International Journal of Food Microbiology 175 (2014) 6–13

Contents lists available at ScienceDirect

International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro

Anaerobic green fluorescent protein as a marker of Bifidobacterium strains José M. Landete a, Ángela Peirotén a, Eva Rodríguez a, Abelardo Margolles b, Margarita Medina a, Juan L. Arqués a,⁎ a b

Dpto. de Tecnología de Alimentos, INIA, Carretera de La Coruña Km 7, 28040 Madrid, Spain Instituto de Productos Lácteos de Asturias, CSIC, Paseo Río Linares s/n, 33300 Villaviciosa, Asturias, Spain

a r t i c l e

i n f o

Article history: Received 7 November 2013 Accepted 11 January 2014 Available online 16 January 2014 Keywords: Fluorescent proteins Bifidobacterium Plasmid Anaerobic conditions

a b s t r a c t Some strains of Bifidobacterium are considered as probiotics and are being added as adjunct culture in food products due to their potential in maintaining a healthy intestinal microbial balance. However, despite these benefits, bifidobacteria still remain poorly understood at the genetic level compared with other microorganisms of industrial interest. In this work, we have developed a non-invasive green fluorescent based reporter system for realtime tracking of Bifidobacterium species in vivo. The reporter vector pNZ:Tu-GFPana is based on the pNZ8048 plasmid harboring a bifidobacterial promoter (elongation factor Tu from Bifidobacterium longum CECT 4551) and a fluorescent protein containing a flavin-mono-nucleotide-based cofactor (evoglow-Pp1) which is fluorescent under both aerobic and anaerobic conditions. pNZ:Tu-GFPana was constructed and found to stably replicate in B. longum CECT 4551 and in the intestinal strain Bifidobacterium breve INIA P734. The subsequent analysis of these strains allowed us to assess the functionality of this plasmid. Our results demonstrate the potential of pNZ:Tu-GFPana as a real-time reporter system for Bifidobacterium in order to track the behavior of this probiotic species in complex environments like food or intestinal microbiota, and to estimate their competition and colonization potential. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Members of the genus Bifidobacterium are high G + C Gram positive bacteria belonging to the phylum Actinobacteria, and represent common inhabitants of the gastro-intestinal tract (GIT) of mammals, birds and certain cold-blooded animals (Turroni et al., 2011). The importance of bifidobacteria as constituents of the human microbiota is generally accepted, and different ecological relationships between bifidobacteria and their host can be developed, ranging from opportunistic pathogenic interactions (e.g. in the case of Bifidobacterium dentium) (Ventura et al., 2009a) to a commensal or health-promoting relationship (e.g. in the case of Bifidobacterium bifidum and Bifidobacterium breve species) (Ventura et al., 2009b). Bifidobacteria are difficult to study due to their growth requirements, oxygen sensitivity and resistance to genetic modification. Thus, there is only limited information available on the molecular mechanisms responsible for their beneficial effects on human health. In the last years, the whole genome sequences of different bifidobacteria are currently available, although there is still a lack of knowledge on the genetic modification of these bacteria, which is essential to manage this enormous genetic data (Álvarez-Martín et al., 2010). Moreover, host-microbiota interactions and cross-talk between different members of the gut microbiota are far from being completely understood, although they represent a crucial factor in the development and maintenance of human physiology and immune system (Hart et al., ⁎ Corresponding author. Fax: +34 91 3572293. E-mail address: [email protected] (J.L. Arqués). 0168-1605/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.ijfoodmicro.2014.01.008

2004). Colonization of the gut during early infancy is a multifaceted process that represents a critical period for the gut development and maturation of the immune system, being Bifidobacterium species as one of the main bacterial groups in the infant gut (Turroni et al., 2012). In the last decades, bifidobacteria have attracted strong interest from the food industry for probiotic applications, and several species are listed as GRAS (Generally Recognized As Safe) microorganisms (Gaggìa et al., 2010). Probiotic bacteria selected for use in foods must survive in sufficient numbers the manufacturing process and storage, as well as the passage through the gastro-intestinal tract. In a first step, it is important to be able to identify the bifidobacteria of interest among several naturally occurring bacteria during the fermentation process. Furthermore, probiotics have several modes of action and there is increasing interest in the understanding of the mechanisms that bacteria use to survive through the gastrointestinal tract, to interact with the resident microbiota, and to modulate host health. Therefore, it is also essential to be able to discriminate the probiotic strain from the endogenous microbiota, to analyze the interaction of these microorganisms with the gastrointestinal epithelia and to unravel the mechanisms underlying the postulated health-beneficial effect. In order to study these mechanisms and to track their survival and implantation, the use of appropriate molecular tools is indispensable. In this aspect, the fluorescent proteins have been exploited as a stable marker system with an easily detectable phenotype to track bacteria in complex ecosystems. Fluorescent reporter proteins are valuable non-invasive molecular tools for in vivo real-time imaging of living cells and tissues as well as

J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13

in vitro fluorescent labeling (Chudakov et al., 2005). The green fluorescent protein (GFP) has been successfully used to detect many microorganisms in real time. However oxygen is essential for the posttranslational folding of the protein into the fluorescent chromophore (Cubitt et al., 1995), which has hindered the employment of GFP in anaerobic or microaerophilic environments. Luciferases are enzymes that need presence of oxygen to emit light, and which have been also employed as a marker for monitoring bacteria (Greer and Szalay, 2002; Hutchens and Luker, 2007). A luciferase reporter system has been used to trace the colonization potential and persistence of the probiotic strain B. breve UCC2003 in real time within the mouse GIT (Cronin et al., 2008). In the present report, we describe the implementation of a cyangreen fluorescent protein that is functional under completely anoxic conditions, as a marker for Bifidobacterium in both aerobic and anaerobic conditions. We evaluate the capacity of this tool to monitor bifidobacterial fate in complex ecosystems, without the potential problems caused by oxygen limitations that could impede the development of fluorescence or luminescence.

7

P426 (Rodríguez et al., 2012) and Enterococcus faecium INIA TAB7 (Rodríguez et al., 2000) strains were routinely cultivated under anaerobic conditions at 37 °C in MRS broth (Scharlau Chemie SA, Barcelona, Spain). Escherichia coli DH5α was grown in LB medium at 37 °C with aeration. Chloramphenicol (Sigma Chemical Co., St. Louis, MO, USA) was added at 8 μg/ml for Lactobacillus, 5 μg/ml for Lactococcus and Enterococcus and 4 μg/ml for Bifidobacterium. Ampicillin at 100 μg/ml was added for E. coli. The plasmids used are listed in Table 1. Plasmid pNZ8048 was obtained from Dr. Kuipers and described in Kuipers et al. (1998). All vectors shown in Table 1 contain the chloramphenicol resistance gene from pNZ8048, which was used for selection in bifidobacteria. pGlowC-Pp1 plasmid (Evocatal GmbH, Düsseldorf, Germany) was used as template for anaerobic gfp (evoglow-Pp1) and E. coli DH5α was used as host microorganism for this plasmid. Commercial lactic culture YC-X16 — Yo-Flex® (Chr. Hansen, Hoersholm, Denmark), that contains a mixture of Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus, was prepared as specified by the manufacturer and kept at −20 °C.

2. Material and methods 2.2. DNA manipulation and molecular techniques 2.1. Bacterial strains and growth conditions The bacterial strains used in this study are listed in Table 1. Bifidobacteria strains were routinely cultivated under anaerobic conditions at 37 °C in RCM broth (Difco, BD Diagnostics, Sparks, MD, USA). B. breve INIA P734, isolated from human breast milk, was deposited at the Spanish Type Culture Collection (CECT; Burjassot, Spain) under accession number CECT 8178. Lactococcus lactis MG1363 used as host microorganisms was grown at 30 °C in M17 broth (Scharlau Chemie SA, Barcelona, Spain) supplemented with glucose (5 g/l). Lactobacillus brevis INIA ESI38 (Cogan et al., 1997), Lactobacillus rhamnosus INIA

The general procedures used for DNA manipulation were essentially those described previously by Sambrook et al. (1989). Restriction endonucleases and Taq DNA polymerase came from Biolabs (New England Biolabs, Hitchin, United Kingdom) and Applied Biosystems (Foster City, CA, USA) respectively, and T4 DNA ligase was obtained from Invitrogen (Carlsbad, CA, USA). All were used according to the manufacturers' instructions. Amplicons were purified using the QIAquick PCR Purification Kit (Qiagen, Clopper Road, Gaithersburg, MD, USA). When required, purified plasmids and amplicons were sequenced (Secugen SL, Madrid, Spain).

Table 1 Bacterial strains, plasmids and primers used in this work. Relevant phenotype or genotype

Source or reference

Strains MG1363 MG1363 pNZ:Tu MG1363 Tu-GFPana INIA P734 INIA P734 Tu-GFPana CECT4551 CECT4551Tu-GFPana INIA TAB7 INIA TAB7 Tu-GFPana INIA ESI38 INIA ESI38 Tu-GFPana INIA P426 INIA P426 Tu-GFPana E. coli DH5α

L. lactis subsp. cremoris strain, plasmid-free derivative of NCDO712 MG1363 with pNZ:Tu-plasmid MG1363 with pNZ:Tu-GFPana plasmid Bifidobacterium breve INIA P734/CECT8178 B. breve INIA P734 with pNZ:Tu-GFPana plasmid Bifidobacterium longum subsp. infantis B. longum subsp. infantis with pNZ:Tu-GFPana plasmid Enterococcus faecium INIA TAB7, isolated from cheese E. faecium INIA TAB7 with pNZ:Tu-GFPana plasmid Lactobacillus brevis INIA ESI38, isolated from cheese L. brevis INIA ESI38 with pNZ:Tu-GFPana plasmid L. rhamnosus INIA P426, isolated from breast-fed infants L. rhamnosus INIA P426 with pNZ:Tu-GFPana plasmid Host microorganisms for pGlow-C-Pp1

Gasson (1983) This work This work CECT This work CECT This work Rodríguez et al. (2000) This work Cogan et al. (1997) This work Rodríguez et al. (2012) This work This work

Plasmids pNZ8048 pNZ:Tu pNZ:Tu-GFPana pGlow-C-Pp1 pGFPuv

Expression vector for Gram-positive bacteria harboring the inducible nisine promoter; Cmr pNZ8048 with promoter of elongation factor Tu from B. longum subsp. infantis CECT4551 pNZ:Tu with anaerobic gfp Plasmid used as template for anaerobic gfp Plasmid used as template for aerobic gfp

Kuipers et al. (1998) This work This work Evocatal GmbH, Germany Clontech Laboratories, Inc. USA

Primersa For-GFP Rev-GFP For.GFP.bif Rev-GFPana.XbaI For-Prom.bif Rev-Prom.bif For-pNZ8048

TTTTCCATGGATCCCCGGGTAGAAAAAATGAG TTTTCTAGATGACCGGCGCTCAGTTGGAATTCATTA TTTTCCATGGTCAACGCAAAACTCCTGCAACTG TTTTTCTAGATCAGTGCTTGGCCTGGCCCTGCTG TTTTAGATCTGCGCCACATCATGAAGTGGCCGG TTTTCCATGGCTTTTGTCCTCCTGGACGTCTC GGAATTGTCAGATAGGCCTAATGACTGG

This work This work This work This work This work This work This work

a

Restriction sites used for cloning are underlined.

8

J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13

2.3. Cloning of gfp plasmids The pNZ8048 vector was digested with restriction endonucleases BglII and NcoI to remove the nisine promoter (PnisA). The promoter of elongation factor Tu from Bifidobacterium longum subsp. infantis ATCC15697 was amplified by PCR using the oligonucleotides For-prom.bif and Revprom.bif listed in Table 1 after digestion with BglII and NcoI. The resulting fragment was cloned into pNZ8048 vector previously digested and the resulting plasmid was named pNZ:Tu, which were used to transform L. lactis MG1363 by electroporation. Transformants were checked by restriction mapping and sequencing of the inserted fragment. 2.3.1. Aerobic gfp The gene encoding aerobic gfp from Aequorea victoria was amplified by PCR using DNA of pGFPuv as the template following a standard protocol. The forward primer For-GFP (Table 1) introduced an NcoI site around the initiation codon of the gfp gene, and the backward primer Rev-GFP introduced an XbaI site downstream of the stop codon. The PCR product was digested with the two restriction enzymes and ligated into the corresponding restriction sites of vector pNZ:Tu. The ligation mixture with the resulting plasmid, named pNZ:Tu-GFPuv, was subsequently introduced into the L. lactis strain MG1363 by electroporation (Holo and Nes, 1989) and transformants were checked by restriction mapping and sequencing of the inserted fragment. 2.3.2. Anaerobic gfp The gene encoding anaerobic gfp was amplified by PCR using DNA of pGlow-C-Pp1 as the template following a standard protocol. The forward primer For-GFP.bif (Table 1) introduced an NcoI site around the initiation codon of the gfp gene, and the backward primer RevGFPanaXbaI introduced an XbaI site downstream of the stop codon. The PCR product was digested with the two restriction enzymes and

NcoI PfoI ZraI BsaHI AatII BsmBI BssSI ++ SapI

MspA1I Bst1107I AccI MspA1I Eco57MI BpmI Cfr10I EaeI BspHI BglII

ligated into the corresponding restriction sites of vector pNZ:Tu. The ligation mixture with the resulting plasmid, named pNZ:Tu-GFPana (Fig. 1), was subsequently introduced into the L. lactis strain MG1363 by electroporation (Holo and Nes, 1989) and transformants were checked by restriction mapping and sequencing of the inserted fragment. Subsequently, plasmid pNZ:Tu-GFPana was used to transform bifidobacteria strains shown in Table 1. 2.4. Transformation procedures The electrotransformation procedure for bifidobacteria strains described by Álvarez-Martín et al. (2008) was tested and modified. The optimized transformation procedure was as follows. Bifidobacteria strains were cultivated under anaerobic conditions at 37 °C in RCM plates during 48 h. Colonies were inoculated into 10 ml of filtrated RCM and incubated anaerobically at 37 °C during 20 h. Tryptic Soy Broth (TSB; Biolife, Milano, Italy) with proteose peptone 20 g/l and bile 0.2% (Oxgall, Sigma) and filtrated RCM with glycine 1% were also tested. Cells were collected by centrifugation at 4 °C and 2000 g for 15 min and washed twice with ice cold 0.5 M sucrose in 1 mM citrate buffer (pH 5.8). Finally, cells were resuspended in 50 μl of ice cold buffer and kept on ice for 20 min before electroporation. The electroporation conditions were 25 μF, 200 Ω and 2.0 or 2.5 KV in a 0.2-cm cuvette by using a Gene Pulser and a Pulse Controller apparatus (Bio-Rad, Richmond, CA, USA), and 2 μl of plasmid DNA (0.3 ng/μl) were used. After electroporation, cells were resuspended in RCM broth (950 μl), incubated anaerobically at 37 °C for 2.5 h, and then plated on RCM supplemented with chloramphenicol (4 μl/ml). The plates were incubated at 37 °C for 2 to 3 days under anaerobic conditions. For each parameter tested at least three independent transformation assays were performed. The transformation efficiencies were expressed as the number of transformants per microgram of plasmid DNA. MmeI BsrDI HaeII BglI Cfr10I BsaHI Eco57MI AlwNI FspI

AleI MslI SgrAI AgeI BsaWI Cfr10I Alw44I Bme1580I BsiHKAI Bsp1286I AvaII MspA1I PvuII

XmnI NruI ++ Eco57MI ++ HindIII

Tu GFPana XmnI

T

cm

3500

AvaII XhoI ++ Eco57MI ++

500

EarI

BsmBI

pNZ.Tu.GFPana

3000

3737 bps

1000

ORI

2500

MmeI 1500 2000

repC

HaeII

SalI AccI repA HaeII BspHI NdeI Fig. 1. Physical and genetic map of pNZ:Tu-GFPana expressing the anaerobic GFP downstream the promoter of elongation factor Tu from Bifidobacterium longum subsp. infantis ATCC15697.

J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13

9

Lactobacillus and Enterococcus strains were transformed according to Posno et al. (1991).

gfp gene were used as control, 20 000 events were collected for each measurement.

2.5. Segregation stability of vectors in bifidobacteria

2.10. Measurement of fluorescence intensity by fluorometer

The stability of the constructions was assayed by growing the bifidobacteria in nonselective media for approximately 50 generations and plating on alternate days onto nonselective agar plates. Antibiotic resistance maintenance was monitored by the transference of the resulting colonies onto antibiotic-containing agar plates. Finally, plasmids were monitored by plasmid extraction from antibiotic-resistant and -susceptible colonies as described above.

Strains harboring the plasmid pNZ:Tu-GFPana were grown in the broth above mentioned in anaerobic conditions without agitation. Fluorescence of cells (0.2 ml from each culture at 0.5 OD) was measured after sedimentation by centrifugation and resuspended in distilled water. The fluorescence was measured on Tecan GENios microplate reader (Salzburg, Austria) by excitation at 410 nm with a slit of 2.5, and detection of emission at 500 nm with a slit of 10. As a background, the same strains harboring pNZ8048 plasmids were used, and their values of fluorescence were subtracted from those obtained from cell harboring plasmids with the anaerobic gfp gene. Experiments were performed in duplicate.

2.6. Growth and probiotic features of anaerobic gfp bifidobacteria transformants The control strains and their transformants were grown and monitored over 48 h in RCM broth at 37 °C under anaerobic conditions in order to check the effect of the plasmid harboring anaerobic gfp on the growth of B. longum CECT 4551 and B. breve INIA P734. Their resistance to consecutive exposition to gastric and intestinal conditions was performed as described by Lebeer et al. (2007). Quantification of biofilm formation in plastic microtitre-plates was assessed according to the method of Stepanovic et al. (2000) with some modifications. Briefly, wells of a sterile 96-well flat-bottomed polystyrene microplate were filled with 180 μl of TBS with proteose peptone 20 g/l, and inoculated with 20 μl a bacterial culture. The negative control wells contained broth only. The plates were incubated anaerobically for 48 h at 37 °C. The content of the plate was then poured off and the wells washed three times with 300 μl of sterile PBS. The microplates were stained with 200 μl per well of crystal violet for 30 min. After being washed and dried, the dye bound to the adherent cells was resuspended with 200 μl of 33% (v/v) glacial acetic acid per well. The optical density (OD) of each well was measured at 570 nm in a Multiskan Spectrum microplate reader (Thermo Fisher Scientific, Vantaa, Finland). All assays were performed in duplicate. 2.7. Direct detection of fluorescent colonies Bifidobacterium, Lactococcus, Lactobacillus and Enterococcus containing the plasmid pNZ:Tu-GFPana were grown in broth supplemented with chloramphenicol. All the strains were propagated overnight, except bifidobacteria which was incubated for 48 h. Then, serial dilutions were cultured in RCM, GM17 or MRS agar plates with and without chloramphenicol. Strains with pNZ8048 plasmid were used as control. After incubation at 37 °C during 24–48 h in anaerobic conditions, fluorescent bacteria colonies were checked for fluorescence under the ChemiDoc MP imaging system (Bio-Rad Laboratories S.A., Alcobendas, Madrid, Spain) with a blue epi illumination and emission filter of 530/ 28 nm. 2.8. Epifluorescent microscopic detection of cells For imaging bacteria expressing anaerobic GFP, fluorescence in suspended cells from liquid cultures was observed by applying 5 μl of culture on a microscope slide followed by examination using a fluorescent microscope Leica DM LB light microscope (Leica, Bensheim, Germany) equipped with 450–490 band-pass excitation filter and 515 long-pass suppression filter. 2.9. Flow cytometry Cells harboring anaerobic GFP were washed in PBS containing 0.1% BSA and 0.01% NaN3 and analyzed in a FACScalibur cytometer (Becton Dickinson, Oxford, UK). Strains harboring pNZ8048 plasmid without

2.11. Detection of anaerobic GFP-marked bacteria against a background of food and human fecal microbiota Two experiments were carried out in order to test whether the anaerobic gfp marker could be used to detect GFP-marked bifidobacteria following addition to a fermented food or to a complex fecal microbiota. Yogurt was made in sterile screw-capped flasks containing 50 ml of UHT semi-skimmed milk with 1.6% fat (Pascual, Aranda de Duero, Spain) supplemented with 5% skim milk powder. Commercial YC-X16 lactic culture was added as specified by the manufacturer. Flask was individually inoculated with B. longum CECT 4551-GFPana and B. breve INIA P734-GFPana strains at approximately 8 log cfu/ml. A flask without Bifidobacterium-GFPana served as control. Milk was then incubated at 40–43 °C to reach a pH value of 4.55–4.60 (approx. 5 h). Fecal samples used in this study were collected from a healthy breastfed infant younger than 6 months. Samples (1 g) were homogenized in 9 ml of sterile peptone (0.1%) water with a Stomacher 400 (Seward Laboratory, London, United Kingdom) and individually inoculated with B. longum CECT 4551-GFPana and B. breve INIA P734-GFPana at approximately 9 log cfu/ml. Homogenized feces with no addition of GFPanamarked bifidobacteria served as control. In both cases, decimal dilutions were cultured in RCM plates and incubated during 48 h at 37 °C in anaerobic conditions. Colonies were checked for fluorescence under the ChemiDoc MP apparatus. The presence of pNZ:Tu-GFPana in fluorescent colonies was checked by means of PCR with the primers For-pNZ8048 and Rev-Prom.bif. Non-fluorescent colonies were subjected to cell morphology examination. All assays were carried out in duplicate. 3. Results 3.1. Construction of gfp plasmids An aerobic gfp gene (gfpuv) and an anaerobic gfp gene (evoglowPp1) were cloned downstream from the constitutive promoter of elongation factor Tu from B. longum CECT 4551, using the pNZ8048 plasmid after deleted PnisA promoter. Expression of aerobic and anaerobic GFP was detected by a fluorescence imager and by fluorescence microscopy. For the anaerobic gfp, the resulting transformant, L. lactis MG1363 containing pNZ:Tu-GFPana was brightly fluorescent (Fig. 2) and harbored the expected plasmid. A plasmid stability test revealed that pNZ:Tu-GFPana was stable for at least 50 generations of growth under nonselective pressure. L. lactis MG1363-GFPana and its parent strain were shown to have similar growth rates (data not shown). L. lactis cells carrying pNZ:Tu with aerobic gfp from A. victoria showed fluorescence in aerobic conditions. However, fluorescence was not observed when it was grown in anaerobic conditions. For these reason, bifidobacteria strains were only transformed with plasmid contained anaerobic gfp.

10

J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13

Fig. 2. Detection of anaerobic GFP in L. lactis MG1363 by a fluorescence imager. Bacteria on the right side of the figure have the anaerobic GFP expression plasmid. Bacteria on the left side of the figure have the control plasmid pNZ8048. The filters used were A) Colorimetric: standard filter, white epi illumination B) Alexa: Filter: 530:28, Blue epi illumination.

3.2. Bifidobacteria transformation with pNZ:Tu-GFPana To prepare electrocompetent bacteria, Bifidobacterium strains were grown in the presence of different cell wall-altering compounds with the aim of improving transformation efficiencies. When the cells were cultivated in filtrated RCM and electroporated with 2.5 kV, B. breve INIA P734 showed a high transformation efficiency of approximately 106 cfu/μg plasmid, whereas 102 cfu/μg plasmid was observed for B. longum CECT 4551. However, the presence of glycine lysed the cells and drastically reduced transformation efficiencies (N101 cfu/μg plasmid) were observed for both strains. No transformants were observed when the cells were incubated in TSB with proteose-peptone and bile. Transformation of B. longum CECT 4551 and B. breve INIA P734 with pNZ:Tu-GFPana generated strains B. longum CECT 4551-GFPana and B. breve INIA P734-GFPana, respectively. Serial subcultures of these two strains showed stability of pNZ:Tu-GFPana in the bifidobacterial host for at least 50 generations under non-selective conditions. The putative effect of the constructions in B. longum CECT 4551 and B. breve INIA P734 was examined. Growth and ability to form biofilm in vitro of the transformed strains were not affected when compared to their parent strains (data not shown). The exposition to gastric and intestinal conditions resulted in reductions in the cell counts of both strains higher than 2 log units, with no significant differences (P b 0.01) in viability between the transformed bifidobacteria and the parent strain (data not shown).

3.3. Detection of anaerobic GFP-marked bifidobacteria The anaerobic GFP fluorescent colonies were visualized by a fluorescence imaging system, whereas fluorescent cells were detected by

fluorescence microscopy and by flow cytometry. The resulting transformants, B. longum CECT 4551-GFPana and B. breve INIA P734-GFPana were brightly fluorescent and harbored the expected plasmid pNZ:Tu-GFPana. Bacterial colonies of B. longum CECT 4551-GFPana and B. breve INIA P734-GFPana remained fluorescent after 10 days at refrigeration temperature under anaerobic conditions. It was also possible to detect fluorescent cells as late as 300 h after inoculation by fluorescence microscopy, suggesting that anaerobic gfp may indeed be a good marker gene to use for bifidobacteria growing under anaerobic conditions. Flow cytometry experiments were conducted to determine if the anaerobic GFP-marked bifidobacteria strains could be detected by this technology, cells carrying pNZ8048 were used as control. The presence of the pNZ:Tu-GFPana leads to an increase in overall green fluorescence in B. longum CECT 4551-GFPana and B. breve INIA P734-GFPana compared with that in controls without the plasmid (Fig. 3). However, we must consider that UV (emission 405 nm) of flow cytometer is far from the optimal of the anaerobic GFP used. The B. longum CECT 4551GFPana histogram showed an initial high peak that represents cells with low/medium fluorescence intensity and a second lower peak for those with high fluorescence intensity. Light scattering analysis revealed that a possible explanation for the later peak is the existence of cell doublets (data not shown). 3.4. Lactic acid bacteria transformation with pNZ:Tu-GFPana The application of pNZ:Tu-GFPana as a marker system for nonbifidobacteria strains was studied. E. faecium INIA TAB7-GFPana showed similar fluorescence to those found in L. lactis MG1363-GFPana when ChemiDoc MP imager and fluorescence microscopy were used. However, when L. brevis INIA ESI38 and L. rhamnosus INIA P426 were

J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13

11

Fig. 4. Comparison of fluorescence intensity between the different strains containing pNZ: Tu-GFPana.

Fig. 3. Fluorescent protein expression of B. longum CECT 4551-GFPana (A) and B. breve INIA P734-GFPana (B) by flow cytometry. The open histogram represents the controls with the plasmid pNZ8048.

transformed with pNZ:Tu-GFPana fluorescence was weak or absent (data not shown). A slight increase in fluorescence was observed with L. lactis and E. faecium carrying pNZ:Tu-GFPana when flow cytometry was used, whereas no Lactobacillus carrying pNZ:Tu-GFPana was detected by this method. 3.5. Fluorescence quantification Experiments were conducted to quantify the difference in fluorescence intensity between the different species harboring pNZ:TuGFPana. The highest fluorescence intensity was observed with B. longum CECT 4551 and B. breve INIA P734 carrying pNZ:Tu-GFPana. L. lactis MG1363 and E. faecium INIA TAB7 harboring pNZ:Tu-GFPana also showed fluorescence, although the fluorescence intensity was approximately four times lower than that of bifidobacteria strains. L. brevis INIA ESI38 and L. rhamnosus INIA P426 containing pNZ:TuGFPana did not show fluorescence in the fluorometric reader (Fig. 4). In addition, the fluorescence of strains harbor anaerobic gfp increased linearly with the cell mass, indicating that the fluorescence is correlated with the cell growth (data not shown). 3.6. Detection of anaerobic GFP-marked bifidobacteria against a background of food and human fecal microbiota The use of anaerobic gfp as a marker for detecting a specific bifidobacteria in food or fecal ecosystems was evaluated. B. longum CECT 4551 and B. breve INIA P734 carrying pNZ:Tu-GFPana were easily detected by direct green fluorescent cell counting methods by plating and subsequent visualization by a fluorescence imaging system (Fig. 5). Fluorescent colonies were still detected on RCM plate after 10 days at refrigeration temperatures. No green fluorescent cells were observed in controls (without addition of marked cells). In control yogurt, colonies from RCM plates were identified as cocci or bacilli by contrast microscopy. However, L. delbrueckii formed large colonies, while S. thermophilus formed very small colonies. In the yogurt manufactured with commercial lactic culture plus GFPana-marked Bifidobacterium, fluorescent bifidobacteria were clearly distinguishable from neighboring colonies from the commercial lactic culture (Fig. 5A). Bifidobacterium levels decreased to approximately 7 log units at the end of yogurt manufacture. Non-fluorescent colonies were identified as bacteria from the starter culture by contrast microscopy.

In homogenized feces not inoculated with Bifidobacterium-GFPana, the counts in RCM plates reached the values of 9.3 log cfu/ml (N80% were initially identified as bifidobacteria). In samples that were inoculated with the B. breve INIA P734-GFPana, the fluorescence imager showed that approximately the 25% of the colonies were fluorescent (Fig. 5B), reaching counts of 8.7 log cfu/ml. GFP-positive colonies were confirmed by PCR using specific primers and conditions. Similar results were observed with B. longum CECT 4551-GFPana. 4. Discussion There is a need to identify and to monitor the bifidobacteria of interest among several naturally occurring bacteria during food fermentation process or in the gastrointestinal tract when administered in vivo for probiotic studies. Fluorescent marker genes have some advantages since their intrinsic property of fluorescing does not require added substrates or cofactors. A major drawback of common GFP-like reporter proteins is that they require oxygen for chromophore formation (Tsien, 1998), and therefore it cannot be applied in strict anaerobic conditions. Recently, Cronin et al. (2008) constructed a luciferase reporter system for B. breve UCC2003 which was used to investigate the persistence of the strain in the GIT of mice. However, luciferases only emit light in the presence of oxygen, and the level of luminescence should be correlated to the number of cells under a given set of experimental conditions to verify that there is enough oxygen for the reaction to occur. The flavin-mono-nucleotide-based fluorescent protein used in this paper overcomes these restrictions. Here we have described the construction of a plasmid carrying an anaerobic gfp gene downstream the constitutive promoter Tu of B. longum CECT 4551 as a real-time reporter to monitor the fate of bifidobacteria in complex environments. This anaerobic GFP can be used as fluorescent reporter in both aerobic and anaerobic biological systems (Drepper et al., 2007; Ernst and Tielker, 2009), demonstrating its functionality in the anaerobic strains B. longum CECT 4551 and B. breve INIA P734 in this paper. Efficient transformation protocols remain a major obstacle to apply genetic manipulation in bifidobacterial research. To date, several protocols for transformation of bifidobacteria based on electroporation for DNA transfer are available, but their transformation efficiencies are generally very low (Argnani et al., 1996; Guglielmetti et al., 2007; Rossi et al., 1997; Sun et al., 2012). However, transformation efficiencies of approximately 107 cfu/μg plasmid DNA have been reported for B. breve UCC2003 (Pokusaeva et al., 2010, 2011; Ruiz et al., 2012). In this work we optimized the procedure proposed by Álvarez-Martín et al. (2008). The use of a transformation buffer containing citrate, an optimized voltage, and an extended incubation at 4 °C prior to electroporation resulted in further improvements. With this procedure, our strain B. breve INIA P734 showed high transformation efficiencies (approximately 106 cfu/μg plasmid DNA). The use of cell wall-altering treatments to prepare competent bacteria has been reported for other Gram-positive organisms (Holo and Nes, 1989; Monk et al., 2008;

12

J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13

Fig. 5. Detection of expression of anaerobic GFP by Chemidoc. Fluorescent B. breve INIA P734-GFPana are discriminated from their non-fluorescent counterparts against a background of yogurt (A) or human fecal (B) microbiota.

Powell et al., 1988). Here, the pre-treatment of bifidobacteria with bile salts or glycine did not improve transformation efficiencies. The use of GFP as a molecular marker for differentiation and identification of starter cultures or other desired bacteria among the microbiota of the fermented foods has been proven previously in cheese (Fernandez de Palencia et al., 2000, 2004) or fermented meat products (Gory et al., 2001; Phumkhachorn et al., 2007). Moreover, GFP marked-strains were also used to detect lactic acid bacteria within a background of fecal bacteria (Scott et al., 1998, 2000). However, although some of these studies have reported that cells grown anaerobically were able to become fluorescent after the exposure to air, the visualization in situ of the GFP labeled strains in highly anaerobic regions of the gut would not be possible as oxygen is required for GFP to fluoresce. The reporter vector pNZ:Tu-GFPana obtained here provides a simple method to differentiate the added bifidobacteria strain against a natural large complex background of bacteria from food or fecal origin, allowing the in situ detection of individual cells or colonies and their spatial distribution even in completely anoxic environments. Fluorescent bifidobacteria colonies were easily discriminated and enumerated from their non-fluorescent counterparts by a fluorescence imager (Fig. 5). The anaerobic GFP expression in B. longum CECT 4551 and B. breve INIA P734 cells carrying pNZ:Tu-GFPana were also confirmed by epifluorescence microscopy and by flow cytometry (Fig. 3). Several methods have been used to identify GFP-marked bacteria, and one of the advantages of flow cytometry over other methods is that the information obtained does not reflect a mean of the entire cell population but rather a discrimination of individual cells in a population. The results obtained using the fluorescence imaging system and the flow cytometer were in concordance with the fluorometric assays (Fig. 4). The promoter from B. longum CECT 4551 used in the expression cassette was strong enough to allow expression in L. lactis MG1363 and

E. faecium TAB7, although lower fluorescence levels than in bifidobacteria were detected by all the methods mentioned above. However, this tool cannot be used as general reporter for lactic acid bacteria since Lactobacillus containing pNZ:Tu-GFPana did not show fluorescence. Then, new constructions must be developed to report anaerobic GFP in lactic acid bacteria. Work is in progress in this direction. According to our results, pNZ:Tu-GFPana could be used as a reliable vehicle for other bifidobacteria reporters under a variety of growth conditions. Moreover, this plasmid provides an easy way for introducing the promoter and GFP fusion protein of interest into bifidobacteria. In conclusion, pNZ:Tu-GFPana provides a stable real-time and noninvasive reporter system for bifidobacteria that does not disturb any important physiological properties of the parent strain, and in which fluorescent signal was strong enough to be detected by several techniques. Our work is the first to report a reliable method to track fluorescently labeled bifidobacteria in food or fecal environments under both aerobic and anaerobic conditions, and provides a powerful tool for survival studies under in vivo conditions. Acknowledgments This work was supported by projects RTA2010-00116-00-00 and RM2010-00008-00-00. J.M. Landete has a postdoctoral contract with the research program “Ramón y Cajal” (MINECO, Spain). The authors thank the valuable help of Concepción Revilla from INIA (Spain), and of V. Monedero and M. Zuñiga from IATA-CSIC (Spain). References Álvarez-Martín, P., Flórez, A.B., Margolles, A., del Solar, G., Mayo, B., 2008. Improved cloning vectors for bifidobacteria, based on the Bifidobacterium catenulatum pBC1 replicon. Appl. Environ. Microbiol. 74, 4656–4665.

J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13 Álvarez-Martín, Guglielmetti, S., Mayo, B., 2010. Mobile genetic elements, cloning vectors and genetic manipulation of bifidobacteria. In: Mayo, B., van Sinderen, D. (Eds.), Bifidobacteria: Genomics and Molecular aspects. Caister Academic Press, Norfolk, UK, pp. 235–258. Argnani, A., Leer, R.J., van Luijk, N., Pouwels, P.H., 1996. A convenient and reproducible method to genetically transform bacteria of the genus Bifidobacterium. Microbiology 142, 109–114. Chudakov, D.M., Lukyanov, S., Lukyanov, K.A., 2005. Fluorescent proteins as a toolkit for in vivo imaging. Trends Biotechnol. 23, 605–613. Cogan, T.M., Barbosa, M., Beuvier, E., Bianchi-Salvadori, B., Cocconcelli, P.S., Fernandes, I., Gomez, J., Kalantzopoulos, G., Ledda, A., Medina, M., Rea, M.C., Rodríguez, E., 1997. Characterization of the lactic acid bacteria in artisanal dairy products. J. Dairy Res. 64, 409–421. Cronin, M., Sleator, R.D., Hill, C., Fitzgerald, G.F., van Sinderen, D., 2008. Development of a luciferase-based reporter system to monitor Bifidobacterium breve UCC2003 persistence in mice. BMC Microbiol. 8, 161. Cubitt, A.B., Heim, R., Adams, S.R., Boyd, A.E., Gross, L.A., Tsien, R.Y., 1995. Understanding, improving and using green fluorescent proteins. Trends Biochem. Sci. 20, 448–455. Drepper, T., Eggert, T., Circolone, F., Heck, A., Krau, U., Guter, K., Wendorff, M., Gärtner, W., Jaeger, K.-E., 2007. Reporter proteins for in vivo fluorescence without oxygen. Nat. Biotechnol. 25, 443–445. Ernst, J.F., Tielker, D., 2009. Responses to hypoxia in fungal pathogens. Cell Microbiol. 11, 183–190. Fernandez de Palencia, P., Nieto, C., Acebo, P., Espinosa, M., Lopez, P., 2000. Expression of green fluorescent protein in Lactococcus lactis. FEMS Microbiol. Lett. 183, 229–234. Fernández de Palencia, P., De la Plaza, M., Mohedano, M.L., Martínez-Cuesta, M.C., Requena, T., López, P., Peláez, C., 2004. Enhancement of 2-methylbutanal formation in cheese by using a fluorescently tagged Lacticin 3147 producing Lactococcus lactis strain. Int. J. Food Microbiol. 93, 335–347. Gaggìa, F., Mattarelli, P., Biavati, B., 2010. Probiotics and prebiotics in animal feeding for safe food production. Int. J. Food Microbiol. 141, S15–S28. Gasson, M.J., 1983. Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol. 154, 1–9. Gory, L., Montel, M.C., Zagorec, M., 2001. Use of green fluorescent protein to monitor Lactobacillus sakei in meat fermented products. FEMS Microbiol. Lett. 194, 127–133. Greer III, L.F., Szalay, A.A., 2002. Imaging of light emission from the expression of luciferases in living cells and organisms: a review. Luminescence 17, 43–74. Guglielmetti, S., Karp, M., Mora, D., Tamagnini, I., Parini, C., 2007. Molecular characterization of Bifidobacterium longum biovar longum NAL8 plasmids and construction of a novel replicon screening system. Appl. Microbiol. Biotechnol. 74, 1053–1061. Hart, A.L., Lammers, K., Brigidi, P., Vitali, B., Rizzello, F., Gionchetti, P., Campieri, M., Kamm, M.A., Knight, S.C., Stagg, A.J., 2004. Modulation of human dendritic cell phenotype and function by probiotic bacteria. Gut 53, 1602–1609. Holo, H., Nes, I.F., 1989. High-frequency transformation, by electroporation, of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl. Environ. Microbiol. 55, 3119–3123. Hutchens, M., Luker, G.D., 2007. Applications of bioluminescence imaging to the study of infections diseases. Cell. Microbiol. 9, 2315–2322. Kuipers, O.P., de Rayter, P.G.G.A., Kleerebezem, M., Vos, W.M., 1998. Quorum sensingcontrolled gene expression in lactic acid bacteria. J. Biotechnol. 64, 15–21. Lebeer, S., Verhoeven, T.L.A., Perea Vélez, M., Vanderleyden, J., De Keersmaecker, S.C.J., 2007. Impact of environmental and genetic factors on biofilm formation by the probiotic strain Lactobacillus rhamnosus GG. Appl. Environ. Microbiol. 73, 6768–6775. Monk, I.R., Gahan, C.G.M., Hill, C., 2008. Tools for functional postgenomic analysis of Listeria monocytogenes. Appl. Environ. Microbiol. 74, 3921–3934.

13

Phumkhachorn, P., Rattanachaikunsopon, P., Khunsook, S., 2007. The use of gfp gene in monitoring bacteriocin-producing Lactobacillus plantarum N014, a potential starter culture in nham fermentation. J. Food Prot. 70, 419–424. Pokusaeva, K., Neves, A.R., Zomer, A., O'Connell-Motherway, M., MacSharry, J., Curley, P., Fitzgerald, G.F., van Sinderen, D., 2010. Ribose utilization by the human commensal Bifidobacterium breve UCC2003. Microb. Biotechnol. 3, 311–323. Pokusaeva, K., O'Connell-Motherway, M., Zomer, A., Macsharry, J., Fitzgerald, G.F., van Sinderen, D., 2011. Cellodextrin utilization by Bifidobacterium breve UCC2003. Appl. Environ. Microbiol. 77, 1681–1690. Posno, M., Leer, R.J., van Luijk, N., van Giezen, M.J., Heuvelmans, P.T., Lokman, B.C., Pouwels, P.H., 1991. Incompatibility of Lactobacillus vectors with replicons derived from small cryptic Lactobacillus plasmids and segregational instability of the introduced vectors. Appl. Environ. Microbiol. 57, 1822–1828. Powell, I.B., Achen, M.G., Hillier, A.J., Davidson, B.E., 1988. A simple and rapid method for genetic transformation of lactic streptococci by electroporation. Appl. Environ. Microbiol. 54, 655–660. Rodríguez, E., González, B., Gaya, P., Nuñez, M., Medina, M., 2000. Diversity of bacteriocins produced by lactic acid bacteria isolated from raw milk. Int. Dairy J. 10, 7–15. Rodríguez, E., Arqués, J.L., Rodríguez, R., Landete, J.M., Medina, M., 2012. Antimicrobial properties of probiotic strains isolated from breast-fed infants. J. Funct. Foods 4, 542–551. Rossi, M., Brigidi, P., Matteuzzi, D., 1997. An efficient transformation system for Bifidobacterium spp. Lett. Appl. Microbiol. 24, 33–36. Ruiz, L., O'Connell-Motherway, M., Zomer, A., de Los Reyes-Gavilán, C.G., Margolles, A., van Sinderen, D., 2012. A bile-inducible membrane protein mediates bifidobacterial bile resistance. Microb. Biotechnol. 5, 523–535. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: a Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Scott, K.P., Mercer, D.K., Glover, L.A., Flint, H.J., 1998. The green fluorescent protein as a visible marker for lactic acid bacteria in complex ecosystems. FEMS Microbiol. Ecol. 26, 219–230. Scott, K.P., Mercer, D.K., Richardson, A.J., Melville, C.M., Glover, L.A., Flint, H.J., 2000. Chromosomal integration of the green fluorescent protein gene in lactic acid bacteria and the survival of marked strains in human gut simulations. FEMS Microbiol. Lett. 182, 23–27. Stepanovic, S., Vukovic, D., Dakic, I., Savic, B., Svabic-Vlahovic, M., 2000. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J. Microbiol. Methods 40, 175–179. Sun, Z., Baur, A., Zhurina, D., Yuan, J., Riedel, C.U., 2012. Accessing the inaccessible: molecular tools for bifidobacteria. Appl. Environ. Microbiol. 78, 5035–5042. Tsien, R.Y., 1998. The green fluorescent protein. Annu. Rev. Biochem. 67, 509–544. Turroni, P., van Sinderen, D., Ventura, M., 2011. Genomics and ecological overview of the genus Bifidobacterium. Int. J. Food Microbiol. 149, 37–44. Turroni, F., Peano, C., Pass, D.A., Foroni, E., Severgnini, M., Claesson, M.J., Kerr, C., Hourihane, J., Murray, D., Fuligni, F., Gueimonde, M., Margolles, A., De Bellis, G., O'Toole, P.W., Van Sinderen, D., Marchesi, J.R., Ventura, M., 2012. Diversity of Bifidobacteria within the infant gut microbiota. PLoS One 7, e36957. Ventura, M., Turroni, F., Zomer, A., Foroni, E., Giubellini, V., Bottacini, F., Canchaya, C., Claesson, M.J., He, F., Mantzourani, M., Mulas, L., Ferrarini, A., Gao, B., Delledonne, M., Henrissat, B., Coutinho, P., Oggioni, M., Gupta, R.S., Zhang, Z., Beighton, D., Fitzgerald, G.F., O'Toole, P.W., van Sinderen, D., 2009a. The Bifidobacterium dentium Bd1 genome sequence reflects its genetic adaptation to the human oral cavity. PLoS Genet. 5 (12), e1000785. Ventura, M., O'Flaherty, S., Claesson, M.J., Turroni, F., Klaenhammer, T.R., van Sinderen, D., O'Toole, P.W., 2009b. Genome-scale analyses of health-promoting bacteria: probiogenomics. Nat. Rev. Microbiol. 7, 61–71.