6170 Nucleic Acids Research, Vol. 18, No. 20
Nucleic Acids Research Vol. 18, No. 20
An STS in the human T cell receptor (located at 7p14-15)
gamma
locus
F.Bernard, P.Chuchana, G.Lefranc and M.-P.Lefranc* Laboratoire d'lmmunogenetique Moleculaire, URA CNRS 1191, Universite Montpellier 11, Place E. Bataillon, CP012, 34095 Montpellier CEDEX 5, France EMBL accession no. X03436
Submitted August 14, 1990
The human T cell receptor gamma locus has been extensively characterized (for review, see ref. 1). The locus which covers 160 kb of genomic DNA is located at 7pl4-15 (2-4). It comprises 2 constant genes, 5 joining segments and 14 variable genes all of which have been sequenced (1). The variable gene TCRGV9 belongs to the Vyll subgroup and is the single member of that subgroup. We have defined this information gene as a sequence-tagged site (STS), designated TCRGV9 [/7pl4-15] for inclusion in the human genome map. Using the polymerase chain reaction (PCR) described below, a fragment of the expected size (427 bp) was amplified from human genomic DNA. The fragment contained sequences from positions 1 to 427 of the human TCRGV9 gene (5). The amplified fragment was purified, uniformly radiolabelled, and used to probe a human genomic Southern. As anticipated, a single 4.8 kb Sac I, 2.2 kb Hind HII and 5.2 kb Eco RI fragment were detected, demonstrating both the unique character of the amplified sequences, and the direct utility of the PCR product as a probe for retrieving clones containing this STS from libraries.
PCR primers:
Forward (1-21 in ref. 5) CTGCAGACATGCTGTCACTGC Reverse (427 -408 in ref. 5) GGTGAGAGTGGATGTAGACG
PCR components:
PCR profile:
2 ,ug of human genomic DNA, 40 pmoles of each nucleotide, 200 yM dNTPs, and 2.5 U Taq polymerase (Perkin Elmer Cetus) in 100 1l of 1 xPCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3 (at room temperature), 1.5 mM MgCl2, 0.1 % (w/v) gelatin). 94°C for 5 minutes 65°C for 10 minutes 72°C for 2 minutes 91°C for 1 minute for 30 cycles 65°C for 1 minute
Anticipated sequence of the PCR product:
REFERENCES 1. 2. 3. 4. 5.
Lefranc,M.-P. and Rabbitts,T.H. (1989) Trends Biochem. Sci. 14, 214-218. Rabbitts et al. (1985) EMBO J. 4, 1461-1465. Murre,C. et al. (1985) Nature 316, 549-552. Bensmana,M. et al. (1990) Cytogenet. Cell Genet. (in press). Lefranc,M.-P. et al. (1986) Nature 319, 420-422.
CTGCAGACATGCTGTCACTGCTCCACACATCAACGCTGGCAGTCCTTGGGGCTCGTAA GTAGTTTTGCTCCCCCAATCACTTTGACTGATATTCTCTATTGTTATATATTIIIATAAA
TTCCAAATTCTTGGTTTAITTACTCCCTCCCATIITTII-TLTrTCCCCAGTGTGTGTATATGGTG CAGGTCACCTAGAGCAACCTCAAATTTCCAGTACTAAAACGCTGTCAAAAACAGCCCG
CCTGGAATGTGTGGTGTCTGGAATAAAAATrTTCTGCAACATCTGTATATTGGTATCGAG AGAGACCTGGTGAAGTCATACAGTTCCTGGTGTCCAIIICATATGACGGCACTGTCAGA AAGGAATCTGGCATTCCGTCAGGCAAATTTGAGGTGGATAGGATACCTGAAACGTCTAC ATCCACTCTCACC
*
To whom correspondence should be addressed
Nucleic Acids Research Vol. 18, No. 20
An STS in the human T cell receptor (located at 7p14-15)
gamma
locus
F.Bernard, P.Chuchana, G.Lefranc and M.-P.Lefranc* Laboratoire d'lmmunogenetique Moleculaire, URA CNRS 1191, Universite Montpellier 11, Place E. Bataillon, CP012, 34095 Montpellier CEDEX 5, France EMBL accession no. X03436
Submitted August 14, 1990
The human T cell receptor gamma locus has been extensively characterized (for review, see ref. 1). The locus which covers 160 kb of genomic DNA is located at 7pl4-15 (2-4). It comprises 2 constant genes, 5 joining segments and 14 variable genes all of which have been sequenced (1). The variable gene TCRGV9 belongs to the Vyll subgroup and is the single member of that subgroup. We have defined this information gene as a sequence-tagged site (STS), designated TCRGV9 [/7pl4-15] for inclusion in the human genome map. Using the polymerase chain reaction (PCR) described below, a fragment of the expected size (427 bp) was amplified from human genomic DNA. The fragment contained sequences from positions 1 to 427 of the human TCRGV9 gene (5). The amplified fragment was purified, uniformly radiolabelled, and used to probe a human genomic Southern. As anticipated, a single 4.8 kb Sac I, 2.2 kb Hind HII and 5.2 kb Eco RI fragment were detected, demonstrating both the unique character of the amplified sequences, and the direct utility of the PCR product as a probe for retrieving clones containing this STS from libraries.
PCR primers:
Forward (1-21 in ref. 5) CTGCAGACATGCTGTCACTGC Reverse (427 -408 in ref. 5) GGTGAGAGTGGATGTAGACG
PCR components:
PCR profile:
2 ,ug of human genomic DNA, 40 pmoles of each nucleotide, 200 yM dNTPs, and 2.5 U Taq polymerase (Perkin Elmer Cetus) in 100 1l of 1 xPCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3 (at room temperature), 1.5 mM MgCl2, 0.1 % (w/v) gelatin). 94°C for 5 minutes 65°C for 10 minutes 72°C for 2 minutes 91°C for 1 minute for 30 cycles 65°C for 1 minute
Anticipated sequence of the PCR product:
REFERENCES 1. 2. 3. 4. 5.
Lefranc,M.-P. and Rabbitts,T.H. (1989) Trends Biochem. Sci. 14, 214-218. Rabbitts et al. (1985) EMBO J. 4, 1461-1465. Murre,C. et al. (1985) Nature 316, 549-552. Bensmana,M. et al. (1990) Cytogenet. Cell Genet. (in press). Lefranc,M.-P. et al. (1986) Nature 319, 420-422.
CTGCAGACATGCTGTCACTGCTCCACACATCAACGCTGGCAGTCCTTGGGGCTCGTAA GTAGTTTTGCTCCCCCAATCACTTTGACTGATATTCTCTATTGTTATATATTIIIATAAA
TTCCAAATTCTTGGTTTAITTACTCCCTCCCATIITTII-TLTrTCCCCAGTGTGTGTATATGGTG CAGGTCACCTAGAGCAACCTCAAATTTCCAGTACTAAAACGCTGTCAAAAACAGCCCG
CCTGGAATGTGTGGTGTCTGGAATAAAAATrTTCTGCAACATCTGTATATTGGTATCGAG AGAGACCTGGTGAAGTCATACAGTTCCTGGTGTCCAIIICATATGACGGCACTGTCAGA AAGGAATCTGGCATTCCGTCAGGCAAATTTGAGGTGGATAGGATACCTGAAACGTCTAC ATCCACTCTCACC
*
To whom correspondence should be addressed
