Journal of Bioscience and Bioengineering VOL. 119 No. 6, 623e628, 2015 www.elsevier.com/locate/jbiosc

Analyses of chicken sialyltransferases related to N-glycosylation Yusuke Kojima, Akifumi Mizutani,x Yuya Okuzaki, Ken-ichi Nishijima, Hidenori Kaneoka,* Takako Sasamoto, Katsuhide Miyake,xx and Shinji Iijima Department of Biotechnology, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603, Japan Received 8 September 2014; accepted 11 November 2014 Available online 8 December 2014

Proteins exogenously expressed and deposited in the egg whites of transgenic chickens did not contain terminal sialic acid in their N-glycan. Since this sugar is important for the biological stability of therapeutic proteins, we examined chicken sialyltransferases (STs). Based on homologies in DNA sequences, we cloned and expressed several chicken STs, which appeared to be involved in N-glycosylation in mammals, in 293FT cells. Enzymatic activity was detected with ST3Gal3, ST3Gal6 and ST6Gal1 using galactose-b1,4-N-acetylglucosamine (Galb1,4GlcNAc) as an acceptor. Using Golgi fractions from the cell-free extracts of chicken organs, a2,3- and/or a2,6-ST activities were detected in the liver and kidney, but were absent in the oviduct cells in which egg-white proteins were produced. This result suggested that the lack of ST activities in oviduct cells mainly caused the lack of sialic acid in the N-glycan of proteins exogenously expressed and deposited in egg white. Ó 2014, The Society for Biotechnology, Japan. All rights reserved. [Key words: Sialyltransferase; Chicken; N-Glycosylation; Transgenic chicken; Sialic acid; Oviduct]

Sialic acid almost exclusively appeared in animals, and has not been detected in microorganisms, except for pathogens such as several strains of Streptococci (1). This sugar exhibits many important biological activities including immune regulation (2). The sialic acid detected at the termini of N-glycans particularly affects the stability of proteins in blood (3). Although humans essentially contain a2,3and a2,6-linked N-acetylneuraminic acid (NeuAc) as the terminal sialic acid, proteins produced by cultured CHO cells contain a2,3linked N-glycolylneuraminic acid (NeuGc) in N-glycans. The chicken contains both a2,3- and a2,6-linked NeuAc, which is advantageous as a host producing therapeutic proteins for human use. We previously established transgenic chickens that produced useful proteins (4e6). Since only limited species of proteins could be transported to egg yolk such as immunoglobulins (7,8), and the productivity of an antibody in the yolk was lower than that in the egg white (4), we adopted the strategy in which exogenously expressed proteins were deposited in the egg white. However, we and others reported that protein products produced in the egg white lacked terminal galactose and sialic acid in N-glycans (6,9,10), which suggested the low expression of galactosyltransferase (GalT) in the magnum portion of the oviduct in which egg white protein is produced. Thus, genetically-manipulated chickens expressing both chicken GalT1 and human erythropoietin or single-chain FvFc were

* Corresponding author. Tel.: þ81 52 789 4278; fax: þ81 52 789 3221. E-mail address: [email protected] (H. Kaneoka). Present address: Department of Biotechnology, Division of Chemistry and Biotechnology, Graduate School of Natural Science and Technology, Okayama University, Okayama 700-8530, Japan. xx Present address: Research Institute for Bioresources and Biotechnology, Ishikawa Prefectural University, Ishikawa 921-8836, Japan. x

established, and showed that galactose was added effectively to the N-glycans of exogenously expressed proteins in these geneticallymanipulated chickens (11,12). However, terminal sialic acid could not be detected with the N-glycan of the recombinant proteins, which suggested that the expression of sialyltransferase (ST) was also low in the oviduct cells. To clarify this issue, the genes for several chicken putative STs were molecularly cloned and expressed in 293FT cells, and enzymatic activity was identified in the present study. The expression of STs in several chicken organs was analyzed by reverse-transcription-quantitative PCR (RT-qPCR) and also by an assay for the enzymatic activity. We found that oviduct magnum cells contained very low enzymatic activity of STs for N-glycosylation. MATERIALS AND METHODS Cloning and expression of STs Chicken ST3Gal3 and ST6Gal2 DNAs were amplified by PCR from chicken blastodermal cDNA as a template with the following primers; ckST3Gal3, Dir: CATGAATTCATGGGACTGCTGGTGTTCATGCG and Rev: CATCTCGAGGACCCCACTGGCCAGGTCCG; ckST6Gal2, Dir: CATGAATTCATGAAACCTAACTTGAAGCAATG and Rev: CATCTCGAGCAAGGGTGGAAAATTATTTCG. The underlined sequences indicate either an EcoRI or XhoI site. The amplified DNAs were cloned into pcDNA4/TO/Myc-His A (Invitrogen, Carlsbad, CA, USA). Chicken ST3Gal4, ST3Gal6, and ST6Gal1 sequences were also amplified by PCR from chicken brain cDNA as the template and the following primers; ckST3Gal4, Dir: TTAGTCGACCATGATCAATAAGTCCCGAGG and Rev: CGTATCGATTAGAAGTAGGTGAGGTTCTTG; ckST3Gal6, Dir: CGCGTCGACCATGAAACGAATTCTTCTGTT and Rev: CGTATCGATTACGTCAAGTTGACCACAAAG; ckST6Gal1, Dir: AAAGTCGACCATGGTTCACATCAATGTGCTGA and Rev: GCAATCGATTAGCAATGTACATTTCGGAAG (the SalI and ClaI sites are underlined), and cloned to pBluescript II KS () (Agilent Technologies, Santa Clara, CA, USA). The coding region was amplified again with the plasmids as templates and following primers; ckST3Gal4, Dir: GCCAAGCTTACCATGATCAATAAGTCCCGA and Rev: GCGTCTAGATCGATTGAAGTAGGTGAGGT; ckST3Gal6, Dir: CATCTGCAGATGAAACGAATTCTTCTGTTTTTCATCC and Rev: CATCTCGAGCGTC

1389-1723/$ e see front matter Ó 2014, The Society for Biotechnology, Japan. All rights reserved. http://dx.doi.org/10.1016/j.jbiosc.2014.11.009

624

KOJIMA ET AL.

J. BIOSCI. BIOENG.,

AAGTTGACCACAAAGTTCTT; ckST6Gal1, Dir: CCCAAGCTTACCATGGTTCACATCAATGTG and Rev: CCGTCTAGAGCAATGTACATTTCGGAAG (the HindIII, XbaI, PstI, and XhoI sites are underlined), and cloned to pcDNA4/TO/Myc-His A. Primers were designed following the putative DNA sequence data of chicken STs: ST3Gal3, JX035876; ST3Gal4, JX035870; ST3Gal6, JX035874; ST6Gal1, JX035872; and ST6Gal2, JX035873. We also cloned mouse ST3Gal1 as a control. The DNA was amplified by PCR from mouse spleen cDNA as a template with following primers; Dir: CATGAATTCATGAGGAGGAAGACCCTCAAGTACC and Rev: CATCTCGAGTCTCCCCTTGAAGATGCGGAT (the EcoRI and XhoI sites are underlined). Primers were designed following the putative DNA sequence data of mouse ST3Gal1 (BC084730). Preparation of the Golgi fraction Organs (the brain, liver, kidney, and magnum, approximately 1 g) were cut into small pieces, and 9 ml of 0.25 M sucrose in 5 mM TriseHCl (pH 7.5) was added. Golgi/microsome fraction was prepared as reported previously (11), and suspended in a suitable amount of 50 mM HEPESNaOH (pH 6.9) and 2% Triton X-100. Measurement of enzymatic activity 293FT cells were maintained in DMEM high glucose medium (SigmaeAldrich, St. Louis, MO, USA) containing 10% fetal bovine serum (FBS), penicillin, and streptomycin. The cells (3  105 cells per 35-mm culture dish were seeded one day before) were transfected with 2.5 mg each of the chicken expression vectors of various STs (pcDNA4/TO/myc-HisA/ckST) using Lipofectamine 2000 (Invitrogen) or FuGENE HD (Promega, Madison, WI, USA) as recommended by the suppliers. Two days after being transfected, cells were harvested and suspended in phosphate buffered saline (PBS) containing 1% Triton X-100. After sonication, cell debris was removed by centrifugation at 10,000 rpm, 4 C for 5 min, and crude cell extracts were obtained. ST activity was measured in 50 mM HEPESNaOH (pH 6.9), 1 mg/ml of galactose-b1,4-N-acetylglucosamine (Galb1,4GlcNAc, SigmaeAldrich) or galactose-b1,3-N-acetylgalactosamine (Galb1,3GalNAc, Toronto Research Chemicals, Ontario, Canada), 2.5 mCi/ml 14C-labeled CMP-sialic acid (cytidine 50 -monophosphate sialic acid [sialic-6-14C], American Radiolabeled Chemicals, St. Louis, MO, USA), 50 mg/ml bovine serum albumin, 1 mM MgCl2, 0.5% Triton X-100, and a suitable amount of the cell lysate or Golgi fraction in a total volume of 20 ml. After the overnight reaction at 37 C, 5 ml of the samples were spotted on HPTLC silica gel 60 (10 cm  10 cm, Merck Millipore, Darmstadt, Germany), which was developed three times with 1-buthanol: ethanol: H2O ¼ 5:3:2. The plate was exposed to an Xray film overnight at 80 C. For the control, the reaction product of commercially available a2,3-(N)-Sialyltransferase (Rat, Recombinant; Merck Millipore), and the unlabeled sugar standards (NeuAca2,3Galb1,4GlcNAc and NeuAca2,6Galb1,4GlcNAc, ProZyme, Hayward, CA, USA) were used. The expression levels of recombinant chicken STs were detected by Western blotting with a mouse anti-His antibody (MBL, Nagoya, Japan) and goat anti-mouse IgG-HRP (Santa Cruz Biotechnology, Santa Cruz, CA, USA). To determine enzymatic activity against fetuin, 25 mg asialofetuin (SigmaeAldrich) was incubated with the 5 mg Golgi fraction at 37 C overnight in 50 mM MES-NaOH (pH 6.0), 0.5% Triton-X 100, 25 mg bovine serum albumin, and 0.2 mM CMP-NeuAc (SigmaeAldrich) in a total volume of 30 ml. Proteins were separated by SDS gel electrophoresis, blotted on PVDF membranes, and sialylated fetuin was detected with SSA lectin (Seikagaku Kogyo, Tokyo, Japan), mouse anti-SSA antiserum, and goat anti-mouse IgG-HRP (6). Mouse anti-SSA antiserum was prepared in our laboratory by injecting SSA lectin into mice. RT-qPCR Total RNAs were isolated from the brain, trachea, liver, magnum, small intestine, and large intestine of 2-year-old female white leghorns using RNAiso Plus (Takara Bio, Shiga, Japan) according to the supplier’s instructions. Total RNA from each organ (10e50 mg) was digested with DNase I (RNase free, Takara Bio), then purified with RNAiso Plus. cDNAs were obtained from 5 mg of total RNA from each organ using ReverTra Ace (Toyobo, Osaka, Japan) as recommended by the supplier. Two microliters of 5-fold diluted cDNA, 10 ml of Thunderbird SYBR qPCR Mix (Toyobo) and 10 pmol of each primer in a total volume of 20 ml were used for qPCR. PCR reactions were conducted using the following thermal cycle; after predenaturation at 94 C for 1 min; denaturation at 95 C for 5 s, annealing at 60 C for 10 s, extension at 72 C for 30 s, total 40 cycles. The following primers were used for amplification. ckST3Gal3, Dir: TCCCAAAGTTCTCGAAGCCG and Rev: GGCAGCTGAGACTGTCAAGA; ckST3Gal4, Dir: AAGAAAACAAGACCGTATGTCCC and Rev: CGT CCTCACCCAGAAGTAATC; ckST3Gal6, Dir: GGAGAGAAGGAACGCCCTAA and Rev: ACTGGCACACAGGAACGG; ckST6Gal1, Dir: TGGGTCGCTGTGCTGTT and Rev: TGG GAGTTGACAAGACGAATC; ckST6Gal2, Dir: TCTCACCAACCCAAACCATCA and Rev: TCCGGCTTCTTATACCACACA; chicken glyceraldehyde 3-phosphate dehydrogenase (ckGAPDH), Dir: GGGCACGCCATCACTATC, and Rev: GTGAAGACACCAGTGGACTCC. Purified ST expression-plasmid DNAs were used as controls. Primers were designed based on the DNA sequence in the database as described for the primers to clone STs. Chickens White leghorns were provided by Nissei Bio (Yamanashi, Japan) and the Nagoya University Graduate School of Bioagricultural Science, Avian Bioscience Research Center through the National Bio-Resource Project of the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan.

RESULTS Cloning and characterization of chicken STs Three chicken STs (ST3Gal3, ST3Gal4 and ST3Gal6) that may transfer sialic acid to the Galb1,4GlcNAc of N-glycans through the a2,3 linkage, and two

STs (ST6Gal1 and ST6Gal2) that transfer through a2,6 linkage were supposed based on their homologies to mammalian counterparts (13). The acceptor of mammalian ST3Gal3, ST3Gal4, and ST3Gal6 were assumed to be Galb1,4GlcNAc attached to proteins. Although ST3Gal3 reacted with Galb1,4GlcNAc, it displayed a preference for Galb1,3GlcNAc. Mammalian ST6Gal1 transfers sialic acid to Galb1,4GlcNAc. ST6Gal2 transfers the sugar to both GalNAcb1,4GlcNAc and Galb1,4GlcNAc, but preferentially to the former acceptor. The homologies of the amino acid sequences between chicken STs and their human orthologs were ST3Gal3, 85.1%; ST3Gal4, 75.4%; ST3Gal6, 66.2%; ST6Gal1, 60.6% and ST6Gal2, 71.2%. Of these, enzymatic activity was only previously determined for ST6Gal1 in the chicken (14). Thus, we confirmed the activity of putative STs. We cloned the genes of chicken ST3Gal3, ST3Gal4, ST3Gal6, ST6Gal1, and ST6Gal2, which were potentially involved in the formation of sialylated N-glycans. The DNA sequences and deduced amino acid sequences of these clones were analyzed. The amino acid sequences of our clones differed at several points from those of chicken STs from a database; some resided in a highly variable region, while others were the same as the mammalian counterparts. STs generally have similar structures such that a trans membrane and stem region in the N-terminal half of the enzyme molecule, and four essential domains for enzymatic activity: an L domain in the central part, and S, III, and VS domains in the Cterminal regions (13,15 and Supplementary Figs. S1eS5). Sequences in the essential regions were well conserved between our clones and those from the database. The amino acid sequences of the essential domains were basically the same between mammals and the chicken, but some differed: the following amino acid substitutions were observed between the chicken and mammals: ST3Gal3 (6 substitutions in the L and S domains), ST3Gal4 (6 substitutions in the L, S, and VS domains), ST3Gal6 (9 substitutions in the L, S, III, and VS domains), ST6Gal1 (7 substitutions in the L, S, and III domains), and ST6Gal2 (one substitution in the L domain). Furthermore, deletions (ST3Gal3 and ST3Gal4) and the insertion (ST3Gal6) of amino acid sequences were observed in the stem regions (Supplementary Figs. S1eS5). Whether these differences made any contribution to the changes in enzymatic activity remains unclear; however, previous studies reported that the stem region could modulate the activity (15,16). One of the ST3Gal6 clones that we obtained lacked the chicken-specific insertion of the stem region. Since the deleted amino acid sequence corresponded to exon 2 of the chicken ST3Gal6 gene, this deleted clone may have been generated by differential splicing. His-tagged chicken STs were expressed in 293FT cells. Using the cell extract, enzymatic activity was measured with 14C-labeled CMP-sialic acid as a donor and Galb1,4GlcNAc as an acceptor. As shown in Fig. 1A, chicken ST3Gal6 and ST6Gal1 produced sialylated Galb1,4GlcNAc, while ST3Gal3 gave a faint band of the product. However, the reaction could not be observed with ST3Gal4 and ST6Gal2. To determine expression levels, STs were detected by Western blotting with an anti-His antibody, and it was found that the amount of produced proteins was slightly different among STs (Fig. 1B). In addition to a distinct band of full-length enzyme, several bands possibly corresponding to degradation products were observed with ST3Gal4. Similar results were obtained when HeLa cells were used as a host (data not shown). We also analyzed enzymatic activity of deleted ST3Gal6 (ST3Gal6DE2, Fig. 1C). This deleted enzyme showed decreased enzymatic activity comparing to full-length chicken ST3Gal6, suggesting that the chicken-specific additional sequence in the stem region may be important for the activity. Distribution of STs in chicken organs The expression of putative STs that may be involved in N-glycosylation was examined.

VOL. 119, 2015

A

B

C

FIG. 1. In vitro ST activities of putative chicken STs expressed in 293FT cells. (A) Recombinant chicken STs were incubated with Galb1,4GlcNAc and CMP-[14C]-NeuAc as the acceptor and donor, respectively. Arrowheads show the positions of the CMPNeuAc and reaction products that were determined with commercially available oligosaccharides. (B) The expression level of each enzyme was confirmed by Western blotting with an anti-His antibody. (C) Enzymatic activity of deleted ckST3Gal6 (36DE2) that lacked a portion of the stem region of the enzyme (top) and the expression level (bottom). Assay condition was the same to that in Fig. 1A. Empty, negative control with an empty vector. Representative results of several experiments are shown.

ANALYSES OF CHICKEN SIALYLTRANSFERASES

625

The expression of these enzymes was assessed by RT-qPCR (Fig. 2). The expression of chicken ST3Gal3 and ST3Gal4 was generally low in all the organs tested, although a certain level of expression was observed with ST3Gal3 (the liver) and ST3Gal4 (the liver and small intestine). The distinct expression of ST3Gal6 was observed in the liver, kidney, magnum, and small intestine. The expression level of ST3Gal6 in the magnum of the oviduct was almost a half that in the liver. ST6Gal1 was expressed in the liver and small intestine, and the copy number of mRNA deduced by RT-qPCR appeared to be the highest among the STs examined. On the other hand, the expression level of ST6Gal1 in the magnum was very low. The expression of ST6Gal2 was relatively low in almost all organs, except for the liver. The expression of certain levels of ST3Gal6 in the magnum did not agree with our result that exogenously expressed human erythropoietin was not sialylated, even in the presence of active GalT1 (12). To clarify the distribution of ST activity, we directly measured the enzymatic activities of several organs. Golgi fractions were prepared from the brain, liver, kidney, and magnum cells of the hen because STs involved in N-glycosylation were localized to the Golgi bodies. ST activity was detected in vitro using Galb1,4GlcNAc as an acceptor. Strong a2,6-ST activity was detected in the liver Golgi fraction. Weak a2,3-ST activity was detected in the liver and kidney, and very weak activity near detection level was observed in the brain. However, neither a2,3- nor a2,6-ST activities was detected in the magnum Golgi fraction under the condition (Fig. 3A). To confirm the lack of ST activities in magnum cells more precisely, a larger amount of the Golgi fraction was used in the enzymatic assay. In the liver Golgi fraction, proportional amounts of the reaction product, NeuAca2,3Galb1,4GlcNAc, was observed with increases in the Golgi fraction (Fig. 4A), and the dense band of NeuAca2,6Galb1,4GlcNAc, was detected with 2 mg-protein of the Golgi fraction. In this experiment, the band of the donor (CMP-NeuAc) completely disappeared when 2 mg of the liver Golgi fraction was used, suggesting that the reaction was completed under these conditions. On the other hand, faint bands of both NeuAca2,3Galb1,4GlcNAc and NeuAca2,6Galb1,4GlcNAc were detected with 20 mg-protein of the magnum Golgi fraction (Fig. 4B). These

FIG. 2. Expression of chicken ST genes analyzed by RT-qPCR. Copy numbers of the mRNAs were estimated using purified plasmids as controls and normalized by the copy number of GAPDH for comparisons between those in each organ. The values of mRNA expression levels are represented as a reference against that of brain ST3Gal3. Mean and standard deviations from three independent experiments are shown.

KOJIMA ET AL.

A

B

FIG. 3. ST activities in various organs. (A) Golgi fractions of various organs (5 mg) were incubated with Galb1,4GlcNAc. Arrowheads show labeled substrate and products as in Fig. 1A. NC, a negative control in which the reaction mixture did not contain any cell extract. (B) Golgi fractions (5 mg) were incubated with Galb1,3GalNAc. For the control, mST3Gal1 was used that produced NeuAca2,3Galb1,3GalNAc (13). Representative results of several experiments are shown.

results suggested that magnum cells may contain a2,3- and a2,6-ST activities toward Galb1,4GlcNAc, but at low levels. On the other hand, distinct a2,3-ST activity toward galactose-b1,3-N-acetylgalactosamine (Galb1,3GalNAc) was observed in the magnum; the activity was not detected with other organs tested except for very weak activity in the kidney (Fig. 3B). Since NeuAca2,3Galb1,3GalNAc is typical in O-glycan, the magnum may contain ST3Gal1 or ST3Gal2 activity assuming from the enzymatic activity of mammalian counterparts (13). These results showed that

A

J. BIOSCI. BIOENG., evident ST activity involved in N-glycosylation was not detected in the magnum cells as long as assay was performed in vitro using Galb1,4GlcNAc as substrate. To measure ST activity against the protein substrate, the Golgi fraction were prepared from the liver and magnum from wild type and GalT1 genetically-manipulated hens (11), and ST activity was analyzed in vitro using asialofetuin as a substrate. The liver Golgi fraction produced a2,6-sialylated fetuin, since a distinct band with molecular mass corresponding to sialylated fetuin could be detected with a2,6-sialic acid specific lectin (SSA). The sugar conjugation activity disappeared after the heat treatment of the cell extract. On the other hand, the band corresponding to the sialylated fetuin was not detected with the magnum Golgi fraction (Fig. 5). When a larger amount of the magnum Golgi fraction (20e40 mg) was used, the enzymatic activity could not be detected (data not shown). Taken together with the results of in vitro enzymatic activity assay with sugar substrates, these results indicated that magnum cells contained the very weak ST activities near detection level. Since the detection level of a lectin against a2,3-sialic acid (MAM lectin) was not sufficient, we could not assay a2,3-ST activity against asialofetuin. DISCUSSION Mammalian STs involved in protein glycosylation are divided into several groups depending on their types of sialic acid linkage that they formed such that (i) specific to a2,3, (ii) specific to a2,6 and (iii) specific to a2,8. Each group contains several STs, and some of them involved in N-glycosylation, O-glycosylation and polysialylation (13). Chicken counterparts of them have been identified based on the DNA sequences in a database, and the enzymatic activity had been detected only with ST6Gal1 (14). In the present study, we cloned chicken STs relating to N-glycosylation, and enzymatic activity was detected with ST3Gal3 and ST3Gal6 in addition to ST6Gal1. Table 1 summarizes the characteristics of cloned chicken STs in this study. It currently remains unclear why chicken ST3Gal4 activity could not be detected. However, the specific activity of a2,3-STs was generally lower than that of a2,6-ST in the in vitro assay. Therefore, it is possible that chicken ST3Gal4 exhibited very weak activity under the assay conditions used, even though mouse ST3Gal4 showed higher Vmax than that of ST3Gal3 (17), and chicken ST3Gal3 revealed a weak but distinct enzymatic activity. Alternatively, it is possible that a mutation observed in chicken ST3Gal4 may cause inactivation. In fact, the active site amino acid sequence in the VS region (an essential region for enzymatic activity) was different between

w/o Golgi

626

B

Golgi WT

Inactivated Golgi

GalT1 WT GalT1

L M L M L M L

M

66 45 kDa

Lectin Blot : SSA ( 2,6Sia) FIG. 4. Measurement of ST activity with increasing amounts of Golgi fractions of (A) the liver (2e10 mg) and (B) magnum (5e40 mg). To measure ST activity, Golgi fractions were incubated with Galb1,4GlcNAc and CMP-[14C]-NeuAc as the acceptor and donor, respectively. Representative results of several experiments are shown.

FIG. 5. ST activities against asialofetuin. Liver and magnum Golgi fractions prepared from two different hens (WT, wild type; GalT1, GalT1 genetically-manipulated chicken) were reacted with asialofetuin and CMP-NeuAc as the acceptor and donor, respectively. Representative results of several experiments are shown.

VOL. 119, 2015

ANALYSES OF CHICKEN SIALYLTRANSFERASES

627

TABLE 1. Enzymatic activity and substrate specificity of chicken sialyltransferases. Mammala

Enzyme Substrate carrier

Chicken (this study) Structure of substrate

In vitro activity

Structure of substrate

ST3Gal3 ST3Gal4 ST3Gal6

GP GP > GL GP, GL

Galb1,3GlcNAc > Galb1,4GlcNAc Galb1,4GlcNAc > Galb1,3GlcNAc Galb1,4GlcNAc > Galb1,3GlcNAc

D ND D

Galb1,3GlcNAc > Galb1,4GlcNAc Unknown Galb1,4GlcNAc > Galb1,3GlcNAc

ST6Gal1 ST6Gal2

N-GP, OL, GL N-GP, OL

Galb1,4GlcNAc GalNAcb1,4GlcNAc > Galb1,4GlcNAc

D ND

Galb1,4GlcNAc Unknown

GL, glycolipids; GP, glycoproteins; N-GP, N-glycosylated proteins; OL, oligosaccharides; D, detected; ND, not detected. a Mammalian data is from Takashima and Tsuji (13).

mammals (HNVSQE) and chicken (HNISHE), in which H and E residues at both ends are essential. The sequence HNISHE is common in chickens, including our clone. We also could not detect chicken ST6Gal2 activity, which may have been due to the preferential acceptor of the enzyme being GalNAcb1,4GlcNAc, at least in mammals (13). In addition, chicken ST3Gal3 showed very weak activity with Galb1,4GlcNAc. Our preliminary results showed that the enzymatic activity was stronger with Galb1,3GlcNAc, as reported with mammalian ST3Gal3 (17). The chicken STs have not been extensively examined, except for ST6Gal1. In the present study, we succeeded in detecting two a2,3STs activities in the chicken in addition to ST6Gal1, and compared enzymatic activities among various organs. The primary purpose of the present study was to determine the expression patterns of STs in order to establish transgenic chicken that produce proteins with sialylated N-glycans in the future. In addition to this, analyses of chicken STs may contribute to other important issues. Sialic acid is a well-known receptor of the influenza virus, and human cells contain a2,6NeuAc and a2,3NeuAc, while other mammals additionally contain a2,6NeuGc and a2,3NeuGc. The chicken is very unique because it contains only a2,6 and a2,3NeuAc. Influenza A and B viruses bind to sialyloligosaccharide on host cells through hemagglutinin. The human influenza virus has been shown to prefer NeuAca2,6Gal, while the avian influenza virus binds to NeuAca2,3Gal (18), and the host specificity of a virus may be based on this difference. Although the incidence of humans being infected with chicken viruses remains small, it still occurs. Therefore, extensive research on various chicken STs may contribute to the prevention of a pandemic of chicken influenza viruses. Many therapeutic proteins such as antibodies and cytokines are glycoproteins and N-glycans are especially important for their biological activity, such as stability (3). Differences in the structures of N-glycans in various host animals have facilitated many attempts to humanize N-glycans (19e21). In this study, we confirmed that chicken oviduct magnum cells had very low activities of either a2,3- or a2,6-ST in the in vitro assay; however, a certain level of expression of the ST3Gal6 gene was observed by RT-qPCR. We found the low-activity splicing variant of ST3Gal6 (ST3Gal6DE2). Thus, we supposed that such variant may be a major ST3Gal6 species in the magnum, which caused the discrepancy between the expression level observed by RT-qPCR and enzymatic activity. To clear this, several cDNA clones of ST3Gal6 were isolated from the magnum and liver, and found that almost half clones were ST3Gal6DE2 in both organs (Kojima, unpublished results). Thus, we could not explain the observed discrepancy by the difference in the proportion of the low-activity variant. In previous reports, various alternative splicing and promoter utilization of mammalian STs were identified. For example, multiple mRNAs differing in the 50 untranslated region (UTR) have been identified in human ST3Gal2, ST3Gal3, ST3Gal4, ST3Gal5 and ST3Gal6 (22). With human ST3Gal3, an inactive splicing variant was reported (23). Thus, it is possible that the other types of alternative splicing and/or the differences in UTR region cause low ST activity in the magnum. Now, we are studying these possibilities.

We currently cannot explain why a2,3-ST activity in the magnum was low. However, low ST activity (both a2,3 and a2,6) in the magnum may cause a deficiency in the sialylation of proteins deposited in the egg white, and a transgenic chicken that expresses both GalT and ST may produce a protein with sialylated N-glycan. We are presently attempting to establish a transgenic chicken that expresses both GalT1 and ST6Gal1 in its oviduct cells and produce useful proteins with humanized N-glycans. Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.jbiosc.2014.11.009. ACKNOWLEDGMENTS We would like to thank the National Bio-Resource Project of the MEXT, Japan (Nagoya University Graduate School of Bioagricultural Science, Avian Bioscience Research Center) for providing white leghorns, and Radioisotope Research Center, Nagoya University for supporting radioisotope experiments. References 1. Watanabe, M., Miyake, K., Yamamoto, S., Kataoka, Y., Koizumi, S., Endo, T., Ozaki, A., and Iijima, S.: Identification of sialyltransferases of Streptococcus agalactiae, J. Biosci. Bioeng., 93, 610e613 (2002). 2. Pilatte, Y., Bignon, J., and Lambré, C. R.: Sialic acids as important molecules in the regulation of the immune system: pathophysiological implications of sialidases in immunity, Glycobiology, 3, 201e218 (1993). 3. Fukuda, M. N., Sasaki, H., Lopez, L., and Fukuda, M.: Survival of recombinant erythropoietin in the circulation: the role of carbohydrates, Blood, 73, 84e89 (1989). 4. Kamihira, M., Ono, K., Esaka, K., Nishijima, K., Kigaku, R., Komatsu, H., Yamashita, T., Kyogoku, K., and Iijima, S.: High-level expression of singlechain Fv-Fc fusion protein in serum and egg white of genetically manipulated chickens by using a retroviral vector, J. Virol., 79, 10864e10874 (2005). 5. Kyogoku, K., Yoshida, K., Watanabe, H., Yamashita, T., Kawabe, Y., Motono, M., Nishijima, K., Kamihira, M., and Iijima, S.: Production of recombinant tumor necrosis factor receptor/Fc fusion protein by genetically manipulated chickens, J. Biosci. Bioeng., 105, 454e459 (2008). 6. Kodama, D., Nishimiya, D., Iwata, K., Yamaguchi, K., Yoshida, K., Kawabe, Y., Motono, M., Watanabe, H., Yamashita, T., Nishijima, K., Kamihira, M., and Iijima, S.: Production of human erythropoietin by chimeric chickens, Biochem. Biophys. Res. Commun., 367, 834e839 (2008). 7. Kawabe, Y., Naka, T., Ando-Noumi, N., Matsumoto, H., Ono, K., Nishijima, K., Kamihira, M., and Iijima, S.: Transport of human immunoglobulin G and Fcfusion proteins to chicken egg yolk, J. Biosci. Bioeng., 102, 518e523 (2006). 8. Kowalczyk, K., Daiss, J., Halpern, J., and Roth, T. F.: Quantitation of maternalfetal IgG transport in the chicken, Immunology, 54, 755e762 (1985). 9. Zhu, L., van de Lavoir, M. C., Albanese, J., Beenhouwer, D. O., Cardarelli, P. M., Cuison, S., Deng, D. F., Deshpande, S., Diamond, J. H., Green, L., and other 19 authors: Production of human monoclonal antibody in eggs of chimeric chickens, Nat. Biotechnol., 23, 1159e1169 (2005). 10. Kamihira, M., Kawabe, Y., Shindo, T., Ono, K., Esaka, K., Yamashita, T., Nishijima, K., and Iijima, S.: Production of chimeric monoclonal antibodies by genetically manipulated chickens, J. Biotechnol., 141, 18e25 (2009). 11. Mizutani, A., Tsunashima, H., Nishijima, K., Sasamoto, T., Yamada, Y., Kojima, Y., Motono, M., Kojima, J., Inayoshi, Y., Miyake, K., Park, E. Y., and Iijima, S.: Genetic modification of a chicken expression system for the galactosylation of therapeutic proteins produced in egg white, Transgenic Res., 21, 63e75 (2012). 12. Kojima, Y., Wakita, J., Inayoshi, Y., Suzuki, R., Yamada, Y., Kaneoka, H., Nishijima, K., and Iijima, S.: Galactosylation of human erythropoietin

628

13. 14.

15.

16.

17.

KOJIMA ET AL.

produced by chimeric chickens expressing galactosyltransferase, J. Biosci. Bioeng., 117, 676e679 (2014). Takashima, S. and Tsuji, S.: Functional diversity of mammalian sialyltransferases, Trends Glycosci. Glycotechnol., 23, 178e193 (2011). Kurosawa, N., Kawasaki, M., Hamamoto, T., Nakaoka, T., Lee, Y. C., Arita, M., and Tsuji, S.: Molecular cloning and expression of chick embryo Galb1,4GlcNAca2,6-sialyltransfrase: comparison with the mammalian enzyme, Eur. J. Biochem., 219, 375e381 (1994). Audry, M., Jeanneau, C., Imberty, A., Harduin-Lepers, A., Delannoy, P., and Breton, C.: Current trends in the structure-activity relationships of sialyltransferases, Glycobiology, 21, 716e726 (2011). Legaigneur, P., Breton, C., El Battari, A., Guillemot, J. C., Augé, C., Malissard, M., Berger, E. G., and Ronin, C.: Exploring the acceptor substrate recognition of the human b-galactoside a2,6-sialyltransferase, J. Biol. Chem., 276, 21608e21617 (2001). Kono, M., Ohyama, Y., Lee, Y. C., Hamamoto, T., Kojima, N., and Tsuji, S.: Mouse b-galactoside a2,3-sialylransferases: comparison of in vitro substrate specificities and tissue specific expression, Glycobiology, 7, 469e479 (1997).

J. BIOSCI. BIOENG., 18. Connor, R. J., Kawaoka, Y., Webster, R. G., and Paulson, J. C.: Receptor specificity in human, avian, and equine H2 and H3 influenza virus isolates, Virology, 205, 17e23 (1994). 19. Jefferis, R.: Glycosylation as a strategy to improve antibody-based therapeutics, Nat. Rev. Drug Discov., 8, 226e234 (2009). 20. Raju, T. S.: Terminal sugars of Fc glycans influence antibody effector functions of IgGs, Curr. Opin. Immunol., 20, 471e478 (2008). 21. Sethuraman, N. and Stadheim, T. A.: Challenges in therapeutic glycoprotein production, Curr. Opin. Biotechnol., 17, 341e346 (2006). 22. Taniguchi, A.: Promoter structure and transcriptional regulation of human b-galactoside a2,3-sialyltransferase genes, Curr. Drug Targets, 9, 310e316 (2008). 23. Grahn, A., Barkhordae, G. S., and Larson, G.: Identification of seven new a2,3sialyltransferase III, ST3Gal III, transcripts from human foetal brain, Glycoconj. J., 20, 493e500 (2004).