DEVELOPMENTAL
BIOLOGY
145, 323-327
(1991)
Analysis of CCAAT Box Transcription Factor Binding Activity during Early Xenopus laevis Embryogenesis NICK OVSENEK,~ HEATHER Department
of Biology.
University
A. KARN, AND JOHN J. HEIKKILA~ of Waterloo,
Waterloo,
Ontario,
Canada
N2L
dG1
Unfertilized eggs and pre-midblastula (MBT) stage Xenopus embryos were found to contain a large pool of maternally derived CCAAT box-binding transcription factor (CBTF). DNA mobility shift experiments using embryonic extracts prepared with either low or high salt buffers suggest that Xerl0w.s CBTF may not interact with embryonic DNA until the late blastula stage, a time point coincident with the increase in zygotic transcription. Additionally, photoaffinity-labeling experiments revealed that both pre- and post-MBT CBTF-binding activities were composed of at least three proteins having relative molecular masses of 68, 52, and 42 kDa. G 1991 Academic press. IIIC.
the present study, pre-MBT stage embryos were found to contain a large pool of maternally derived CCAAT box-binding transcription factor (CBTF). DNA mobility shift experiments using embryonic extracts prepared with either high or low salt buffers suggest that Xenopus CBTF may not interact with embryonic DNA until the late blastula stage, a time point coincident with the increase in zygotic transcription.
INTRODUCTION
During the first 6-7 hr of Xenopus development there is no significant transcription of embryonic genes as the embryo undergoes a series of 12 rapid cell divisions with abbreviated cell cycles consisting only of S and M phases (Newport and Kirschner, 1982a,b). This pattern changes abruptly at the midblastula transition (MBT) with the initiation of asynchronous cell divisions, the onset of cell motility, and transcription by RNA polymerase II and III. Strong evidence suggests that these events are initiated by the titration of a maternal component when the embryo reaches a critical nucleus to cytoplasm ratio and that depletion of this factor(s) gives rise to an increase in cell cycle duration allowing for the activation of embryonic genes (Newport and Kirschner, 1982a,b; Kimelman et al., 1987). It is likely that the transcription factors responsible for gene expression at the MBT are of maternal origin. Recently, it has been found that the Xenops serum responsive factor and heat shock transcription factor are present in pre-MBT embryos (Mohun et al., 1989; Ovsenek and Heikkila, 1990). This suggested that other transcription factors may be stored in the egg to regulate transcription at the MBT. Here, we have examined several early embryonic stages for the presence of CCAAT box-specific-binding activity. The CCAAT box element is located 50-80 bp upstream of the transcriptional start site of many eukaryotic genes. A variety of studies have shown that interaction between this transcription element and its cognate binding protein activates transcription (Jones et al., 1988). In i Current address: Center for Developmental Biology, of Zoology, Iiniversity of Texas, Austin, TX 78712. ’ To whom correspondence should be addressed.
MATERIALS
Embryo
AND
METHODS
Maintena.nce
Xenopus laevis eggs were obtained, fertilized, dejelled, maintained in Steinberg’s solution, and staged as described in Heikkila et al. (1985,1987). Only normally developing embryos were used for extracts.
Whole Cell Extracts Whole cell embryo low salt extracts were obtained by the method of Mohun et al. (1989; Method 2) with the modifications of Ovsenek and Heikkila (1990). High salt extracts were obtained by the method of Mohun et al. (1989; Method 3) using 10 mM Hepes, pH 7.9, 400 mM NaCl, 1.5 mMMgCl,, 0.1 mMEDTA, 0.5 mMdithiothreito1 (DTT), 0.5 mM phenylmethanesulfonyl fluoride (PMSF), and 5% glycerol (Wu, 1984). DNase Treatment of Extracts Aliquots of neurula stage embryo low salt homogenates were treated with 30 U/ml RQl DNase (Promega) at 4°C for 30 min followed by the addition of EDTA to 5 mM. Homogenates were centrifuged and supernatants were treated with high salt, dialyzed, and frozen as de-
Department
323
0012-1606/91 Copyright All rights
$3.00
(tf 1991 by Academic Press. Inc. of reproduction in any form reserved.
324
DEVELOPMENTAL
BIOLOGY
VOLUME
145. 1991
we used whole cell extracts and a radiolabeled doublestranded oligonucleotide containing a CCAAT box element known to be involved in the constitutive expression of a microinjected human HSP’i’O gene immediately after the MBT (Ovsenek et al., 1990). A relatively high level of a CCAAT box-binding activity was detected in unfertilized eggs (lane 2). The levels of CBTF detected in cleavage and early blastula stage embryos increased twofold relative to those found in unfertilized eggs (lanes 3 and 4). This increase in CBTF binding may be due to the translation of maternal mRNA encoding CBTF or some post-translational modification of CBTF. However, a dramatic decrease in CBTF-binding activity was observed 60 min after the MBT at the late blastula stage (lane 5). Decreased levels of the CBTF-CCAAT FIG. 1. Detection of CCAAT box-binding activity during development, An end-labeled CCAAT oligonucleotide probe was incubated box interaction were also observed in extracts made with one embryo equivalent of whole cell extract made from embryos from gastrula and neurula stage embryos (lanes 6 and at several stages of development. Whole cell extracts were made with 7). These data suggested that the level of CBTF ina low salt buffer (lanes 2 to 7) or a high salt buffer (lanes 8 to 13) as creased during cleavage and early blastula stages and described under Materials and Methods. Lane 1, unbound CCAAT then decreased after the MBT. Interestingly, the apparprobe; lanes 2 and 8, unfertilized egg; lanes 3 and 9, cleavage (stage 6); lanes 4 and 10, early blastula (stage 8); lanes 5 and 11, late blastula ent decrease in CCAAT box-binding activity observed in (stage 9); lanes 6 and 12, gastrula (stage 10); lanes ‘7 and 13, neurula Fig. 1 (lanes 5-7) coincides temporally with the tran(stage 19). Specific complexes are indicated by an arrow. scriptional activation of selected zygotic genes after the MBT (Newport and Kirschner, 1982a,b). Therefore it is possible that this pattern was the result of an associascribed above. Digestion of DNA was monitored by inin viva between CBTF and CCAAT sequences in the tion cubation of aliquots from untreated and DNase-treated promoters of genes being transcribed for the first time homogenates with radiolabeled marker DNA and subafter the MBT. Given the size of the Xenopas genome, it sequent visualization on a 5% polyacrylamide nondenais also likely that CBTF may bind to nonspecific turing gel. CCAAT-like sequences in post-MBT embryos. In the present study, it is likely that CBTF was availDNA Mobility Shift Assays able for oligonucleotide binding in low salt extracts DNA mobility shift assays were performed as de- made from embryos prior to the MBT, but not in low salt scribed (Ovsenek and Heikkila, 1990). The binding reac- extracts made from post-MBT embryos. To test this postions contained one embryo equivalent (10 ~1) of whole sibility, extracts were made from batches of developing cell extract, mixed with 1.0 ng of double-stranded 32P- embryos by homogenization in a high salt buffer capaend-labeled CCAAT box oligonucleotide (5’-GATCTCble of disrupting in viva DNA-protein interactions (Wu, GAGCTCGGTGATTGGCTCAGAAGGGAAAAGGC1984). In contrast to our results with the low salt buffer, CGA-3’; Ovsenek et ab, 1990). the DNA mobility shift assay shown in Fig. 1 (lanes 8 to 13) employing the high salt extract reveals that CCAAT Photoafinity Labeling of CCAAT Box-Binding Protein box-binding activity increased fourto fivefold Ultraviolet crosslinking was performed as previously throughout development from unfertilized eggs to the described (Ovsenek and Heikkila, 1990). A 32P-labeled neurula stage. bromodeoxyuridine (BrdU) substituted CCAAT oligonuSpecificity of the embryonic CBTF-CCAAT box intercleotide probe was prepared by annealing a g-base action was assessedby competition experiments using primer (Y-TCGGCCTT-3’) to the CCAAT strand shown high salt extracts made from both cleavage and gastrula above and filling in with the Klenow fragment of DNA stage embryos (Fig. 2). The addition of a 50-fold excess polymerase 1 with dATP, dGTP, [cu-32P]dCTP, and a 1:l of unlabeled CCAAT oligonucleotide in the binding reacratio of dTTP:BrdU. tion resulted in a reduction of the retarded complex (lanes 3 and 6) whereas the presence of a 50-fold excess RESULTS AND DISCUSSION of unlabeled oligonucleotide did not affect the CBTFCCAAT box interaction (lanes 4 and 7). A similar result In order to detect the presence of CCAAT box-binding transcription factor(s) (CBTF) in Xenopus eggs and em- was obtained when egg extracts or low salt extracts from cleavage and gastrula stage embryos were used bryos by means of a DNA mobility shift assay (Fig. l), 1234567
-*dBIlb-d),
8 9 10 11 12 13 a* L* #a 10 Il- *I
OVSENEK,
KARN,
325
AND HEIKKILA
1234567
@* .a **i
FIG. 2. Specificity of the CCAAT box-binding activity in whole cell extracts of cleavage and gastrula stage embryos. A DNA mobility shift assay was performed using 1 ng of end-labeled CCAAT oligonucleotide (lane 1) and a high salt whole cell extract (one embryo equivalent) of stage 6 and stage 10 embryos (lanes 2 and 5, respectively). Competition experiments were performed with a 50-fold excess of unlaheled CCAAT (lanes 3 and 6) or with a 50-fold excess of unlabeled noncomplementary HSE oligonucleotide (lanes 4 and 7). Specific complexrs arc indicated with an arrow.
(data not shown). Thus, the CCAAT box-binding activity detected in whole cell extracts made from embryos before and after the MBT is sequence-specific. The faster migrating nonspecific interactions observed in these assays are typical of whole cell extracts (Ovsenek and Heikkila, 1990; Ovsenek et al., 1990) and were not affected by the addition of competitor CCAAT DNA. It was important to determine if the reduction in CBTF levels in low salt extracts was a consequence of incomplete nuclear lysis during the preparation of extracts from later stage embryos. Several batches of gastrula stage embryos were homogenized in low salt buffer, and the pellets were resuspended in low salt buffer and subjected either to further homogenization or to the rounds of freezing and thawing in liquid N,. The DNA mobility shift assay shown in Fig. 3 demonstrates that, relative to the low salt supernatant (lane 2), very low levels of CBTF were found in the pellet resuspended in low salt buffer (lane 3), even after two rounds of freezing and thawing (lane 4). We reasoned that if transcription factors associate with chromatin in gastrula stage and neurula stage embryos, CBTF could be recovered from the pellets by high salt treatment. Whereas high salt treatment of the low salt supernatant isolated from neurulae did not result in an increase in CBTF activity (lane 5), resuspension of the correspond-
ing pellet in high salt buffer resulted in the recovery of a CCAAT box-CBTF complex (lane 6). In similar experiments performed with cleavage stage embryos (stage 6), no CBTF activity was recovered from the pellet after resuspension with either low or high salt buffers (lanes 7 to 10). Based on the generally accepted premise that low salt does not interfere with specific DNA-protein interactions, we tentatively concluded that CBTF was pelleted during centrifugation of low salt homogenates by associating with its target DNA sequences in chromatin. This idea was tested more vigorously by incubating a low salt homogenate of post-MBT embryos with DNase prior to centrifugation. We predicted that digestion of DNA would result in more soluble lower molecular weight fragments and that, subsequently, CBTF binding activity would be detectable in the supernatant after high salt treatment. Gel shift analysis revealed levels of CBTF-binding activity in the DNase-treated samples higher than those in the control low salt supernatant (Fig. 4, compare lanes 2 and 3). The level of CBTF binding in DNase-treated low salt extracts was similar to that of high salt extracts (lane 4), indicating that the digestion of DNA in the homogenate substantially reduced the pelleting of DNA-associated CBTF during centrifugation. Thus, we confirmed that CBTF was co-pel123456
7 8 9 *
10
*I
-
FIG. 3. Recovery of a CCAAT box-binding activity from low salt extracts of gastrula stage embryos. A DNA mobility shift assay was performed using 1 ng of end-labeled CCAAT oligonucleotide (lane 1) and a low salt extract (one embryo equivalent) of stage 10 embryos (lane 2). Lane 3 contains an aliquot of the pellet obtained during the extraction procedure which was resuspended and homogenized in low salt buffer. Lane 4 contains a similar aliquot treated with two rounds of freezing and thawing. Lane 5 contains supernatant (as in lane 2) which had been subjected to a high salt treatment. Lane 6 contains an aliquot of the pellet similar to that in lane 3 except that it had been resuspended in high salt buffer. Lane 7, cleavage stage low salt extract; lane 8, cleavage stage pellet resuspended in low salt; lane 9, cleavage stage low salt extract subsequently treated with high salt; lane 10, cleavage stage pellet treated with high salt. Specific complexes are indicated by an arrow.
326
DEVELOPMENTAL BIOLOGY
FIG. 4. Decline of CBTF-binding activity in low salt extracts of postMBT embryos is sensitive to DNase. A DNA mobility shift assay was performed using 1 ng of end-labeled CCAAT oligonucleotide (lane 1) and a neurula stage low salt extract (lane 2), a DNase-treated neurula extract (lane 3), and a high salt neurula extract (lane 4). It should be emphasized that the supernatant obtained after DNase treatment was treated with high salt to release CBTF. Each lane contains extract equivalent to one embryo. The slightly different pattern of migration of CBTF and the nonspecific band relative to previous figures is due to the use of different electrophoresis equipment. Specific complexes are indicated with an arrow.
leting with DNA rather than another cellular component such as cytoskeleton in low salt extracts. The decline in CBTF binding activity in low salt extracts occurs within 1 hr after the MBT, a time at which transcription of zygotic genes is rapidly increasing (Newport and Kirschner, 1982a,b). We speculate that CBTF-CCAAT interactions which participate in transcription may be inhibited during early development as a consequence of the absence of a G phase in the cell cycles of pre-MBT embryos. It is tenable that rapid oscillation between S and M phases in the first 12 cell cycles effectively precludes CCAAT element-CBTF interactions until the slowing of the cell cycle at MBT. An alternative explanation for our observations is that CBTF and other transcription factors are excluded from nuclei until the blastula stage of development. Dreyer (1987) has reported that some nuclear proteins are released to the cytoplasm after germinal vesicle breakdown and do not reenter embryonic nuclei until the blastula stage. The possibility that maternally derived transcription factors remain in the cytoplasm until the MBT is consistent with previous studies showing very low levels of CCAAT box-binding activity in early blastula stage nuclear extracts (Ovsenek et al., 1990). However, since the recovery of intact nuclei from pre-MBT embryos is difficult due to their large size, a cytological
VOLUME 1451991
approach may be preferable to assess the intracellular location of transcription factors during development. The approximate molecular size of CBTF was determined by a photoaffinity-labeling technique. Three polypeptides with apparent molecular masses of 68,52, and 42 kDa were observed in both cleavage and gastrula stage samples (data not shown). This result is not surprising given the multicomponent nature of CCAATbinding proteins such as CBP, CPl, and CP2 (Hatamochi et ah, 1988). The appearance of one specific band in the gel shift assays with embryonic extracts would suggest that we have detected a single binding activity. However, since several different CCAAT element-binding proteins have been shown to exist within eukaryotic cells (Raymondjean et aZ., 1988), we cannot rule out the possibility that other CCAAT-specific binding activities are present in embryos. Also, we have not yet established a relationship, if any, between Xenopus CBTF and known CCAAT-specific-binding proteins such as Xenopus FRG Y-box-binding protein (Tafuri and Wolffe, 1990), CTF/NFl (Jones et ah, 1987), C/EBP (Graves et al., 1986), or CPl (Hatamochi et al., 1988). We thank Andrew Johnson and Paul Krieg for their helpful suggestions. This work was supported by a Natural Sciences and Engineering Research Council of Canada grant to J.J.H. N.O. was supported by an Ontario Graduate Scholarship.
REFERENCES DREYER, C. (1987). Differential accumulation of oocyte nuclear proteins by embryonic nuclei of Xenopus. Development 101,829-846. GRAVES, B. J., JOHNSON, P. F., and MCKNIGHT, S. L. (1986). Homologous recognition of a promoter domain common to the MSV LTR and the HSV tk gene. Cell 44,565-576. HATAMOCHI, A., GOLUMBEK, P. T., VAN SCHFTINGEN, E., and DE CROMBRUGGHE, B. (1988). A CCAAT DNA binding factor consisting of two different components that are both required for DNA binding. J. Biol. Chem. 263,5940-5947. HEIKKILA, J. J., KLOC, M., BURY, J., SCHULTZ, G. A., and BROWDER, L. W. (1985). Aquisition of the heat shock response and thermotolerante during early development of Xenopus laevis. Dev. Biol. 107, 483-489.
HEIKKILA, J. J., OVSENEK, N., and KRONE, P. H. (1987). Examination of heat shock protein mRNA accumulation in early Xenopus laevis embryos. Biochem. Cell Biol. 65,87-94. JONES, K. A., KADONAGA, J. T., ROSENFELD, P. J., KELLY, T. J., and TIJAN, R. (1987). A cellular DNA-binding protein that activated eukaryotic transcription and DNA replication. Cell 48,79-89. JONES, N. C., RIGBY, P. W. J., and ZIFF, E. B. (1988). Transacting protein factors and the regulation of eukaryotic transcription: Lessons from studies on DNA tumor viruses. Genes Dev. 2,267-281. KIMELMAN, D., KIRSCHNER, M., and SCHERSON,T. (1987). The events of the midblastula transition in Xenoms are regulated by changes in the cell cycle. Cell 48, 399-407. MOHUN, T. J., TAYLOR, M. V., GARRET, N., and GURDON, J. B. (1989).
OVSENEK,
KARN,
AND HEIKKILA
The CArG promoter sequence is necessary for muscle-specific transcription of the cardiac actin gene in Xcnopus embryos. EMBO J. 8, 1153-1161. NEWPORT, J., and KIRSCHNER, M. (1982a). A major developmental transition in early Xenomus embryos. I. Characterization and timing of cellular changes at the midblastula stage. Cell 30,675-686. NEWPORT, J., and KIRSCHNER, M. (198213). A major developmental transition in early Xenows embryos. II. Control of the onset of transcription. Cell 30, 687-696. OVSENEK, N., and HEIKKILA, J. J. (1990). DNA sequence-specific binding activity of the heat shock transcription factor is heat-inducible before the midblastula transition of early Xenoms development. Dewloprnenf 110, 427-433.
CBTF
Levels
in Xenopw
Embryos
327
OVSENEK, N., WILLIAMS, G. T., MORIMOTO, R. I., and HEIKKILA, J. J. (1990). Cis-acting sequences and trans-acting factors required for constitutive expression of a microinjected HSP’IO gene after the midblastula transition of Xenoms laevis embryogenesis. Dell. Genet. 11, 97-109. RAYMONDJEAN, M., CEREGHINI, S., and YANIV, M. (1988). Several distinct “CCAAT” box binding proteins coexist in eukaryotic cells. Proc. Natl. Acad. Sci. USA 85,757-761. TAFURI, S. R., and WOLFFE, A. P. (1990). Xenms Y-box transcriptional factors: Molecular cloning, functional analysis, and developmental regulation. Proc. N&l. Acud. Sci. USA 87, 9028-9032. WU, C. (1984). Activating protein factor binds in vitro to upstream control sequences in heat shock gene chromatin. Nature 311,81-84.
BIOLOGY
145, 323-327
(1991)
Analysis of CCAAT Box Transcription Factor Binding Activity during Early Xenopus laevis Embryogenesis NICK OVSENEK,~ HEATHER Department
of Biology.
University
A. KARN, AND JOHN J. HEIKKILA~ of Waterloo,
Waterloo,
Ontario,
Canada
N2L
dG1
Unfertilized eggs and pre-midblastula (MBT) stage Xenopus embryos were found to contain a large pool of maternally derived CCAAT box-binding transcription factor (CBTF). DNA mobility shift experiments using embryonic extracts prepared with either low or high salt buffers suggest that Xerl0w.s CBTF may not interact with embryonic DNA until the late blastula stage, a time point coincident with the increase in zygotic transcription. Additionally, photoaffinity-labeling experiments revealed that both pre- and post-MBT CBTF-binding activities were composed of at least three proteins having relative molecular masses of 68, 52, and 42 kDa. G 1991 Academic press. IIIC.
the present study, pre-MBT stage embryos were found to contain a large pool of maternally derived CCAAT box-binding transcription factor (CBTF). DNA mobility shift experiments using embryonic extracts prepared with either high or low salt buffers suggest that Xenopus CBTF may not interact with embryonic DNA until the late blastula stage, a time point coincident with the increase in zygotic transcription.
INTRODUCTION
During the first 6-7 hr of Xenopus development there is no significant transcription of embryonic genes as the embryo undergoes a series of 12 rapid cell divisions with abbreviated cell cycles consisting only of S and M phases (Newport and Kirschner, 1982a,b). This pattern changes abruptly at the midblastula transition (MBT) with the initiation of asynchronous cell divisions, the onset of cell motility, and transcription by RNA polymerase II and III. Strong evidence suggests that these events are initiated by the titration of a maternal component when the embryo reaches a critical nucleus to cytoplasm ratio and that depletion of this factor(s) gives rise to an increase in cell cycle duration allowing for the activation of embryonic genes (Newport and Kirschner, 1982a,b; Kimelman et al., 1987). It is likely that the transcription factors responsible for gene expression at the MBT are of maternal origin. Recently, it has been found that the Xenops serum responsive factor and heat shock transcription factor are present in pre-MBT embryos (Mohun et al., 1989; Ovsenek and Heikkila, 1990). This suggested that other transcription factors may be stored in the egg to regulate transcription at the MBT. Here, we have examined several early embryonic stages for the presence of CCAAT box-specific-binding activity. The CCAAT box element is located 50-80 bp upstream of the transcriptional start site of many eukaryotic genes. A variety of studies have shown that interaction between this transcription element and its cognate binding protein activates transcription (Jones et al., 1988). In i Current address: Center for Developmental Biology, of Zoology, Iiniversity of Texas, Austin, TX 78712. ’ To whom correspondence should be addressed.
MATERIALS
Embryo
AND
METHODS
Maintena.nce
Xenopus laevis eggs were obtained, fertilized, dejelled, maintained in Steinberg’s solution, and staged as described in Heikkila et al. (1985,1987). Only normally developing embryos were used for extracts.
Whole Cell Extracts Whole cell embryo low salt extracts were obtained by the method of Mohun et al. (1989; Method 2) with the modifications of Ovsenek and Heikkila (1990). High salt extracts were obtained by the method of Mohun et al. (1989; Method 3) using 10 mM Hepes, pH 7.9, 400 mM NaCl, 1.5 mMMgCl,, 0.1 mMEDTA, 0.5 mMdithiothreito1 (DTT), 0.5 mM phenylmethanesulfonyl fluoride (PMSF), and 5% glycerol (Wu, 1984). DNase Treatment of Extracts Aliquots of neurula stage embryo low salt homogenates were treated with 30 U/ml RQl DNase (Promega) at 4°C for 30 min followed by the addition of EDTA to 5 mM. Homogenates were centrifuged and supernatants were treated with high salt, dialyzed, and frozen as de-
Department
323
0012-1606/91 Copyright All rights
$3.00
(tf 1991 by Academic Press. Inc. of reproduction in any form reserved.
324
DEVELOPMENTAL
BIOLOGY
VOLUME
145. 1991
we used whole cell extracts and a radiolabeled doublestranded oligonucleotide containing a CCAAT box element known to be involved in the constitutive expression of a microinjected human HSP’i’O gene immediately after the MBT (Ovsenek et al., 1990). A relatively high level of a CCAAT box-binding activity was detected in unfertilized eggs (lane 2). The levels of CBTF detected in cleavage and early blastula stage embryos increased twofold relative to those found in unfertilized eggs (lanes 3 and 4). This increase in CBTF binding may be due to the translation of maternal mRNA encoding CBTF or some post-translational modification of CBTF. However, a dramatic decrease in CBTF-binding activity was observed 60 min after the MBT at the late blastula stage (lane 5). Decreased levels of the CBTF-CCAAT FIG. 1. Detection of CCAAT box-binding activity during development, An end-labeled CCAAT oligonucleotide probe was incubated box interaction were also observed in extracts made with one embryo equivalent of whole cell extract made from embryos from gastrula and neurula stage embryos (lanes 6 and at several stages of development. Whole cell extracts were made with 7). These data suggested that the level of CBTF ina low salt buffer (lanes 2 to 7) or a high salt buffer (lanes 8 to 13) as creased during cleavage and early blastula stages and described under Materials and Methods. Lane 1, unbound CCAAT then decreased after the MBT. Interestingly, the apparprobe; lanes 2 and 8, unfertilized egg; lanes 3 and 9, cleavage (stage 6); lanes 4 and 10, early blastula (stage 8); lanes 5 and 11, late blastula ent decrease in CCAAT box-binding activity observed in (stage 9); lanes 6 and 12, gastrula (stage 10); lanes ‘7 and 13, neurula Fig. 1 (lanes 5-7) coincides temporally with the tran(stage 19). Specific complexes are indicated by an arrow. scriptional activation of selected zygotic genes after the MBT (Newport and Kirschner, 1982a,b). Therefore it is possible that this pattern was the result of an associascribed above. Digestion of DNA was monitored by inin viva between CBTF and CCAAT sequences in the tion cubation of aliquots from untreated and DNase-treated promoters of genes being transcribed for the first time homogenates with radiolabeled marker DNA and subafter the MBT. Given the size of the Xenopas genome, it sequent visualization on a 5% polyacrylamide nondenais also likely that CBTF may bind to nonspecific turing gel. CCAAT-like sequences in post-MBT embryos. In the present study, it is likely that CBTF was availDNA Mobility Shift Assays able for oligonucleotide binding in low salt extracts DNA mobility shift assays were performed as de- made from embryos prior to the MBT, but not in low salt scribed (Ovsenek and Heikkila, 1990). The binding reac- extracts made from post-MBT embryos. To test this postions contained one embryo equivalent (10 ~1) of whole sibility, extracts were made from batches of developing cell extract, mixed with 1.0 ng of double-stranded 32P- embryos by homogenization in a high salt buffer capaend-labeled CCAAT box oligonucleotide (5’-GATCTCble of disrupting in viva DNA-protein interactions (Wu, GAGCTCGGTGATTGGCTCAGAAGGGAAAAGGC1984). In contrast to our results with the low salt buffer, CGA-3’; Ovsenek et ab, 1990). the DNA mobility shift assay shown in Fig. 1 (lanes 8 to 13) employing the high salt extract reveals that CCAAT Photoafinity Labeling of CCAAT Box-Binding Protein box-binding activity increased fourto fivefold Ultraviolet crosslinking was performed as previously throughout development from unfertilized eggs to the described (Ovsenek and Heikkila, 1990). A 32P-labeled neurula stage. bromodeoxyuridine (BrdU) substituted CCAAT oligonuSpecificity of the embryonic CBTF-CCAAT box intercleotide probe was prepared by annealing a g-base action was assessedby competition experiments using primer (Y-TCGGCCTT-3’) to the CCAAT strand shown high salt extracts made from both cleavage and gastrula above and filling in with the Klenow fragment of DNA stage embryos (Fig. 2). The addition of a 50-fold excess polymerase 1 with dATP, dGTP, [cu-32P]dCTP, and a 1:l of unlabeled CCAAT oligonucleotide in the binding reacratio of dTTP:BrdU. tion resulted in a reduction of the retarded complex (lanes 3 and 6) whereas the presence of a 50-fold excess RESULTS AND DISCUSSION of unlabeled oligonucleotide did not affect the CBTFCCAAT box interaction (lanes 4 and 7). A similar result In order to detect the presence of CCAAT box-binding transcription factor(s) (CBTF) in Xenopus eggs and em- was obtained when egg extracts or low salt extracts from cleavage and gastrula stage embryos were used bryos by means of a DNA mobility shift assay (Fig. l), 1234567
-*dBIlb-d),
8 9 10 11 12 13 a* L* #a 10 Il- *I
OVSENEK,
KARN,
325
AND HEIKKILA
1234567
@* .a **i
FIG. 2. Specificity of the CCAAT box-binding activity in whole cell extracts of cleavage and gastrula stage embryos. A DNA mobility shift assay was performed using 1 ng of end-labeled CCAAT oligonucleotide (lane 1) and a high salt whole cell extract (one embryo equivalent) of stage 6 and stage 10 embryos (lanes 2 and 5, respectively). Competition experiments were performed with a 50-fold excess of unlaheled CCAAT (lanes 3 and 6) or with a 50-fold excess of unlabeled noncomplementary HSE oligonucleotide (lanes 4 and 7). Specific complexrs arc indicated with an arrow.
(data not shown). Thus, the CCAAT box-binding activity detected in whole cell extracts made from embryos before and after the MBT is sequence-specific. The faster migrating nonspecific interactions observed in these assays are typical of whole cell extracts (Ovsenek and Heikkila, 1990; Ovsenek et al., 1990) and were not affected by the addition of competitor CCAAT DNA. It was important to determine if the reduction in CBTF levels in low salt extracts was a consequence of incomplete nuclear lysis during the preparation of extracts from later stage embryos. Several batches of gastrula stage embryos were homogenized in low salt buffer, and the pellets were resuspended in low salt buffer and subjected either to further homogenization or to the rounds of freezing and thawing in liquid N,. The DNA mobility shift assay shown in Fig. 3 demonstrates that, relative to the low salt supernatant (lane 2), very low levels of CBTF were found in the pellet resuspended in low salt buffer (lane 3), even after two rounds of freezing and thawing (lane 4). We reasoned that if transcription factors associate with chromatin in gastrula stage and neurula stage embryos, CBTF could be recovered from the pellets by high salt treatment. Whereas high salt treatment of the low salt supernatant isolated from neurulae did not result in an increase in CBTF activity (lane 5), resuspension of the correspond-
ing pellet in high salt buffer resulted in the recovery of a CCAAT box-CBTF complex (lane 6). In similar experiments performed with cleavage stage embryos (stage 6), no CBTF activity was recovered from the pellet after resuspension with either low or high salt buffers (lanes 7 to 10). Based on the generally accepted premise that low salt does not interfere with specific DNA-protein interactions, we tentatively concluded that CBTF was pelleted during centrifugation of low salt homogenates by associating with its target DNA sequences in chromatin. This idea was tested more vigorously by incubating a low salt homogenate of post-MBT embryos with DNase prior to centrifugation. We predicted that digestion of DNA would result in more soluble lower molecular weight fragments and that, subsequently, CBTF binding activity would be detectable in the supernatant after high salt treatment. Gel shift analysis revealed levels of CBTF-binding activity in the DNase-treated samples higher than those in the control low salt supernatant (Fig. 4, compare lanes 2 and 3). The level of CBTF binding in DNase-treated low salt extracts was similar to that of high salt extracts (lane 4), indicating that the digestion of DNA in the homogenate substantially reduced the pelleting of DNA-associated CBTF during centrifugation. Thus, we confirmed that CBTF was co-pel123456
7 8 9 *
10
*I
-
FIG. 3. Recovery of a CCAAT box-binding activity from low salt extracts of gastrula stage embryos. A DNA mobility shift assay was performed using 1 ng of end-labeled CCAAT oligonucleotide (lane 1) and a low salt extract (one embryo equivalent) of stage 10 embryos (lane 2). Lane 3 contains an aliquot of the pellet obtained during the extraction procedure which was resuspended and homogenized in low salt buffer. Lane 4 contains a similar aliquot treated with two rounds of freezing and thawing. Lane 5 contains supernatant (as in lane 2) which had been subjected to a high salt treatment. Lane 6 contains an aliquot of the pellet similar to that in lane 3 except that it had been resuspended in high salt buffer. Lane 7, cleavage stage low salt extract; lane 8, cleavage stage pellet resuspended in low salt; lane 9, cleavage stage low salt extract subsequently treated with high salt; lane 10, cleavage stage pellet treated with high salt. Specific complexes are indicated by an arrow.
326
DEVELOPMENTAL BIOLOGY
FIG. 4. Decline of CBTF-binding activity in low salt extracts of postMBT embryos is sensitive to DNase. A DNA mobility shift assay was performed using 1 ng of end-labeled CCAAT oligonucleotide (lane 1) and a neurula stage low salt extract (lane 2), a DNase-treated neurula extract (lane 3), and a high salt neurula extract (lane 4). It should be emphasized that the supernatant obtained after DNase treatment was treated with high salt to release CBTF. Each lane contains extract equivalent to one embryo. The slightly different pattern of migration of CBTF and the nonspecific band relative to previous figures is due to the use of different electrophoresis equipment. Specific complexes are indicated with an arrow.
leting with DNA rather than another cellular component such as cytoskeleton in low salt extracts. The decline in CBTF binding activity in low salt extracts occurs within 1 hr after the MBT, a time at which transcription of zygotic genes is rapidly increasing (Newport and Kirschner, 1982a,b). We speculate that CBTF-CCAAT interactions which participate in transcription may be inhibited during early development as a consequence of the absence of a G phase in the cell cycles of pre-MBT embryos. It is tenable that rapid oscillation between S and M phases in the first 12 cell cycles effectively precludes CCAAT element-CBTF interactions until the slowing of the cell cycle at MBT. An alternative explanation for our observations is that CBTF and other transcription factors are excluded from nuclei until the blastula stage of development. Dreyer (1987) has reported that some nuclear proteins are released to the cytoplasm after germinal vesicle breakdown and do not reenter embryonic nuclei until the blastula stage. The possibility that maternally derived transcription factors remain in the cytoplasm until the MBT is consistent with previous studies showing very low levels of CCAAT box-binding activity in early blastula stage nuclear extracts (Ovsenek et al., 1990). However, since the recovery of intact nuclei from pre-MBT embryos is difficult due to their large size, a cytological
VOLUME 1451991
approach may be preferable to assess the intracellular location of transcription factors during development. The approximate molecular size of CBTF was determined by a photoaffinity-labeling technique. Three polypeptides with apparent molecular masses of 68,52, and 42 kDa were observed in both cleavage and gastrula stage samples (data not shown). This result is not surprising given the multicomponent nature of CCAATbinding proteins such as CBP, CPl, and CP2 (Hatamochi et ah, 1988). The appearance of one specific band in the gel shift assays with embryonic extracts would suggest that we have detected a single binding activity. However, since several different CCAAT element-binding proteins have been shown to exist within eukaryotic cells (Raymondjean et aZ., 1988), we cannot rule out the possibility that other CCAAT-specific binding activities are present in embryos. Also, we have not yet established a relationship, if any, between Xenopus CBTF and known CCAAT-specific-binding proteins such as Xenopus FRG Y-box-binding protein (Tafuri and Wolffe, 1990), CTF/NFl (Jones et ah, 1987), C/EBP (Graves et al., 1986), or CPl (Hatamochi et al., 1988). We thank Andrew Johnson and Paul Krieg for their helpful suggestions. This work was supported by a Natural Sciences and Engineering Research Council of Canada grant to J.J.H. N.O. was supported by an Ontario Graduate Scholarship.
REFERENCES DREYER, C. (1987). Differential accumulation of oocyte nuclear proteins by embryonic nuclei of Xenopus. Development 101,829-846. GRAVES, B. J., JOHNSON, P. F., and MCKNIGHT, S. L. (1986). Homologous recognition of a promoter domain common to the MSV LTR and the HSV tk gene. Cell 44,565-576. HATAMOCHI, A., GOLUMBEK, P. T., VAN SCHFTINGEN, E., and DE CROMBRUGGHE, B. (1988). A CCAAT DNA binding factor consisting of two different components that are both required for DNA binding. J. Biol. Chem. 263,5940-5947. HEIKKILA, J. J., KLOC, M., BURY, J., SCHULTZ, G. A., and BROWDER, L. W. (1985). Aquisition of the heat shock response and thermotolerante during early development of Xenopus laevis. Dev. Biol. 107, 483-489.
HEIKKILA, J. J., OVSENEK, N., and KRONE, P. H. (1987). Examination of heat shock protein mRNA accumulation in early Xenopus laevis embryos. Biochem. Cell Biol. 65,87-94. JONES, K. A., KADONAGA, J. T., ROSENFELD, P. J., KELLY, T. J., and TIJAN, R. (1987). A cellular DNA-binding protein that activated eukaryotic transcription and DNA replication. Cell 48,79-89. JONES, N. C., RIGBY, P. W. J., and ZIFF, E. B. (1988). Transacting protein factors and the regulation of eukaryotic transcription: Lessons from studies on DNA tumor viruses. Genes Dev. 2,267-281. KIMELMAN, D., KIRSCHNER, M., and SCHERSON,T. (1987). The events of the midblastula transition in Xenoms are regulated by changes in the cell cycle. Cell 48, 399-407. MOHUN, T. J., TAYLOR, M. V., GARRET, N., and GURDON, J. B. (1989).
OVSENEK,
KARN,
AND HEIKKILA
The CArG promoter sequence is necessary for muscle-specific transcription of the cardiac actin gene in Xcnopus embryos. EMBO J. 8, 1153-1161. NEWPORT, J., and KIRSCHNER, M. (1982a). A major developmental transition in early Xenomus embryos. I. Characterization and timing of cellular changes at the midblastula stage. Cell 30,675-686. NEWPORT, J., and KIRSCHNER, M. (198213). A major developmental transition in early Xenows embryos. II. Control of the onset of transcription. Cell 30, 687-696. OVSENEK, N., and HEIKKILA, J. J. (1990). DNA sequence-specific binding activity of the heat shock transcription factor is heat-inducible before the midblastula transition of early Xenoms development. Dewloprnenf 110, 427-433.
CBTF
Levels
in Xenopw
Embryos
327
OVSENEK, N., WILLIAMS, G. T., MORIMOTO, R. I., and HEIKKILA, J. J. (1990). Cis-acting sequences and trans-acting factors required for constitutive expression of a microinjected HSP’IO gene after the midblastula transition of Xenoms laevis embryogenesis. Dell. Genet. 11, 97-109. RAYMONDJEAN, M., CEREGHINI, S., and YANIV, M. (1988). Several distinct “CCAAT” box binding proteins coexist in eukaryotic cells. Proc. Natl. Acad. Sci. USA 85,757-761. TAFURI, S. R., and WOLFFE, A. P. (1990). Xenms Y-box transcriptional factors: Molecular cloning, functional analysis, and developmental regulation. Proc. N&l. Acud. Sci. USA 87, 9028-9032. WU, C. (1984). Activating protein factor binds in vitro to upstream control sequences in heat shock gene chromatin. Nature 311,81-84.
