FEMS MicrobiologyLetters 95 (1992l 57-62 @ 1992 Federation of European MicrobiologicalSocieties l)378-1097/92/S05.01) Published by Elsevier
FEMSLE (14973
Analysis of DNA encoding 23S rRNA and 16S-23S rRNA intergenic spacer regions from Plesiomonas shigelloides A l i s o n K. E a s t , D. A l l a w a y i a n d M . D .
Collins
l)epartmcnt of Microbioloh~.'. ,4FR(" h~stitutc o~ I'~l Rc.~carch,Reading l,aln~ratory. Reading, UK Received 23 April 1992 Accepted 6 May It)tl2 Key words: Plesiomonas shigelloides; 23S rRNA- tRNA: Nucleotide sequence
I. S U M M A R Y
2. I N T R O D U C T I O N
Amplification of the gene encoding 23S r R N A of Plesiomonas shigellohles by polymerasc chain reaction (PCR), with primers complementary to conserved regions of 16S and the 3' end of 23S r R N A genes, resulted in a D N A fragment of approximately 3 kb. This fragment was cloned in Escherichia coli and its nucleotide sequence determined. The region encoding 23S r R N A shows high homology with the published sequences of 23S r R N A from o t h e r members of the gamma division of Proteobacteria. The sequence of the intergenic spacer region, between the 16S and 23S r R N A genes, was determined in a further two clones. In one the sequence of a single t R N A c;l~ was found which was absent from the o t h e r two. This variation in sequence suggests that the different clones may be derived from different ribosomal R N A operons.
Plesiomonas shigelloMes is a Gram-negative, oxidase-positivc, rod-shaped bacterium which, in common with l/ihrio and Aeromonas, has both a fermentative and a respiratory, metabolism of glucose. The taxonomic position of P. shigdloMes is controversial, the organism having been at various times associated with Aeromonas, Vibrionaceac and Entcrobacteriaceae. To clarify its phylogcnetic position we have sequenced the 16S r R N A gene [1] and report the isolation of the genc encoding 23S r R N A using PCR methodology. The nucleotide sequence of the 23S r R N A gene and the intergenic spacer region between small- and large-subunit r R N A genes are presented.
Correspondence to: M.D. Collins, Department of Microbiology. AFRC Institute of Ft~d Research, Reading Laboratory, Earley Gate, Whiteknights Road. Reading RG6 2EF, UK. I Present address: Department of Food Microbiology. University College Cork, Cork, RepubLicof Ireland.
3. M A T E R I A L S A N D M E T H O D S
3.1. Cultures and prel~mition of DNA P. shigelloides ( N C I M B 9242, type strain) was grown aerobically in flasks containing nutrient broth, and chromosomal D N A was prepared from harvested cells as described previously [l].
Escherichia coli SURE (Stratagene) was used as the recipient for transformation. Plasmid DNA was prepared from E. coli by a modification of the alkaline lysis method of Birnbolm and Doly [2]. For sequencing, plasmid DNA was prepared by the method of Treisman as described by Sambrook et al. [3]. 3.2. PCR amplification PCR was carried out using the following conditions; denaturation at 95°C for 5 min, 25 cycles of denaturation at 92°C for 1 rain, annealing at 50°C for ! min, primer extension at 72°C for 5 min, and finally held at 4°C until frozen at - 20°C for storage. Primers (final concentration of 4 ng/p.I) were 5'-GGCCTTGTACACACCG-3' (complementary to conserved region of 16S rRNA, position 1386-1401 E. coil numbering [4]) and 5'-TTCACGCrTAGATGCTITC-3' (complementary to 3' end of 23S rRNA 2741-2759 E. coli numbering [5]). All oligonucleotides were made on an Applied Biosystems model 391 DNA synthesiser. Template DNA was at a final concentration of 20 n g / # ! and deoxy-nucleotides (BCL) at a final concentration of 200/~M. One unit of Taq polymerase (Amersham International) was used according to the manufacturer's instructions. To prevent evaporation during the course of the PCR, a small volume of mineral oil (Sigma) was added to the top of the reaction mixture. Negative controls, set up as described above but containing no template DNA, were included in all experiments. 3.3. Cloning and transformation Products of PCR were purified for cloning as follows: after transfer of the aqueous layer to a fresh tube, 5 units of Klenow (BCL) were added and incubated at 37°C for 30 rain. The DNA was concentrated and purified by use of a 'Geneelean' kit (Stratatech) and phosphorylated by incubation at 37°C with 10 units kinase (Gibco-BRL) used according to manufacturer's instructions. The DNA fragment was extracted with phenol, ethanol precipitated and resuspended in TE (10 mM "Iris • HCI, 1 mM EDTA, pH 7.6). The fragment was ligated with pBiuescript KS + (Stratagene) prepared as follows: the vector was cut with EcoRV
(NBL) and dephosphorylated using alkaline phosphatase (BCL) according to the procedure of Sambrook et al. [3]. The ligation reaction was incubated at 16°C for 16 h using 8 units T4-DNA ligase (BCL). Transformation into E. coli competent cells, prepared as described by lnoue et al. [6], was carried out as described by Sambrook et al. [3]. Transformed cells were plated on to nutrient agar, containing 100 btg/ml Ampicillin (Sigma), 0.02% 5-bromo-4-chloro-3-indolyl-/3-galactoside (X-gaD and 40 ~tg/ml isopropyl-~-D-thiogalactopyranoside (iPTG) and incubated overnight at 37°C. White colonies were grown in 2 × TY broth [3] containing 50 ~tg/ml ampicillin, and plasmid DNA was prepared [2]. Restriction enzymes were used to digest the plasmid DNA and the products s~parated on a I% agarose using a mini gel apparatus (Gibco-BRL) with ! x "Iris. acetate (TAE) buffer [3]. Either i-kb ladder or lambda DNA cut with Hindlll (Gibco-BRL) was used as a size marker. After staining with ethidium bromide (Sigma) the DNA fragments were visualised on a UV transiUuminator. Plasmids containing inserts of approximately 3 kb were subjected to sequence analysis.
3. 4. Sequence determination Sequencing of plasmid DNA was carried out using dideoxy-nucleotide chain termination [7] with primers complementary to the plasmid se. quence (m:~versal primer, reverse primer and primers KS and SIO and to the two strands of the region encoding rRNA. Both strands of the insert encoding 23S rRNA were sequenced completely. Denaturation of double-stranded DNA was carried out by addition of NaOH to a final concentration of 0.4 M, incubation for 10 rain at room temperature, followed by ethanol precipitation [3] and resuspension in sterile distilled water. Annealing of denatured template (approx. 8 / ~ g / r e action) to primer (20 ng/reactiou) was carried out in 1 ×'Sequenase' buffer (Cambridge Bioscience) by incubation for 30 min at 37°C. For sequencing, a "Sequcnasc" kit (Cambridge Bioscience) was used with [35S]dATP (Amersham International) except that "1"7 polymerase (Pharmacia) was substituted for the 'Sequenase' en-
GGTTAAGTGACTAAGCGTACACGGTGGATGCCTTSGCAGTCAGAGGC
150 ITAGGTATCGTTAAGTGAATACA
ATAGCCAACCATGTCCGAATGGGGAAACCCACCTAAGATAAC
2C0 .'k30 T T A A ~ C A J G C G A A C C G G G A G A A C T G A A A C A T
250 ~ A G T A G C G G C GAC,C G A A C G C G G A G C A G C C
CTAAGTACCCGAGC, AAAAGAAATCAACCGAGATTCCGT
i~o
50 GATGAAGGACGTCGAT.~GGACGGAAAAGGGTTGGTGAC-CT~T
300 = A J A G T C T ~qAAT ([A,~-T~,C4~TGTGTTAGTGGARC
~5: GGATTGGAAAGTCCGGCGATACAGGGTGAT
OATAGGGGGGACCATCCTCCAAGGC
TGAAATAGAACCTAAAACC
400
A G C C C C G T A C A C C.AAGAC G C A T T G C T ~ T ~ A G C T C G A T G A : ; T A G ' ; A ~ G ~ G A C A C G T G G T A ~
CCTGTTTGAA
4'~ ? A A A iA C T C C T ,3A~"D3ACC 3 A I'AGC GAACCA.;TAL" ~";~ C,A A 3G~=AAAG3( ~3 A A A A G A A ~ C C C T G T G A G G G G A G T G
GTGTACGTAt'AA~CAGTG~GAGC
~-~:: 600 AC ~ T ,~C,~T7~GrG T G A C 70 J G T A "C ~ ."T T G rAT AATGG, T.r 7AC.C.q.ACTTACATT ."T.qTA
~5,3 GCGAGGTTAACCGAATAGGGGACCCGTA£;(;GA2~ACCGAGTCrTAACTG(~GCDAAT~A(=T']
GTTGGGTAACACGTAACTGGAGGACC
GAACCGACTAATG
503
700 ;CACTC ;A~AJCt"~QTGATC".A6CCATC, G G C A G G T T G A A G
~o 8=0 T T G A A A A A 7T A,3:;G3AT, ;A,."ITCTC.G¢ r G G O 3 G r';AAAG G C : ' A A T C A A A C C G G G A G A T A G C
~'~,~ 900 T G G T T C T C C C C G A A A G C T A T T T A G G T A G C G C i ~CGGA, " G A A C A C C FA ~'GZG ; G T A G A 3 C A C ?G'I'FAA,;,;C TAG' ,3~37,T'"A 7.TCC3A.ZTTACCAACCCTTT '*%0 I000 GCAAACTCCGAATAUCG'rAGAGrGLTA'rCCh;GC, A~,ACI%UA~ ,;~iCGG~;T,=
FEMSLE (14973
Analysis of DNA encoding 23S rRNA and 16S-23S rRNA intergenic spacer regions from Plesiomonas shigelloides A l i s o n K. E a s t , D. A l l a w a y i a n d M . D .
Collins
l)epartmcnt of Microbioloh~.'. ,4FR(" h~stitutc o~ I'~l Rc.~carch,Reading l,aln~ratory. Reading, UK Received 23 April 1992 Accepted 6 May It)tl2 Key words: Plesiomonas shigelloides; 23S rRNA- tRNA: Nucleotide sequence
I. S U M M A R Y
2. I N T R O D U C T I O N
Amplification of the gene encoding 23S r R N A of Plesiomonas shigellohles by polymerasc chain reaction (PCR), with primers complementary to conserved regions of 16S and the 3' end of 23S r R N A genes, resulted in a D N A fragment of approximately 3 kb. This fragment was cloned in Escherichia coli and its nucleotide sequence determined. The region encoding 23S r R N A shows high homology with the published sequences of 23S r R N A from o t h e r members of the gamma division of Proteobacteria. The sequence of the intergenic spacer region, between the 16S and 23S r R N A genes, was determined in a further two clones. In one the sequence of a single t R N A c;l~ was found which was absent from the o t h e r two. This variation in sequence suggests that the different clones may be derived from different ribosomal R N A operons.
Plesiomonas shigelloMes is a Gram-negative, oxidase-positivc, rod-shaped bacterium which, in common with l/ihrio and Aeromonas, has both a fermentative and a respiratory, metabolism of glucose. The taxonomic position of P. shigdloMes is controversial, the organism having been at various times associated with Aeromonas, Vibrionaceac and Entcrobacteriaceae. To clarify its phylogcnetic position we have sequenced the 16S r R N A gene [1] and report the isolation of the genc encoding 23S r R N A using PCR methodology. The nucleotide sequence of the 23S r R N A gene and the intergenic spacer region between small- and large-subunit r R N A genes are presented.
Correspondence to: M.D. Collins, Department of Microbiology. AFRC Institute of Ft~d Research, Reading Laboratory, Earley Gate, Whiteknights Road. Reading RG6 2EF, UK. I Present address: Department of Food Microbiology. University College Cork, Cork, RepubLicof Ireland.
3. M A T E R I A L S A N D M E T H O D S
3.1. Cultures and prel~mition of DNA P. shigelloides ( N C I M B 9242, type strain) was grown aerobically in flasks containing nutrient broth, and chromosomal D N A was prepared from harvested cells as described previously [l].
Escherichia coli SURE (Stratagene) was used as the recipient for transformation. Plasmid DNA was prepared from E. coli by a modification of the alkaline lysis method of Birnbolm and Doly [2]. For sequencing, plasmid DNA was prepared by the method of Treisman as described by Sambrook et al. [3]. 3.2. PCR amplification PCR was carried out using the following conditions; denaturation at 95°C for 5 min, 25 cycles of denaturation at 92°C for 1 rain, annealing at 50°C for ! min, primer extension at 72°C for 5 min, and finally held at 4°C until frozen at - 20°C for storage. Primers (final concentration of 4 ng/p.I) were 5'-GGCCTTGTACACACCG-3' (complementary to conserved region of 16S rRNA, position 1386-1401 E. coil numbering [4]) and 5'-TTCACGCrTAGATGCTITC-3' (complementary to 3' end of 23S rRNA 2741-2759 E. coli numbering [5]). All oligonucleotides were made on an Applied Biosystems model 391 DNA synthesiser. Template DNA was at a final concentration of 20 n g / # ! and deoxy-nucleotides (BCL) at a final concentration of 200/~M. One unit of Taq polymerase (Amersham International) was used according to the manufacturer's instructions. To prevent evaporation during the course of the PCR, a small volume of mineral oil (Sigma) was added to the top of the reaction mixture. Negative controls, set up as described above but containing no template DNA, were included in all experiments. 3.3. Cloning and transformation Products of PCR were purified for cloning as follows: after transfer of the aqueous layer to a fresh tube, 5 units of Klenow (BCL) were added and incubated at 37°C for 30 rain. The DNA was concentrated and purified by use of a 'Geneelean' kit (Stratatech) and phosphorylated by incubation at 37°C with 10 units kinase (Gibco-BRL) used according to manufacturer's instructions. The DNA fragment was extracted with phenol, ethanol precipitated and resuspended in TE (10 mM "Iris • HCI, 1 mM EDTA, pH 7.6). The fragment was ligated with pBiuescript KS + (Stratagene) prepared as follows: the vector was cut with EcoRV
(NBL) and dephosphorylated using alkaline phosphatase (BCL) according to the procedure of Sambrook et al. [3]. The ligation reaction was incubated at 16°C for 16 h using 8 units T4-DNA ligase (BCL). Transformation into E. coli competent cells, prepared as described by lnoue et al. [6], was carried out as described by Sambrook et al. [3]. Transformed cells were plated on to nutrient agar, containing 100 btg/ml Ampicillin (Sigma), 0.02% 5-bromo-4-chloro-3-indolyl-/3-galactoside (X-gaD and 40 ~tg/ml isopropyl-~-D-thiogalactopyranoside (iPTG) and incubated overnight at 37°C. White colonies were grown in 2 × TY broth [3] containing 50 ~tg/ml ampicillin, and plasmid DNA was prepared [2]. Restriction enzymes were used to digest the plasmid DNA and the products s~parated on a I% agarose using a mini gel apparatus (Gibco-BRL) with ! x "Iris. acetate (TAE) buffer [3]. Either i-kb ladder or lambda DNA cut with Hindlll (Gibco-BRL) was used as a size marker. After staining with ethidium bromide (Sigma) the DNA fragments were visualised on a UV transiUuminator. Plasmids containing inserts of approximately 3 kb were subjected to sequence analysis.
3. 4. Sequence determination Sequencing of plasmid DNA was carried out using dideoxy-nucleotide chain termination [7] with primers complementary to the plasmid se. quence (m:~versal primer, reverse primer and primers KS and SIO and to the two strands of the region encoding rRNA. Both strands of the insert encoding 23S rRNA were sequenced completely. Denaturation of double-stranded DNA was carried out by addition of NaOH to a final concentration of 0.4 M, incubation for 10 rain at room temperature, followed by ethanol precipitation [3] and resuspension in sterile distilled water. Annealing of denatured template (approx. 8 / ~ g / r e action) to primer (20 ng/reactiou) was carried out in 1 ×'Sequenase' buffer (Cambridge Bioscience) by incubation for 30 min at 37°C. For sequencing, a "Sequcnasc" kit (Cambridge Bioscience) was used with [35S]dATP (Amersham International) except that "1"7 polymerase (Pharmacia) was substituted for the 'Sequenase' en-
GGTTAAGTGACTAAGCGTACACGGTGGATGCCTTSGCAGTCAGAGGC
150 ITAGGTATCGTTAAGTGAATACA
ATAGCCAACCATGTCCGAATGGGGAAACCCACCTAAGATAAC
2C0 .'k30 T T A A ~ C A J G C G A A C C G G G A G A A C T G A A A C A T
250 ~ A G T A G C G G C GAC,C G A A C G C G G A G C A G C C
CTAAGTACCCGAGC, AAAAGAAATCAACCGAGATTCCGT
i~o
50 GATGAAGGACGTCGAT.~GGACGGAAAAGGGTTGGTGAC-CT~T
300 = A J A G T C T ~qAAT ([A,~-T~,C4~TGTGTTAGTGGARC
~5: GGATTGGAAAGTCCGGCGATACAGGGTGAT
OATAGGGGGGACCATCCTCCAAGGC
TGAAATAGAACCTAAAACC
400
A G C C C C G T A C A C C.AAGAC G C A T T G C T ~ T ~ A G C T C G A T G A : ; T A G ' ; A ~ G ~ G A C A C G T G G T A ~
CCTGTTTGAA
4'~ ? A A A iA C T C C T ,3A~"D3ACC 3 A I'AGC GAACCA.;TAL" ~";~ C,A A 3G~=AAAG3( ~3 A A A A G A A ~ C C C T G T G A G G G G A G T G
GTGTACGTAt'AA~CAGTG~GAGC
~-~:: 600 AC ~ T ,~C,~T7~GrG T G A C 70 J G T A "C ~ ."T T G rAT AATGG, T.r 7AC.C.q.ACTTACATT ."T.qTA
~5,3 GCGAGGTTAACCGAATAGGGGACCCGTA£;(;GA2~ACCGAGTCrTAACTG(~GCDAAT~A(=T']
GTTGGGTAACACGTAACTGGAGGACC
GAACCGACTAATG
503
700 ;CACTC ;A~AJCt"~QTGATC".A6CCATC, G G C A G G T T G A A G
~o 8=0 T T G A A A A A 7T A,3:;G3AT, ;A,."ITCTC.G¢ r G G O 3 G r';AAAG G C : ' A A T C A A A C C G G G A G A T A G C
~'~,~ 900 T G G T T C T C C C C G A A A G C T A T T T A G G T A G C G C i ~CGGA, " G A A C A C C FA ~'GZG ; G T A G A 3 C A C ?G'I'FAA,;,;C TAG' ,3~37,T'"A 7.TCC3A.ZTTACCAACCCTTT '*%0 I000 GCAAACTCCGAATAUCG'rAGAGrGLTA'rCCh;GC, A~,ACI%UA~ ,;~iCGG~;T,=
