Nucleic Acids Research, Vol. 19, No. 24 6963
I.) 1991 Oxford University Press
An STS in the human oct-1
gene
located
on
chromosome 1
Richard A.Sturm Centre for Molecular Biology and Biotechnology, University of Queensland, Qld 4072, Australia Submitted October 31, 1991 Investigations of cellular proteins able to interact with the octamer (ATGCAAAT), which is found as a controlling element in a number of disparate gene systems, has identified a complex set of factors with distinct expression patterns. The largest of these proteins is a generally expressed sequence-specific transcription factor that has been purified to homogeneity (1) and its cDNA cloned (2). This protein, when detected through its DNA binding properties, has been labelled with a variety of names but is now commonly referred to as Oct-I and also OTF-1. The cDNA sequence of the human oct-I gene was used in comparative sequence analysis to establish a unique DNA binding structure known as the POU domain (3). The family of proteins recognising the octamer sequence have been named in series according to their electrophoretic mobility or order of characterisation, but are known as Oct-factors and all recognised Oct proteins are members of the POU class of transcription factors. The gene symbol for the Oct-I protein is OTFI for humans and Oct-I for mouse. In both species the gene has been found on chromosome 1 and mapped to region cenq32 in the human (4). I have used the human oct-I gene exon structure (R.A.S. unpublished) together with the oct-I cDNA sequence (2, accession number X13403) to select oligonucleotide primers suitable for PCR amplification from total human genomic DNA template and thus define a sequence tagged site within the OTFI locus. Figure I illustrates the amplification of a 273 bp fragment expected using a forward oligo placed directly after a 3' splice junction and a reverse oligo internal to the exon. This Oct-I STS has been used to detect expression of Oct-I by amplification of the PCR product from cDNA of total human cell line RNA, screen for the presence of oct-I clones in human X and plasmid cDNA libraries, a X genomic DNA library, the isolation of an oct- I gene containing YAC clone, and to identify recombinant baculovirus plaques. Its utility in linkage of an STSmap of chromosome 1 is to be determined in the future. PCR Primers: Forward: Oct-1-FT2 20mer, 5' GCACTTCAGACACCACCTCC 3' (corresponding to base number 1487- 1506 of reference 2) Reverse: Oct- -8 20 mer, 5' CATTTGCTGGCAACTGTGCA 3' (complementary to base number 1740- 1779 of reference 2) PCR Components: A 50 kl reaction was performed using 50 pmol of each Oct-I 20mer, 200,M dNTPs, 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.01 % gelatin, 2.5 units of AmpliTaq (PerkinElmer Cetus) and overlayed with 30 1l of paraffin oil. Figure 1 shows the result of addition of template DNAs and resolution of 5 Al of the reaction on a 2 % agarose gel. Lane 2, no DNA control, lane 3, 1 pg of pBSoct-l+ control template (2), lanes 3-6, 1 ng, 10 ng, 100 ng and 1 yg of Sigma human placenta
consensus sequence
DNA (No. D-701 1) respectively. The presence of artifactual bands is apparent at high concentrations of human genomic DNA but there is good specificity and yield with 1 to 10 ng of starting material. PCR Profile: The cycle conditions were 94°C denaturation/ 1 minute, 60°C annealing/i minute, 72°C extension/I minute for 30 cycles followed by a 72°C soak/7 minutes. Sequence of PCR Product: Yield = 273 bp
GCACTTCAGACACCACCTCCAACAACACAGCAACCGTGATTTCCACAGCGCCTCCAGCTTCCTCAGCAGTCACGTCCCCCTCTCTGAGTCCCTCCCCTTCTGCCTCAGCCTCCACCTCCGAGGCATCCAGTGCCAGTGAGACCAGCACAACACAGACCACCTCCACTCCTTTGTCCTCCCCTCTTGGGACCAGCCAGGTGATGGTGACAGCATCAGGTTTGCAAACAGCAGCAGCTGCTGCCCTTCAAGGAGCTGCACAGTTGCCAGCAAATG
ACKNOWLEDGEMENT This work was supported by the award of an Australian Research Council Queen Elizabeth II Fellowship to R.A.S.
REFERENCES 1. Sturm,R., Baumruker,T., Franza,B.R.Jr and Herr,W. (1987) Genes Dev. 1, 1147-1160. 2. Sturm,R.A., Das,G. and Herr,W. (1988) Genes Dev. 2, 1582-1599. 3. Herr,W., Sturm,R.A., Clerc,R.G., Corcoran,L.M., Baltimore,D., Sharp,P.A., Ingraham,H.A., Rosenfeld,M.G., Finney,M., Ruvkun,G. and Horvitz,H.R. (1988) Genes Dev. 2, 1513-1516. 4. Hsieh,C.-L., Sturm,R., Herr,W. and Francke,U. (1990) Genomics 6, 666-672.
Oct- I S STt
12345678
Figure 1. Amplification of Oct-I STS on plasmid cloned and human genomic DNA. Lane 1, XHIII marker, lane 2, no DNA, lane 3, 1 pg of pBSoct-1 +, and different amounts of human placenta DNA, lane 4, 1 ng, lane 5, 10 ng, lane 6, 100 ng, lane 7, 1 jig, and lane 8, pBR22 HpaII marker. The specifically amplified fragment is shown by the arrow to the right of the figure, unincorporated primer is present in all lanes.
I.) 1991 Oxford University Press
An STS in the human oct-1
gene
located
on
chromosome 1
Richard A.Sturm Centre for Molecular Biology and Biotechnology, University of Queensland, Qld 4072, Australia Submitted October 31, 1991 Investigations of cellular proteins able to interact with the octamer (ATGCAAAT), which is found as a controlling element in a number of disparate gene systems, has identified a complex set of factors with distinct expression patterns. The largest of these proteins is a generally expressed sequence-specific transcription factor that has been purified to homogeneity (1) and its cDNA cloned (2). This protein, when detected through its DNA binding properties, has been labelled with a variety of names but is now commonly referred to as Oct-I and also OTF-1. The cDNA sequence of the human oct-I gene was used in comparative sequence analysis to establish a unique DNA binding structure known as the POU domain (3). The family of proteins recognising the octamer sequence have been named in series according to their electrophoretic mobility or order of characterisation, but are known as Oct-factors and all recognised Oct proteins are members of the POU class of transcription factors. The gene symbol for the Oct-I protein is OTFI for humans and Oct-I for mouse. In both species the gene has been found on chromosome 1 and mapped to region cenq32 in the human (4). I have used the human oct-I gene exon structure (R.A.S. unpublished) together with the oct-I cDNA sequence (2, accession number X13403) to select oligonucleotide primers suitable for PCR amplification from total human genomic DNA template and thus define a sequence tagged site within the OTFI locus. Figure I illustrates the amplification of a 273 bp fragment expected using a forward oligo placed directly after a 3' splice junction and a reverse oligo internal to the exon. This Oct-I STS has been used to detect expression of Oct-I by amplification of the PCR product from cDNA of total human cell line RNA, screen for the presence of oct-I clones in human X and plasmid cDNA libraries, a X genomic DNA library, the isolation of an oct- I gene containing YAC clone, and to identify recombinant baculovirus plaques. Its utility in linkage of an STSmap of chromosome 1 is to be determined in the future. PCR Primers: Forward: Oct-1-FT2 20mer, 5' GCACTTCAGACACCACCTCC 3' (corresponding to base number 1487- 1506 of reference 2) Reverse: Oct- -8 20 mer, 5' CATTTGCTGGCAACTGTGCA 3' (complementary to base number 1740- 1779 of reference 2) PCR Components: A 50 kl reaction was performed using 50 pmol of each Oct-I 20mer, 200,M dNTPs, 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.01 % gelatin, 2.5 units of AmpliTaq (PerkinElmer Cetus) and overlayed with 30 1l of paraffin oil. Figure 1 shows the result of addition of template DNAs and resolution of 5 Al of the reaction on a 2 % agarose gel. Lane 2, no DNA control, lane 3, 1 pg of pBSoct-l+ control template (2), lanes 3-6, 1 ng, 10 ng, 100 ng and 1 yg of Sigma human placenta
consensus sequence
DNA (No. D-701 1) respectively. The presence of artifactual bands is apparent at high concentrations of human genomic DNA but there is good specificity and yield with 1 to 10 ng of starting material. PCR Profile: The cycle conditions were 94°C denaturation/ 1 minute, 60°C annealing/i minute, 72°C extension/I minute for 30 cycles followed by a 72°C soak/7 minutes. Sequence of PCR Product: Yield = 273 bp
GCACTTCAGACACCACCTCCAACAACACAGCAACCGTGATTTCCACAGCGCCTCCAGCTTCCTCAGCAGTCACGTCCCCCTCTCTGAGTCCCTCCCCTTCTGCCTCAGCCTCCACCTCCGAGGCATCCAGTGCCAGTGAGACCAGCACAACACAGACCACCTCCACTCCTTTGTCCTCCCCTCTTGGGACCAGCCAGGTGATGGTGACAGCATCAGGTTTGCAAACAGCAGCAGCTGCTGCCCTTCAAGGAGCTGCACAGTTGCCAGCAAATG
ACKNOWLEDGEMENT This work was supported by the award of an Australian Research Council Queen Elizabeth II Fellowship to R.A.S.
REFERENCES 1. Sturm,R., Baumruker,T., Franza,B.R.Jr and Herr,W. (1987) Genes Dev. 1, 1147-1160. 2. Sturm,R.A., Das,G. and Herr,W. (1988) Genes Dev. 2, 1582-1599. 3. Herr,W., Sturm,R.A., Clerc,R.G., Corcoran,L.M., Baltimore,D., Sharp,P.A., Ingraham,H.A., Rosenfeld,M.G., Finney,M., Ruvkun,G. and Horvitz,H.R. (1988) Genes Dev. 2, 1513-1516. 4. Hsieh,C.-L., Sturm,R., Herr,W. and Francke,U. (1990) Genomics 6, 666-672.
Oct- I S STt
12345678
Figure 1. Amplification of Oct-I STS on plasmid cloned and human genomic DNA. Lane 1, XHIII marker, lane 2, no DNA, lane 3, 1 pg of pBSoct-1 +, and different amounts of human placenta DNA, lane 4, 1 ng, lane 5, 10 ng, lane 6, 100 ng, lane 7, 1 jig, and lane 8, pBR22 HpaII marker. The specifically amplified fragment is shown by the arrow to the right of the figure, unincorporated primer is present in all lanes.
