology and Pathology, People’s Hospital of Xinjiang. The tissue was cut into serial sections 5 lm thick, then eight sections of tumour-rich areas were collected. Genomic DNA was extracted from the samples using a QIAamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. The genomic DNA was used as template for separate PCR amplifications of the DNA sequences, encompassing exons 11 and 13 of KIT. The primers used for the PCR amplification are shown in Table 1. PCR was performed using 2 lL of genomic DNA, 1 lL of each primer (20 lmol/L) and 25 lL of Master Mix (TaKaRa-Bio, Shiga, Japan) in a total volume of 50 lL. Thermal cycling for the amplification of exon 11 was performed at 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 57 °C for 30 °s and 72 °C for 45 s, with a final extension at 57 °C for 7 min. Conditions for amplification of exon 13 were 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 56°C for 30 s and 72 °C for 40 s, with a final extension at 57 °C for 7 min. The PCR products were stored at 4 °C. The PCR products were separated by electrophoresis in a 1.5% agarose gel (Sangon Biotech Shanghai Co. Ltd, Shanghai, China), and the PCR products were confirmed by DNA sequencing (Sangon).
Immunohistochemistry
Dewaxed and rehydrated sections in 10 mmol/L sodium citrate buffer (pH 6.0) were boiled in a microwave for antigen retrieval. Immunohistochemistry for detection of c-KIT was performed using a DAB chromogenic kit (Dako, Carpinteria, CA, USA) and a 1 : 400 dilution of a polyclonal rabbit anti-human c-KIT antibody (Dako). The c-KIT staining procedure produced brown cytoplasmic particles in the c-KIT-positive cells. The proportion of c-KIT- positive MM cells was scored as: < 5% = 0 (negative), 5–50% = 1 (+), 51–5% = 2 (++) and > 95% = 3 (+++).
Statistical analysis
Statistical analysis was performed using the SPSS software (v17.0; IBM, Armonk, NY, USA). Associations between the demographic and clinicopathological characteristics and the KIT mutation status or level of c-KIT expression were evaluated using the v² test or
ª 2015 British Association of Dermatologists
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
Table 1 Primers used for amplification. Primer
Direction
Sequence 50 ?30
Exon 11
Forward Reverse Forward Reverse
CCAGAGTGCTCTAATGACTG TGACATGGAAAGCCCCTGTT GCTTGACATCAGTTTGCCAG AAAGGCAGCTTGGACACGGCTTTA
Exon 13
Fisher exact test. P < 0.05 was considered statistically significant.
Results Demographic and clinicopathological characteristics
The patients’ demographic and clinicopathological characteristics are listed in Table 2. The median age of the Uyghur and Han patients was 62 and 68 years (range 6–95 and 34–81). respectively. Ulceration was present in 45 patients, while 39 patients (37.1%) had regional lymph node metastases. As shown in Fig. 1, CSD MMs were the most common tumour subtype (n = 18) in Uyghur patients, followed by mucosal (n = 16), acral (n = 14) and non-CSD (n = 6) MMs. In addition, two Uyghur patients had primary MMs of an unknown subtype. In the Han group, acral MMs were the most common tumour subtype (n = 21), followed by mucosal (n = 15), non-CSD (n = 10) and CSD (n = 3) MMs. Statistical analysis confirmed that CSD MMs were more common in Uyghur than in Han patients (P = 0.001), whereas acral and mucosal MMs were predominant in Han patients (P = 0.04).
Table 2 Clinicopathological features of the patients with MMs with KIT mutation.
Figure 1 Distribution of malignant melanomas in Uyghur and
Han patients. CSD, chronic sun-induced damage; UP, unknown primary.
KIT mutational status
Of the 105 patients, 13 had KIT mutations, giving an overall mutation rate of 12.4%. Ten of the patients with KIT mutations were aged ≥ 60 years at diagnosis, and the other three were younger than 60 years. The male : female ratio was 0.63 (five men, eight women). Of these 13 patients, 12 had exon 11 mutations (11 with L576P mutations and 1 with a W557R mutation), and 1 had an exon 13 mutation (K642E) (Fig. 2). All of the Han patients had the L576P mutation, while the three mutations in Uyghur patients comprised one L576P and one W557R in exon 11, and one K642E in exon 13. KIT mutations were more common in Han (n = 10) than in Uyghur (n = 3) patients, with overall frequen-
Mutation Patient
Ethnic group
Melanoma subtype
Sex
Age, years
Exon
Nucleotide
Amino acid
1 2 3 4 5 6 7 8 9 10 11 12 13
Han Han Han Han Han Han Han Han Han Han Uyghur Uyghur Uyghur
Acral Acral Acral Acral Acral Mucosal Mucosal Mucosal CSD Non-CSD Acral Mucosal CSD
M M F F F F F F M F F M M
70 57 48 74 76 64 73 34 76 63 67 60 62
11 11 11 11 11 11 11 11 11 11 13 11 11
T1727C T1727C T1727C T1727C T1727C T1727C T1727C T1727C T1727C T1727C G1924A T1669C T1727C
L576P L576P L576P L576P L576P L576P L576P L576P L576P L576P K642E W557R L576P
CSD, chronic sun-induced damage.
ª 2015 British Association of Dermatologists
Clinical and Experimental Dermatology (2016) 41, pp81–87
83
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
(a) L576P mutation
(c) W557R mutation
(e) K642E mutation
(b) KIT exon 11 sequence
(d) KIT exon 11 sequence
(f) KIT exon 13 sequence Figure 2 (a) The mutation corresponding
to L576P. (b) The wild-type sequence of KIT exon 11. (c) The mutation corresponding toW557R. (d), The wild-type sequence of KIT exon 11. (e) The mutation corresponding to K642E. (f) The wild-type sequence of KIT exon 13.
Table 3 KIT gene mutation in melanoma with clinicopathological characteristics.
tion status and age, sex, tumour subtype, ulceration status or lymph node metastases (Table 3).
KIT gene mutation Variable
n
Age, years < 60 47 ≥ 60 58 Sex Male 50 Female 55 Ethnicity Han 49 Uyghur 56 Tumour subtype Acral 35 Mucosal 31 CSD 21 Other 18 Ulceration Yes 45 No 60 Lymph node metastases Yes 39 No 66
Positive
Negative
P*
3 10
44 48
0.09
5 8
45 47
0.48
10 3
39 53
0.02
6 4 2 1
29 27 19 17
0.64
5 8
40 52
0.73
4 9
35 57
0.61
CSE, Chronic sun-induced damage. *v² test or Fisher exact test.
cies of 20.4% (10/49) and 5.36% (3/56), respectively (P = 0.02). The frequencies of KIT mutations in Uyghur patients with acral, mucosal and CSD MMs were 7.14% (1/14), 6.25% (1/16) and 5.56% (1/18), respectively. None of the Uyghur patients with nonCSD MMs had mutations. The frequencies of KIT mutations in Han patients with acral, mucosal, CSD and non-CSD MMs were 23.8% (5/21), 20% (3/15), 33.3% (1/3) and 10% (1/10), respectively (Table 2). No significant correlation existed between KIT muta-
84
Clinical and Experimental Dermatology (2016) 41, pp81–87
Analysis of c-KIT expression
We detected c-KIT expression in 71.4% (40/56) and 42.9% (21/49) of the tumour tissue samples collected from the Uyghur and Han patients, respectively. Of the c-KIT-positive patients, staining scores of 1, 2 and were seen in 18, 16 and 6 of the Uyghur patients and 7, 9 and 5 of the Han patients, respectively (Fig. 3). Of the 13 patients who had MM with KIT mutations, 3, 2 and 2 patients had c-KIT-staining scores of 1, 2 and 3, respectively. No significant correlation existed between the extent of c-KIT staining and the ethnicity or KIT mutation status of the patients with MM (P < 0.05; Table 4).
Discussion MM is associated with demographic characteristics and ethnicity.11 Previous studies have suggested that MM subtype is associated with KIT mutation frequency.14 In East Asian patients with MMs, mucosal and acral MMs are the prominent subtypes.3–5 This is the first comparative study of MM in Chinese Uyghur and Han patients, to our knowledge, and we found that the most prevalent subtype in Uyghur patients was CSD MM, whereas acral and mucosal MMs were the most prevalent subtypes in Chinese Han patients. These findings may be influenced by the fact that Uyghurs are of both East Asian and white descent. KIT mutations have been shown to be common in acral and mucosal MMs.4,15 In a previous study, the mutation rate was 10.8% in Chinese Han patients.3
ª 2015 British Association of Dermatologists
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
(a)
(b)
Figure 3 Immunohistochemical staining for c-KIT in malignant melanomas (MMs) (9400). (a) MM has c-KIT expression, but no c-kit mutation. (b) MMs have c-KIT expression with the c-kit mutation L576P in exon 11.
Table 4 Relationship between c-KIT expression and KIT gene mutation status in Uyghur and Han ethnic group KIT mutational status Ethnicity
c-KIT IHC-positive cells, %
Positive
Negative
Pa
Han
95 95
5 2 2 1 1 1 0 1
13 5 7 4 15 17 16 5
0.98
Uyghur
a
0.49
Fisher exact test. IHC, immunochemistry.
We limited our screening to exons 11 and 13 because most KIT mutations reported in previous studies occurred in these exons, and because mutations in exons 11 and 13 have been shown to correlate with imatinib sensitivity.10,11 We identified 13 patients with KIT mutations in our cohort, giving a mutation rate of 12.4%. The overall KIT mutation rate was significantly higher in the Han (20.4%) than the Uyghur (5.36%) patients (P = 0.02). The relatively high mutation rates observed for mucosal and acral MMs, which are the most prominent subtypes in Chinese Han patients,3 contributed to the higher overall mutation rate in the Han group. The frequencies of KIT mutations in the acral, mucosal and CSD MMs was higher than that of non-CSD MMs in both the Han and Uyghur groups, which is consistent with the findings of previous studies.2,3 Guo et al.11 found that treatment of patients with metastatic MM harbouring KIT mutations or amplifications is a promising approach in advanced MM. Thus, our results give a basis for selecting patients for whom treatment with KIT inhibitors is
ª 2015 British Association of Dermatologists
appropriate, and the study indicates that Chinese Han patients are more likely to benefit from this treatment. Previous studies have shown that the most common KIT mutation is L576P in exon 11.16,17 This mutation was also the most common mutation in the Han patients in our current study, comprising 84.6% (11/ 13) of the mutations detected. However, we also identified an L576P mutation in a Chinese Han patient with non-CSD MM, reports of which are rare in the literature. This patient was a 63-year-old Han woman with a lesion on her back. In the Uyghur patients in our study, we identified three different point mutations in KIT: L576P and W557R in exon 11 and K642E in exon 13, all of which have been reported in previous studies.18,19 It is interesting that the three mutations identified in the Uyghur patients occurred at different nucleotide positions in KIT, whereas all of the Han patients had identical mutations (L576P). Future studies are warranted to clarify the differences in KIT mutation frequencies between Chinese Han and Uyghur patients. Previous studies of c-KIT protein expression in patients with MM have reported frequencies of 37.3– 81% in acral MMs and 23–91% in mucosal MMs.13,17 In the current study, we found that c-KIT was expressed in 42.9% and 71.4% of the tumour specimens collected from Han and Uyghur patients, respectively. We also found that no correlation existed between the expression of c-KIT and the KIT mutation status in either patient group (P > 0.05). Our findings are consistent with those of two previous studies,2,19 which also found that KIT mutation status did not correlate with c-KIT expression. Taken together, these data suggest that analysis of c-KIT expression cannot be used in place of genetic screening for detection of KIT mutations. Possible causes for the lack of concordance between c-KIT mutation and expression in our study could be differences in immunohistochemistry qualities and protocols. In addition, our mutational
Clinical and Experimental Dermatology (2016) 41, pp81–87
85
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
screening was focused on exons 11 and 23, and this may have influenced the results. However, previous immunohistochemical studies17,20,21 reported a significantly higher level of c-KIT expression in mucosal MMs harbouring a potentially activating KIT mutation, compared with tumours without a KIT mutation. Such differences between our findings and those of other studies may be the result of differences in data sources, sample sizes, ethnicities and environmental factors. Several small-molecule inhibitors that target KIT, such as imatinib and sunitinib, have been used to treat patients with MM. Treatment with imatinib has been shown to significantly improve survival in patients with gastrointestinal stromal tumour.22 Carvajal et al23 found that the therapeutic response rate was better in cases with mutations affecting recurrent hotspots and mutations with a mutant to wild-type allele ratio of > 1. Studies in China have also shown significantly better therapeutic response in patients with MM harbouring KIT mutations.11 Our limited clinical experience suggests that MMs in Chinese Uyghur patients are less responsive to imatinib, compared with those of Chinese Han patients. The results from the current study suggest that the lower KIT mutation rate in Uyghur patients may be related to such differences in therapeutic response between Han and Uyghur patients. Therefore, genetic testing should facilitate the identification of patients who are most appropriate for KIT-targeted therapy, and assist in developing individualized therapies while reducing the financial burden and conserving medical resources. Our findings are limited by the relatively small size of our MM cohort (n = 105). Future studies of larger sample sizes are warranted to fully clarify the role of KIT mutations and c-KIT expression in the tumorigenesis of MMs.
Acknowledgement This work was supported by the International Science and Technology Cooperation Project of Xinjiang Uyghur Autonomous Region (grant no. 20146022).
What’s already known about this topic? KIT is an established therapeutic target in
patients with MM harbouring activating mutations in these oncogenes.
86
Clinical and Experimental Dermatology (2016) 41, pp81–87
Several studies of KIT gene mutations and c-
KIT expression in Chinese Han patients with MM have been performed, but similar studies in Chinese Uyghur patients are lacking.
What does this study add? The prevalent MM types are CSD in Uyghur
and acral and mucosal MMs in Chinese Han patients from the Xinjiang region of China. KIT mutations are more common in Han than Uyghur patients with MM. Treatment may need to be tailored for different populations with specific mutational loci.
References 1 Siegel R, Ward E, Brawley O et al. The impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin 2011; 61: 212–36. 2 Curtin JA, Busam K, Pinkel D et al. Somatic activation of KIT in distinct subtypes of melanoma. J Clin Oncol 2006; 24: 4340–6. 3 Kong Y, Si L, Zhu Y et al. Large-scale analysis of KIT aberrations in Chinese patients with melanoma. Clin Cancer Res 2011; 17: 1684–91. 4 Ashida A, Uhara H, Kiniwa Y et al. Assessment of BRAF and KIT mutations in Japanese melanoma patients. J Dermatol Sci 2012; 66: 240–2. 5 Chi Z, Li S, Sheng X et al. Clinical presentation, histology, and prognoses of malignant melanoma in ethnic Chinese: a study of 522 consecutive cases. BMC Cancer 2011; 11: 1–10. 6 Guo F, Kang X-J, Tang X-H, Sun Z-Z. Analysis BRAF gene mutation in 80 cases of malignant melanomas in Xinjiang. Chin J Dermatol 2014; 46: 33–6. 7 Beadling C, Jacobson-Dunlop E, Hodi FS et al. KIT gene mutations and copy number in melanoma subtypes. Clin Cancer Res 2008; 14: 6821–8. 8 Maldonado JL, Fridlyand J, Patel H et al. Determinants of BRAF mutations in primary melanomas. J Natl Cancer Inst 2003; 95: 1878–90. 9 Mehnert JM, Kluger HM. Driver mutations in melanoma: lessons learned from bench-to-bedside studies. Curr Oncol Rep 2012; 14: 449–57. 10 Garrido MC, Bastian BC. KIT as a therapeutic target in melanoma. J Invest Dermatol 2010; 130: 20–7. 11 Guo J, Si L, Kong Y et al. Phase II, open-label, single-arm trial of imatinib mesylate in patients with metastatic
ª 2015 British Association of Dermatologists
A study of Chinese melanomas and KIT gene X.-J. Kang et al.
12
13
14 15
16
17
melanoma harboring c-Kit mutation or amplification. J Clin Oncol 2011; 29: 2904–9. Woodman SE, Davies MA. Targeting KIT in melanoma: a paradigm of molecular medicine and targeted therapeutics. Biochem Pharmcol 2010; 80: 568–74. Dai B, Cai X, Kong YY et al. Analysis of KIT expression and gene mutation in human acral melanoma: with a comparison between primary tumors and corresponding metastases/recurrences. Hum Pathol 2013; 44: 1472–8. Si L, Guo J. C-kit-mutated melanomas: the Chinese experience. Curr Opin Oncol 2013; 25: 160–5. Hodi FS, Corless CL, Giobbie-Hurder A et al. Imatinib for melanomas harboring mutationally activated or amplified KIT arising on mucosal, acral, and chronically sun-damaged skin. J Clin Oncol 2013; 31: 3182–90. Torres-Cabala CA, Wang W-L, Trent J et al. Correlation between KIT expression and KIT mutation in melanoma: a study of 173 cases with emphasis on the acral-lentiginous/ mucosal type. Mod Pathol 2009; 22: 1446–56. Satzger I, Schaefer T, Kuettler U et al. Analysis of c-KIT expression and KIT gene mutation in human mucosal melanomas. Br J Cancer 2008; 99: 2065–9.
ª 2015 British Association of Dermatologists
18 Abysheva SN, Iyevleva AG, Efimova NV et al. KIT mutations in Russian patients with mucosal melanoma. Melanoma Res 2011; 21: 555–9. 19 Ni S, Huang D, Chen X et al. c-kit gene mutation and CD117 expression in human anorectal melanomas. Human Pathol 2011; 43: 801–7. 20 Antonescu CR, Busam KJ, Francone TD et al. L576P KIT mutation in anal melanomas correlates with KIT protein expression and is sensitive to specific kinase inhibition. Int J Cancer 2007; 121: 257–64. 21 Rivera RS, Nagatsuka H, Gunduz M et al. C-kit protein expression correlated with activating mutations in KIT gene in oral mucosal melanoma. Virchows Arch 2008; 452: 27–32. 22 Blanke CD, Demetri GD, von Mehren M et al. Long-term results from a randomized phase II trial of standardversus higher-dose imatinib mesylate for patients with unresectable or metastatic gastrointestinal stromal tumors expressing KIT. J Clin Oncol 2008; 26: 620–5. 23 Carvajal RD, Antonescu CR, Wolchok JD et al. KIT as a therapeutic target in metastatic melanoma. JAMA 2010; 305: 2327–34.
Clinical and Experimental Dermatology (2016) 41, pp81–87
87
