Arch Virol (2015) 160:1397–1405 DOI 10.1007/s00705-015-2395-1

ORIGINAL ARTICLE

Analysis of cytokine production in a newly developed canine tracheal epithelial cell line infected with H3N2 canine influenza virus Woo-Jung Park1 • Byung-Joo Park1 • Young-Jo Song1 • Dong-Hun Lee1 • Seong-Su Yuk1 • Joong-Bok Lee1 • Seung-Yong Park1 • Chang-Seon Song1 Sang-Won Lee1 • In-Soo Choi1

•

Received: 12 November 2014 / Accepted: 8 March 2015 / Published online: 24 March 2015 Ó Springer-Verlag Wien 2015

Abstract The Madin-Darby canine kidney (MDCK) cell line is typically used to analyze pathological features after canine influenza virus (CIV) infection. However, MDCK cells are not the ideal cell type, because they are kidney epithelial cells. Therefore, we generated an immortalized canine tracheal epithelial cell line, KU-CBE, to more reliably study immune responses to CIV infection in the respiratory tract. KU-CBE cells expressed the influenza virus receptor, a-2,3-sialic acid (SA), but not a-2,6-SA. KU-CBE and MDCK cells infected with H3N2 CIV demonstrated comparable virus growth kinetics. Gene expression levels of interleukin (IL)-1b, IL-2, IL-4, IL-6, IL8, IL-10, tumor necrosis factor (TNF)-a, and interferon (IFN)-b were estimated in both KU-CBE and MDCK cells infected with CIV by real-time reverse transcription polymerase chain reaction (qRT-PCR). Of these cytokines, IL4, IL-10, TNF-a, and IFN-b mRNAs were detected in both cell lines. Gene expression of IL-4, IL-10, and TNF-a was not significantly different in the two cell lines. However, MDCK cells exhibited a significantly higher level of IFN-b mRNA than KU-CBE cells at 18 h post infection. Additionally, the protein concentrations of these four cytokines were determined by enzyme-linked immunosorbent assay (ELISA) using cell culture supernatants obtained from the two CIV-infected cell lines. MDCK cells produced significantly higher amounts of IL-4 and IFN-b than KU-CBE cells. However, KU-CBE cells produced a significantly higher amount of TNF-a than MDCK cells. These data

& In-Soo Choi [email protected] 1

Department of Infectious Diseases, College of Veterinary Medicine, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 143-701, Korea

indicated that the newly developed canine tracheal epithelial cells exhibited different cytokine production patterns compared to MDCK cells when infected with CIV. Inflammation of the respiratory tract of dogs induced by CIV infection may be attributed to the elevated expression level of TNF-a in canine tracheal epithelial cells.

Introduction Influenza A virus infects humans and several animal species, including dogs [1]. Equine-origin canine influenza virus (CIV) subtype H3N8 was first isolated in 2004 from greyhound dogs that presented with severe clinical signs such as bronchopneumonia, high fever, and hemorrhagic tracheitis [2]. Adaptation of equine influenza virus for canine infection has been attributed to four amino acid changes in the hemagglutinin protein [2]. H3N2 CIV originated from avian influenza in Korea [3]. H3N2 CIV infection induces severe respiratory disease with nasal discharge, fever, coughing, sneezing, and anorexia in dogs [3]. The second H3N2 CIV of avian origin was isolated from dogs in southern China [4]. The third isolate of H3N2 CIV was recently reported in Thailand, and it is genetically related to H3N2 CIV isolated from Korea and China [5]. Interspecies transmission of H3N2 CIV via airborne infection has been observed between dogs and cats, but not between dogs and ferrets. However, direct intranasal infection of cats or ferrets with CIV induces influenza-like clinical signs, viral shedding, and serological responses [6]. Previous CIV infection studies have mostly focused on in vivo effects, as well as virus isolation and identification of clinical signs in experimental animals. The airway epithelium is an important contributor to the early innate immune response to viral infection. Type-I

123

1398

interferons (IFN-a and b) are central players in innate antiviral responses; these IFNs initiate signaling cascades that lead to containment of viral spread and subsequent activation of the adaptive immune response [7]. These IFNs also play an important role in inducing inflammation in the respiratory tract of humans and animals infected with influenza viruses [4, 8]. In addition, several proinflammatory cytokines and chemokines contribute significantly to the pathogenesis of influenza viruses in humans and animals. Human macrophages and bronchial epithelial cells infected with H5N1 viruses induce the production of tumor necrosis factor (TNF)-a, IFN-gamma-inducible protein 10 (IP-10), RANTES, and interleukin (IL)-6 [4, 9]. Infection with the pandemic H1N1 strain was also shown to induce TNF-a, IL-6, CCL2, and CCL5 in human lung epithelial cells [10]. Pigs infected with swine influenza virus mainly produced TNF-a and IL-6 [8]. High concentrations of IFNc, TNF-a, and monocyte chemoattractant protein (MCP)-1 were detected in the lungs of dogs infected with CIV [11]. Typically, in vitro CIV infection studies employ MadinDarby canine kidney (MDCK) cells because they are highly susceptible and permissive to CIV. MDCK cells are frequently used to study the immunological and pathological responses to CIV infection. However, MDCK cells do not represent the physiological, immunological, and pathological responses occurring in CIV-infected respiratory epithelial cells because they are kidney cells. Therefore, in this study, we developed a canine respiratory epithelial cell line to better understand the innate immune responses that occur in response to CIV infection. CIV replicated efficiently in the newly developed canine respiratory epithelial cells. Moreover, CIV infection resulted in the production of typical inflammatory cytokines, TNF-a and IFN-b, and unexpectedly, cytokine IL-4.

Materials and methods Culture of primary tracheal epithelial cells Lower tracheal tissues were obtained from a 4-week-old mixed-breed dog under the approval of the Institutional Animal Care and Use Committees (IACUC, KU-14047). Epithelial cells were removed from the tissues by treatment with 0.1 % protease type XIV (Sigma-Aldrich, USA) for 16–18 h at 4 °C and were cultured on collagen-coated plastic plates with serum-free airway epithelial cell basal medium (ATCC, USA) supplemented with bronchial epithelial growth kit containing growth factors (ATCC, USA) and antibiotics (Gibco, USA). When the primary epithelial cells reached 80–90 % confluence at 3–4 day intervals, they were subcultured into new plastic plates. Alternatively, some aliquots were stored in liquid nitrogen.

123

W.-J. Park et al.

Immortalization of primary tracheal epithelial cells Primary tracheal epithelial cells were cultured on collagen-coated 6-well plates in serum-free medium until they were 70–80 % confluent and were then transfected with pSV3-neo plasmid (ATCC, USA) carrying a simian virus 40 large T-antigen (SV40 LT-ag) using FugeneÒ 6 reagent (Promega, USA) according to the manufacturer’s instructions. Briefly, 6 lg of pSV3-neo plasmid was mixed with FugeneÒ 6 reagent and serum-free medium in a total reaction volume of 300 lL with a 3:1 ratio of FugeneÒ 6 to plasmid DNA. The combined reagent was incubated for 15 min and was added to each well containing primary cells. After 4 days, live cells were selected by adding 200–400 lg of G-418 (Sigma-Aldrich, USA) per mL, and growing cells were cloned by limiting dilution. Cloned cells were cultured in minimum essential medium (MEM) supplemented with 8 % fetal bovine serum (FBS) and antibiotics. Reverse transcription polymerase chain reaction (RT-PCR) and immunofluorescence staining Expression of SV40 LT-ag in the cloned epithelial cell line, named KU-CBE, was confirmed by RT-PCR and immunofluorescence staining. Total RNA was extracted from primary and KU-CBE cells using an RNeasyÒ Mini Kit (QIAGEN, USA) according to the manufacturer’s protocol, and genes were amplified using a MaximeTM RT-PCR PreMIX (Intron Biotechnology, Korea) with primer sets for the SV40 LT-ag gene. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), a housekeeping gene, was used as an internal control (Table 1). The RT-PCR conditions were as follows: reverse transcription reaction for 30 min at 45 °C, inactivation of reverse transcriptase for 5 min at 94 °C, denaturation for 1 min at 94 °C, annealing for 30 s at 58 °C, and extension for 1 min at 72 °C. Immunofluorescence staining was performed as described previously, with some modifications [12]. Briefly, immortalized KU-CBE cells were grown on 4-well poly-Dlysine culture slides (BD Biocoat, USA) for 1 day and were fixed with 4 % formaldehyde in phosphate-buffered saline (PBS) for 10 min at room temperature. The cells were permeabilized with 0.5 % TritonTM X-100 in PBS for 7 min and were washed three times with a washing solution containing 10 % FBS and 0.2 % TweenÒ-20 in phosphate-buffered saline (PBS). Then, the cells were incubated with a mouse monoclonal antibody specific for SV40 LT-ag (Abcam, USA) and a mouse monoclonal antibody specific for cytokeratin 18 (Abcam, USA) for 1 h at room temperature. After washing, secondary antibodies conjugated with Alexa FluorÒ 488 goat anti-mouse immunoglobulin G (IgG; Invitrogen, USA) were applied

Cytokine production in influenza-virus-infected canine cells

1399

Table 1 Oligonucleotide primers used for reverse transcription polymerase chain reaction (RT-PCR) and real-time (q)RT-PCR Target gene

Primer

Sequence (50 -30 )

Nucleotide position

GenBank accession number

Product length (bp)

Reference

SV40 LT-ag

Forward

GCAATCGAAGCAGTAGCAATC

–

–

395

[33]

Reverse

CAGCTAATGGACCTTCTAGG AB038240

412

[34]

Z70044

81

[35]

GAPDH b-actin IL-1b IL-2 IL-4 IL-6 IL-8 IL-10 TNF-a IFN-b

Forward

CCTTCATTGACCTCCACTACATGGT

514-533

Reverse

CCACAACATACGTAGCACCACGAT

906-925

Forward

CCGCGAGAAGATGACCCAGA

131-152

Reverse

GTGAGGATCTTCATGAGGTAGTCGG

189-211

Forward Reverse

TCTCCCACCAGCTCTGTAACAA GCAGGGCTTCTTCAGCTTCTC

84-105 143-163

Z70047

80

D30710

80

AF054833

83

U12234

78

AF048717

81

U33843

78

Z70046

79

Forward

CATCGCACTGACGCTTGTACTT

58-79

Reverse

CCATCTGTTGCTCTGTTTCCTTT

115-137

Forward

CATCCTCACAGCGAGAAACG

117-136

Reverse

CCTTATCGCTTGTGTTCTTTGGA

177-199

Forward

TCCTGGTGATGGCTACTGCTT

98-118

Reverse

GACTATTTGAAGTGGCATCATCCTT

151-175

Forward

CAAGAGCCAGAAAGAAACCAGAAC

4-27

Reverse

AAAGCTGCCAAGAGAGCAACA

64-84

Forward

CGCTGTCACCGATTTCTTCC

383-402

Reverse

CTGGAGCTTACTAAATGCGCTCT

438-460

Forward

GAGCCGACGTGCCAATG

97-113

Reverse

CAACCCATCTGACGGCACTA

156-175

Forward

CCAGTTCCAGAAGGAGGACA

207-226

Reverse

TGTCCCAGGTGAAGTTTTCC

386-406

using the same conditions as those used for the primary antibodies. Finally, the cells were washed and counterstained with 40 ,6-diamidino-2-phenylindole (DAPI; SigmaAldrich, USA) for 5 min. Fluorescence images were analyzed using an inverted fluorescence microscope (Axio Vert200, Germany). Detection of CIV receptor on canine tracheal epithelial cells Biotinylated Maackia amurensis (MAA) lectin II specific for a-2,3-linked sialic acid (SA) and biotinylated Sambucus nigra agglutinin (SNA) specific for a-2,6-linked SA (Vector Laboratories, USA) were used to detect the receptors of avian and human influenza viruses, respectively. KU-CBE and MDCK cells were cultured and fixed using the method described for immunofluorescence staining, but the cells were incubated with 3 % horse serum in PBS for 1 h to block nonspecific binding. After washing three times, the cells were incubated with MAA (20 lg/mL) or SNA (20 lg/mL) for 16 h at 4 °C. Binding of biotinylated lectin was detected using a streptavidin-biotin complex kit (Vector Laboratories, USA). Negative control cells were treated with PBS instead of lectin.

NM_001135787

200

[36]

Growth kinetics of CIV Growth kinetics of CIV (A/canine/Korea/LBM412/ 2008[H3N2]) in KU-CBE cells were compared with those of CIV in MDCK cells. Both KU-CBE and MDCK cells were infected with H3N2 CIV at a multiplicity of infection (MOI) of 0.1. Viral infectivity titers were determined with cell culture supernatants collected at 6, 12, 18, 24, 48, and 72 h postinfection in terms of 50 % tissue culture infective dose (TCID50)/mL using the Reed-Muench method [13]. Measurement of cytokine levels in cells infected with CIV MDCK and KU-CBE cells that were 80–90 % confluent were infected with H3N2 CIV at an MOI of 0.01. Total RNA from infected and uninfected cells was extracted using an RNeasyÒ Mini Kit (QIAGEN), according to the manufacturer’s instructions. Expression of cytokine genes was estimated by real-time (q)RT-PCR using One-Step SYBRÒ Green Master Mix II (Takara) according to the manufacturer’s instructions. Primer sequences for canine cytokines and b-actin (as an internal control) are listed in

123

1400

Table 1. Cytokine gene expression was quantified using the comparative 2-DDCt method, which was used to determine the mean fold changes in the expression level of the respective gene at the corresponding time point in the uninfected cells [14]. Quantification of cytokines Supernatants were collected from MDCK and KU-CBE cultures at various time points after CIV infection and were centrifuged at 3,000 rpm for 5 min to eliminate cell debris. Enzyme-linked immunosorbent assay (ELISA) kits for canine IL-4 and IFN-b (USCN Life Science), as well as IL10 and TNF-a (R&D Systems), were used to determine protein concentrations in the supernatants. All of the ELISA procedures were performed according to the manufacturer’s protocols. Statistical analysis Data are expressed as the mean ± standard deviation (SD). Statistical analysis of cytokine mRNA and protein levels was performed using a t-test for paired means. Differences were considered significant at a p-value less than 0.05.

W.-J. Park et al.

Identification of the influenza virus receptor on KU-CBE cells A previous study demonstrated that the influenza virus receptor a-2,3-linked SA is expressed on canine bronchial and tracheal epithelial tissues [3]. We further demonstrated that this receptor was present on KU-CBE cells. In accordance with the results of other studies [15], we demonstrated that both a-2,3-linked and a-2,6-linked SA receptors were present on MDCK cells (Fig. 2A). In contrast, KU-CBE cells expressed a-2,3-linked SA, but not a2,6-linked SA receptor (Fig. 2B). Replication kinetics of H3N2 CIV in KU-CBE cells To determine the kinetics of influenza virus replication in KU-CBE cells, we compared the growth curves of H3N2 CIV in KU-CBE and MDCK cells. Supernatants were harvested at different time points, and titers of the virus were determined. Both KU-CBE and MDCK cells exhibited highest viral titers 48 h after infection (Fig. 3). The growth curves of the virus were almost identical in the two cell lines. There were no significant differences in viral replication kinetics between the cell lines (Fig. 3). Determination of cytokine mRNA levels by qRT-PCR

Results Development of an immortalized canine tracheal epithelial cell line Canine tracheal primary cells were immortalized using SV40 large T-antigen (LT-ag), and one epithelial cell clone, named KU-CBE, was obtained by limiting dilution of the immortalized cells. The phenotype of KU-CBE cells was examined morphologically at passages 5 and 60 (data not shown). SV40 LT-ag expression in KU-CBE cells was examined by RT-PCR and immunofluorescence staining. The 395-base-pair (bp) SV40 LT-ag gene was observed in KU-CBE cells at passages 5 and 60 (Fig. 1A), but it was not detected in primary cells at passage 3. Both primary and immortalized KU-CBE cells expressed the housekeeping gene GAPDH (412 bp) (Fig. 1A). In addition, KUCBE cells transfected with the pSV3-neo plasmid stably expressed SV40 LT-ag, which was localized in the nucleus (Fig. 1B). Morphologically, KU-CBE cells appeared to be epithelial cells; therefore, their epithelial status was verified by an immunofluorescence assay using an epithelialcell-specific marker antibody. KU-CBE cells expressed cytokeratin 18, a typical epithelial cell cytoplasmic marker (Fig. 1C).

123

We used qRT-PCR to determine the mRNA levels of cytokines IL-1b, IL-2, IL-4, IL-6, IL-8, IL-10, TNF-a, and IFN-b in KU-CBE and MDCK cells infected with H3N2 CIV. Relatively high levels of IL-4, TNF-a, and IFN-b mRNA and low levels of IL-10 mRNA were detected in KU-CBE and MDCK cells after CIV infection. The mRNA levels of these cytokines reached their maximum value at 18 h postinfection and decreased at 24 h postinfection. The mean levels of IL-4, IL-10, TNF-a, and IFN-b mRNA in infected KU-CBE cells were 24.3, 2.5, 23.1, and 8.3-fold higher, respectively, than those in mock-infected KU-CBE cells at 18 h post-infection (Fig. 4A, B, C, and D). Similarly, mean mRNA levels of IL-4, IL-10, TNF-a, and IFN-b in infected MDCK cells were 18.6, 3.2, 18.8, and 19-fold higher, respectively, than those in mock-infected MDCK cells at 18 h postinfection (Fig. 4A, B, C, and D). The mRNA levels of IL-4, IL-10, and TNF-a in KU-CBE cells were not significantly different from those in MDCK cells after CIV infection. However, the mRNA levels of IFN-b in CIV-infected MDCK cells were significantly higher than those in infected KU-CBE cells at 18 h postinfection (p \ 0.05). The mRNA levels of IL-1b, IL-2, IL-6, and IL-8 were extremely low in both KU-CBE and MDCK cells infected with CIV (data not shown).

Cytokine production in influenza-virus-infected canine cells

1401

Fig. 1 Identification of simian virus 40 large T-antigen (SV40 LT-ag) and epithelial cell markers in immortalized KUCBE cells. (A) SV40 LT-ag mRNA in KU-CBE cells at passages 5 and 60 was amplified by reverse transcription polymerase chain reaction (RTPCR). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected as a control gene. (B) Nuclear localization of SV40 LT-ag in the KU-CBE cells was demonstrated using a mouse monoclonal antibody specific for SV40 LT-ag as a primary antibody and goat anti-mouse IgG-Alexa FluorÒ 488 as a secondary antibody. Additionally, cell nuclei were stained with 40 ,6-diamidino-2phenylindole (DAPI). (C) Expression of cytokeratin 18, an epithelial marker in the cytoplasm of KU-CBE cells was confirmed by immunofluorescence staining. KU-CBE cells were counterstained with DAPI

Fig. 2 Identification of influenza virus receptors in Madin-Darby canine kidney (MDCK) and KU-CBE cells. Cells were stained with biotinylated Maackia amurensis lectin II (MAA; specific for a-2,3linked sialic acid) or biotinylated Sambucus nigra agglutinin (SNA;

specific for a-2,6-linked sialic acid). (A) MDCK cells expressed avian and human influenza virus receptors. (B) KU-CBE cells expressed only avian influenza virus receptors

123

1402

W.-J. Park et al.

Determination of cytokine production levels by ELISA

Fig. 3 Growth kinetics of canine influenza virus (CIV) in MDCK and KU-CBE cells. Both cell lines were infected with CIV at a multiplicity of infection (MOI) of 0.1. Viral titers were determined in terms of 50 % tissue culture infective dose (TCID50)/mL at the indicated time points. The results are expressed as mean ± standard deviation (SD) of three replicates

Fig. 4 Determination of cytokine mRNA levels in KU-CBE and MDCK cells infected with CIV. The mRNA levels of (A) interleukin (IL)-4, (B) IL-10, (C) tumor necrosis factor (TNF)-a, and (D) interferon (IFN)-b were determined by real-time (q)RT-PCR and were

123

Because IL-4, IL-10, TNF-a, and IFN-b mRNAs were detected in both KU-CBE and MDCK cells infected with H3N2 CIV, we subsequently assayed the protein concentrations of these cytokines by ELISA. Production of IL-4 was higher in CIV-infected MDCK cells than that in infected KU-CBE cells (Fig. 5A). IL-4 levels produced by infected MDCK cells were significantly higher than those produced by infected KU-CBE cells at 6 (p \ 0.001), 12 (p \ 0.01), and 24 h (p \ 0.01) postinfection. The concentrations of IL-10 produced by infected cells of both types were too low to evaluate (Fig. 5B). TNF-a production was detected in infected KU-CBE cells, but not in MDCK cells (Fig. 5C). The concentration of TNF-a produced by infected KU-CBE cells was significantly higher than that produced by infected MDCK cells at 6 (p \ 0.01), 12 (p \ 0.05), 18 (p \ 0.001), and 24 h (p \ 0.001) postinfection. Similar to the production patterns of IL-4, production of IFN-b was

normalized to b-actin mRNA expression. Statistical significance of cytokine mRNA expressed from KU-CBE and MDCK cells was assumed at p \ 0.05 (*)

Cytokine production in influenza-virus-infected canine cells

1403

Fig. 5 Determination of cytokine protein levels in KU-CBE and MDCK cells infected with CIV. Cytokine concentrations of (A) IL-4, (B) IL-10, (C) TNF-a, and (D) IFN-b were measured in cell culture supernatants by enzyme-linked immunofluorescent assay (ELISA).

Statistical significance of cytokines produced from KU-CBE and MDCK cells was assumed at p \ 0.05 (*), p \ 0.01 (**), and p \ 0.001 (***)

higher in infected MDCK cells than in infected KU-CBE cells (Fig. 5D). IFN-b levels produced by infected MDCK cells were significantly higher than those produced by infected KU-CBE cells (p \ 0.001) during CIV infection.

were demonstrated in human primary bronchial epithelial cell (NHBE) [16]. Influenza virus receptors are commonly classified as avian influenza receptors (a-2,3-SA) or human influenza receptors (a-2,6-SA). The canine respiratory tract, including the trachea and lung tissues, widely expresses a-2,3-SA receptor; however, a-2,6-SA receptor is rarely expressed in the canine respiratory tract [17]. A recent study has demonstrated that human seasonal H3N2 and pandemic H1N1 influenza viruses can infect dogs [18]. Therefore, the presence of a few a-2,6-SA receptors in the respiratory tract of dogs might permit human influenza virus infections. However, the KU-CBE cells developed in this study only expressed a-2,3-SA receptor. Therefore, the susceptibility of dogs to both avian and human influenza viruses appears to depend on the presence of the a-2,3- and a-2,6-SA receptors in the respiratory tract. We determined the mRNA levels and protein expression profiles of IL-4, IL-10, TNF-a, and IFN-b in KU-CBE and MDCK cells after CIV infection. Our study clearly identified different cytokine production profiles in the two cell types. MDCK cells produced significantly higher amounts

Discussion Although CIV was isolated a long time ago, in vitro studies of the innate immune response induced by CIV infection were relatively restricted because of the lack of suitable respiratory epithelial cell lines. In a previous study, we investigated CIV infection using several in vivo parameters, including immunological and histopathological effects, in experimentally infected dogs [11]. In this study, we developed a canine tracheal epithelial cell line, KUCBE, to better understand CIV-infection-mediated immune responses in the respiratory tract of dogs. Replication kinetics of CIV in KU-CBE cells was comparable to that in MDCK cells. However, compared to MDCK cells, better infectivity and cell tropism of human influenza viruses

123

1404

of IL-4 and IFN-b than KU-CBE cells during CIV infection. However, production of high amounts of TNF-a was observed only in KU-CBE cells. In addition, KU-CBE cells produced considerable amounts of IL-4 and IFN-b. Several studies have indicated that influenza virus infection can induce the expression of various cytokines in the epithelial cells of animals and humans. The human bronchial epithelial cell line NCI-H292 produced IL-6, IL-8, and RANTES in response to influenza A virus (H3N2) infection [19]. Primary normal human bronchial epithelial (NHBE) cells expressed IP-10, IFN-b, RANTES, IL-6, IL8, and MCP-1 in response to H5N1 influenza virus infection [9]. In addition, NHBE cells infected with the H1N1 pandemic strain expressed high levels of IFN-a, TNF-a, and IL-6 [10]. Human macrophages infected with H5N1 virus exhibited significantly higher gene expression of TNF-a and IFN-b than those infected with H3N2 or H1N1 viruses [20]. Similarly, INF-a and IL-1 were detected in the bronchoalveolar lavage fluid (BALF) of pigs infected with H1N1 virus [21]. Mice infected with H5N1 also produced significantly increased levels of TNF-a and IL-6 [22]. Our results indicate that TNF-a and IFN-b might contribute to the induction of inflammation in the respiratory tract of dogs infected with H3N2 CIV. A recent study has demonstrated that H3N8 CIV infection induces TNF-a production in canine lung macrophages [23], suggesting that tracheal epithelial cells and lung macrophages play important roles in the induction of respiratory disease in CIV-infected dogs. However, why IL-1b, IL-6, and IL-8 were not induced by CIV infection in canine tracheal epithelial cells is not clear. It is possible that the use of different cell types, animal species, and influenza virus isolates in our study resulted in different immune responses when compared with other studies. Cytokines and chemokines produced from immune cells have various defensive functions against foreign microorganisms. IL-2 and IFN-c induce Th1-type immune responses [24], and IL-4, IL-5, IL-6, and IL-10 mediate Th2type immune responses [25]. IL-4 induces differentiation of Th2 cells but inhibits development of Th1 cells [26]. IL4 also suppresses the function of proinflammatory cytokines such as IL-1b, IL-12, and TNF-a [27]. In addition, IL-4 has been shown to delay virus clearance in mice infected with influenza virus by inhibiting both primary and secondary antiviral immune responses [28]. In our study, mRNA expression and protein production of IL-4 were detected in KU-CBE cells infected with CIV. IL-4 production in canine tracheal epithelial cells is intriguing because only a few studies have demonstrated IL-4 mRNA and protein expression in respiratory epithelial cells. One study demonstrated that IL-4 production promotes IL-8 expression in human bronchial epithelial cells and that the two cytokines might be involved in inflammation of the

123

W.-J. Park et al.

respiratory tract [29]. A previous study has demonstrated that IL-4 and TGF-b are predominantly produced by apoptotic human bronchial epithelial cells and that they might contribute to inhibition of inflammation in the respiratory tract [30]. In this study, we eliminated apoptotic cells before estimating IL-4 expression in canine tracheal epithelial cells infected with CIV. In duplicate experiments, we consistently found expression of IL-4 in viable cells. However, we currently do not know the exact role of IL-4 in canine tracheal epithelial cells infected with CIV. IL-4 might function as an anti-inflammatory cytokine or might exacerbate respiratory inflammation together with TNF-a. Pretreatment of airway epithelial cells with a combination of TNF-a and IL-4 increased the mRNA and protein levels of MCP-1, which might contribute to respiratory disease caused by respiratory syncytial virus infection [31]. In contrast to IL-4, induction of IL-10 was considerably lower in KU-CBE cells. Together with TGFb, IL-10 functions as a typical anti-inflammatory cytokine. Some studies have reported that IL-10 is produced in macrophages, dendritic cells, and regulatory T cells infected with influenza virus [32]. However, KU-CBE cells only marginally induced IL-10 in response to CIV infection. In conclusion, this study clearly demonstrated distinctive immune responses in canine respiratory epithelial cells when compared with MDCK cells after CIV infection. A high concentration of TNF-a, primarily produced in respiratory epithelial cells, could contribute to severe inflammatory respiratory disease in dogs infected with CIV. The newly developed canine respiratory epithelial cell line may be used to study pathogenesis of several viruses infecting the respiratory tract. Acknowledgments This research was supported by the Brain Korea 21 Plus and Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2013-A419-0092).

References 1. Yoon KJ, Cooper VL, Schwartz KJ, Harmon KM, Kim WI, Janke BH, Strohbehn J, Butts D, Troutman J (2005) Influenza virus infection in racing greyhounds. Emerg Infect Dis 11:1974–1976 2. Crawford PC, Dubovi EJ, Castleman WL, Stephenson I, Gibbs EP, Chen L, Smith C, Hill RC, Ferro P, Pompey J, Bright RA, Medina MJ, Johnson CM, Olsen CW, Cox NJ, Klimov AI, Katz JM, Donis RO (2005) Transmission of equine influenza virus to dogs. Science 310:482–485 3. Song D, Kang B, Lee C, Jung K, Ha G, Kang D, Park S, Park B, Oh J (2008) Transmission of avian influenza virus (H3N2) to dogs. Emerg Infect Dis 14:741–746 4. Li S, Shi Z, Jiao P, Zhang G, Zhong Z, Tian W, Long LP, Cai Z, Zhu X, Liao M, Wan XF (2010) Avian-origin H3N2 canine influenza A viruses in Southern China. Infect. Genet Evol 10:1286–1288

Cytokine production in influenza-virus-infected canine cells 5. Bunpapong N, Nonthabenjawan N, Chaiwong S, Tangwangvivat R, Boonyapisitsopa S, Jairak W, Tuanudom R, Prakairungnamthip D, Suradhat S, Thanawongnuwech R, Amonsin A (2013) Genetic characterization of canine influenza A virus (H3N2) in Thailand. Virus Genes 48:56–63 6. Kim H, Song D, Moon H, Yeom M, Park S, Hong M, Na W, Webby RJ, Webster RG, Park B, Kim J-K, Kang B (2013) Interand intraspecies transmission of canine influenza virus (H3N2) in dogs, cats, and ferrets. Influenza Other Respir Viruses 7:265–270 7. Durbin JE, Fernandez-Sesma A, Lee C-K, Rao TD, Frey AB, Moran TM, Vukmanovic S, Garcia-Sastre A, Levy DE (2000) Type I IFN modulates innate and specific antiviral immunity. J Immunol 164:4220–4228 8. Van Reeth K, Van Gucht S, Pensaert M (2002) Correlations between lung proinflammatory cytokine levels, virus replication, and disease after swine influenza virus challenge of vaccinationimmune pigs. Viral Immunol 15:583–594 9. Chan MC, Cheung CY, Chui WH, Tsao SW, Nicholls JM, Chan YO, Chan RW, Long HT, Poon LL, Guan Y, Peiris JS (2005) Proinflammatory cytokine responses induced by influenza A (H5N1) viruses in primary human alveolar and bronchial epithelial cells. Respir Res 6:135 10. Gerlach RL, Camp JV, Chu Y-K, Jonsson CB (2013) Early host responses of seasonal and pandemic influenza A virus in primary well-differentiated human lung epithelial cells. PLoS ONE 8:e78912. doi:10.1371/journal.pone.0078912 11. Lee Y-N, Lee H-J, Lee D-H, Kim J-H, Park H-M, Nahm S-S, Lee J-B, Park S-Y, Choi I-S, Song C-S (2011) Severe canine influenza in dogs correlates with hyperchemokinemia and high viral load. Virology 417:57–63 12. Janson C, Romanova L, Hansen E, Hubel A, Lam C (2011) Immortalization and functional characterization of rat arachnoid cell lines. Neuroscience 177:23–34 13. Reed LJ, Muench H (1938) A simple method for estimating fifty percent endpoints. Am J Hyg 27:493–497 14. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402–408 15. Ibricevic A, Pekosz A, Walter MJ, Newby C, Battaile JT, Brown EG, Holtzman MJ, Brody SL (2006) Influenza virus receptor specificity and cell tropism in mouse and human airway epithelial cells. J Virol 80:7469–7480 16. Ilyushina NA, Ikizler MR, Kawaoka Y, Rudenko LG, Treanor JJ, Subbarao K (2012) Comparative study of influenza virus replication in MDCK cells and in primary cells derived from adenoids and airway epithelium. J Virol 86:11725–11734 17. Ning ZY, Wu XT, Cheng YF, Qi WB, An YF, Wang H, Zhang GH, Li SJ (2012) Tissue distribution of sialic acid-linked influenza virus receptors in beagle dogs. J Vet Sci 13:219–222 18. Song D, Kim H, Na W, Hong M, Park SJ, Kang B, Lyoo KS, Yeon M, Jeong DG, An DJ, Kim JK (2014) Canine susceptibility to human influenza viruses (A/pdm09 H1N1, A/H3N2, and B). J Gen Virol. doi:10.1099/vir.0.070821-0 19. Matsukura S, Kokubu F, Noda H, Tokunaga H, Adachi M (1996) Expression of IL-6, IL-8, and RANTES on human bronchial epithelial cells, NCI-H292, induced by influenza virus A. J Allergy Clin Immunol 98:1080–1087 20. Cheung CY, Poon LL, Lau AS, Luk W, Lau YL, Shortridge KF, Gordon S, Guan Y, Peiris JS (2002) Induction of proinflammatory

1405

21.

22.

23.

24. 25. 26. 27.

28.

29.

30.

31.

32. 33.

34.

35.

36.

cytokines in human macrophages by influenza A (H5N1) viruses: a mechanism for the unusual severity of human disease? Lancet 7:1831–1837 Van Reeth K, Nauwynck H, Pensaert M (1998) Bronchoalveolar interferon-alpha, tumor necrosis factor-alpha, interleukin-1, and inflammation during acute influenza in pigs: a possible model for humans? J Infect Dis 177:1076–1079 Xu T, Qiao J, Zhao L, Wang G, He G, Li K, Tian Y, Gao M, Wang J, Wang H, Dong C (2006) Acute respiratory distress syndrome inducted by avian influenza A (H5N1) virus in mice. Am J Respir Crit Care Med 174:1011–1017 Powe JR, Castleman WL (2009) Canine influenza virus replicates in alveolar macrophages and induces TNF-alpha. Vet Pathol 46:1187–1196 Paul WE, Seder RA (1994) Lymphocyte responses and cytokines. Cell 76:241–251 Moore KW, O’Garra A, de Waal Malefyt R, Vieira P, Mosmann TR (1993) Interleukin-10. Annu Rev Immunol 11:165–190 Seder RA, Paul WE (1994) Acquisition of lymphokine-producing phenotype by CD4? T cells. Annu Rev Immunol 12:635–673 Gautam SC, Chikkala NF, Hamilton TA (1992) Anti-inflammatory action of IL-4. Negative regulation of contact sensitivity to trinitrochlorobenzene. J Immunol 148:1411–1415 Moran TM, Isobe H, Fernandez-Sesma A, Schulman JL (1996) Interleukin-4 causes delayed virus clearance in influenza virusinfected mice. J Virol 70:5230–5235 Adachi Y, Mio T, Takigawa K, Striz I, Romberger DJ, Robbins RA, Spurzem JR, Heires P, Rennard SI (1997) Mutual inhibition by TGF-beta and IL-4 in cultured human bronchial epithelial cells. Am J Physiol 273:701–708 Hodge S, Hodge G, Flower R, Reynolds PN, Scicchitano R, Holmes M (2002) Up-regulation of production of TGF-beta and IL-4 and down-regulation of IL-6 by apoptotic human bronchial epithelial cells. Immunol. Cell Biol 80:537–543 Yamada Y, Matsumoto K, Hashimoto N, Saikusa M, Homma T, Yoshihara S, Saito H (2011) Effect of Th1/Th2 cytokine pretreatment on RSV-induced gene expression in airway epithelial cells. Int Arch Allergy Immunol 154:185–194 Couper KN, Blount DG, Riley EM (2008) IL-10: the master regulator of immunity to infection. J Immunol 180:5771–5777 Hnasko R, Khurana S, Shackleford N, Steinmetz R, Low MJ, Ben-Jonathan N (1997) Two distinct pituitary cell lines from mouse intermediate lobe tumors: a cell that produces prolactinregulating factor and a melanotroph [see comments]. Endocrinology 138:5589–5596 Maeda S, Okayama T, Omori K, Masuda K, Sakaguchi M, Ohno K, Tsujimoto H (2002) Expression of CC chemokine receptor 4 (CCR4) mRNA in canine atopic skin lesion. Vet Immunol Immunopathol 90:145–154 Wang YS, Chi KH, Chu RM (2007) Cytokine profiles of canine monocyte-derived dendritic cells as a function of lipopolysaccharide- or tumor necrosis factor-alpha-induced maturation. Vet Immunol Immunopathol 118:186–198 Seitz C, Frensing T, Hoper D, Kochs G, Reichl U (2010) High yields of influenza A virus in Madin-Darby canine kidney cells are promoted by an insufficient interferon-induced antiviral state. J Gen Virol 91:1754–1763

123