k.:) 1991 Oxford University Press
5086 Nucleic Acids Research, Vol. 19, No. 18
An STS in the human skeletal ao-actin
gene
Brian C.Freeman and J.Christopher States* Center for Molecular Biology, Wayne State University, Detroit, Ml 48201, USA Submitted June 21, 1991 The human skeletal a-actin gene has been studied extensively (1-3). The skeletal a-actin gene is co-expressed with the cardiac a-actin gene in striated muscle. The level of expression of the two genes varies during development and differentiation of the expressing cells. The two genes apparently arose from a gene duplication. The coding regions of the two genes remain conserved but the 3' untranslated regions (UTRs) have diverged signficantly (3). The sequence divergence in the 3'-UTR of the a-actin genes allows the development of a specific sequence tagged site (STS) for the human skeletal a-actin gene. Using the polymerase chain reaction (PCR) described below, a fragment of the expected size (188 bp) was amplified from human genomic DNA (Figure 1). The amplified fragment was sequenced to confirm that it contained the expected skeletal a-actin sequence encoded by the 3'-UTR of exon seven from positions 2493 fo 2681 in the skeletal a-actin gene sequence (2). Amplification of the STS using a human/hamster somatic cell hybrid chromosome panel properly mapped the a-actin gene to chromosome 1 (data not shown). Thus, the usefulness of the STS has been confirmed. PCR Primers: ATCACCAAGCAGGAGT Forward (1-16) Reverse (172-188) GTCAGTTTACGATGGC PCR Components in a 10 Il Reaction: 12.5 ng DNA, 1 Ad 10 x PCR buffer D (100 mM Tris-HCI, pH 8.8, 500 mM KCI, 60 mM MgCl2, 10 mM dithiothreitol), 100 nM of each oligonucleotide, 200 ytM dNTPs, 1.0 /Ag bacteriophage T4 gene 32 protein (US Biochemical, Cleveland, OH) and 0.25 U Amplitaq (Perkin-Elmer-Cetus, Norwalk, CT). PCR Profile: 94°C for 1 minute; 58°C for 1 minute; 72°C for 3 minutes; 35 cycles followed by 10 minute incubation at 72°C. Sequence of PCR Product: ATCACCAAGCAGGAGTACGACGAGGCCGGCCCTTCCATCGTCCACCGCAAATGCTTCTAGACACACTCCACCTCCAGCACGCGACTTCTCAGGACGACGAATCTTCTCAATGGGGGGGCGGCTGAGCTCCAGCCACCCCGCAGTCACTTTCTTTGTAACAACTTCCGTTGCTGCCATCGTAAACTGAC
*
To whom correspondence should be addressed
REFERENCES 1. Hanauer,A., Levin,M., Heilig.R., Daegelen,D., Kahn,A. and Mandel,J.L. (1983) Nucl. Acids Res. 11, 3503-35 16. 2. Taylor,A., Erba,H.P., Muscat,G.E. and Kedes,L. (1988) Genomics 4, 323-336. 3. Gunning,P., Mohun.T., Ng,S.-Y., Ponte,P. and Kedes,L. (1984) J. Mol. Evol. 20, 202-210.
600300-
100-
Figure 1. Amplification of ae-actin STS. Lane 1, 100 bp marker DNAs (GibcoBRL, Gaithersburg, MDO, size of some marker fragments are given in bp in the margin; Lane 2, a-actin STS obtained using conditions described.
5086 Nucleic Acids Research, Vol. 19, No. 18
An STS in the human skeletal ao-actin
gene
Brian C.Freeman and J.Christopher States* Center for Molecular Biology, Wayne State University, Detroit, Ml 48201, USA Submitted June 21, 1991 The human skeletal a-actin gene has been studied extensively (1-3). The skeletal a-actin gene is co-expressed with the cardiac a-actin gene in striated muscle. The level of expression of the two genes varies during development and differentiation of the expressing cells. The two genes apparently arose from a gene duplication. The coding regions of the two genes remain conserved but the 3' untranslated regions (UTRs) have diverged signficantly (3). The sequence divergence in the 3'-UTR of the a-actin genes allows the development of a specific sequence tagged site (STS) for the human skeletal a-actin gene. Using the polymerase chain reaction (PCR) described below, a fragment of the expected size (188 bp) was amplified from human genomic DNA (Figure 1). The amplified fragment was sequenced to confirm that it contained the expected skeletal a-actin sequence encoded by the 3'-UTR of exon seven from positions 2493 fo 2681 in the skeletal a-actin gene sequence (2). Amplification of the STS using a human/hamster somatic cell hybrid chromosome panel properly mapped the a-actin gene to chromosome 1 (data not shown). Thus, the usefulness of the STS has been confirmed. PCR Primers: ATCACCAAGCAGGAGT Forward (1-16) Reverse (172-188) GTCAGTTTACGATGGC PCR Components in a 10 Il Reaction: 12.5 ng DNA, 1 Ad 10 x PCR buffer D (100 mM Tris-HCI, pH 8.8, 500 mM KCI, 60 mM MgCl2, 10 mM dithiothreitol), 100 nM of each oligonucleotide, 200 ytM dNTPs, 1.0 /Ag bacteriophage T4 gene 32 protein (US Biochemical, Cleveland, OH) and 0.25 U Amplitaq (Perkin-Elmer-Cetus, Norwalk, CT). PCR Profile: 94°C for 1 minute; 58°C for 1 minute; 72°C for 3 minutes; 35 cycles followed by 10 minute incubation at 72°C. Sequence of PCR Product: ATCACCAAGCAGGAGTACGACGAGGCCGGCCCTTCCATCGTCCACCGCAAATGCTTCTAGACACACTCCACCTCCAGCACGCGACTTCTCAGGACGACGAATCTTCTCAATGGGGGGGCGGCTGAGCTCCAGCCACCCCGCAGTCACTTTCTTTGTAACAACTTCCGTTGCTGCCATCGTAAACTGAC
*
To whom correspondence should be addressed
REFERENCES 1. Hanauer,A., Levin,M., Heilig.R., Daegelen,D., Kahn,A. and Mandel,J.L. (1983) Nucl. Acids Res. 11, 3503-35 16. 2. Taylor,A., Erba,H.P., Muscat,G.E. and Kedes,L. (1988) Genomics 4, 323-336. 3. Gunning,P., Mohun.T., Ng,S.-Y., Ponte,P. and Kedes,L. (1984) J. Mol. Evol. 20, 202-210.
600300-
100-
Figure 1. Amplification of ae-actin STS. Lane 1, 100 bp marker DNAs (GibcoBRL, Gaithersburg, MDO, size of some marker fragments are given in bp in the margin; Lane 2, a-actin STS obtained using conditions described.
