..) 1991 Oxford University Press
5084 Nucleic Acids Research, Vol. 19, No. 18
An STS in the human adenosine deaminase (located 20q1 2-q1 3.1 1)
gene
Brian C.Freeman and J.Christopher States* Center for Molecular Biology, Wayne State University, Detroit, MI 48201, USA Submitted June 21, 1991 The human adenosine deaminase gene has been characterized in detail (1). The adenosine deaminase gene product, as part of the purine catabolic pathway, catalyzes the irreversible deamination of adenosine and deoxyadenosine. Deficiency of this activity in humans is associated with an autosomal recessive form of severe combined immunodeficiency disease (2). Recently, this genetic deficiency disease has been targeted for the first attempts at gene therapy in humans. Using the polymerase chain reaction (PCR) described below, a fragment of the expected size (160 bp) was amplified from human genomic DNA (Figure 1). The amplified fragment was sequenced to confirm that it contained the expected sequence encoded by the 3' untranslated region of exon 12 from positions 31855 to 32014 (1). Amplification of the STS using a human/hamster hybrid chromosome panel properly mapped the adenosine deaminase gene to chromosome 20 (data not shown). Thus, the usefulness of the STS has been confirmed. PCR Primers: Forward (1-16) ACCCTATGTGTCCATT Reverse (160-144) ATTGAGCACCAGATTT PCR Components in a 10 Al Reaction: 50 ng DNA, 1 Al 10xPCR buffer D (100 mM Tris-HCl, pH 8.8, 500 mM KCI, 60 mM MgCl2, 10 mM dithiothreitol), 100 nM of each oligonucleotide, 200 ptM dNTPs, 1.0 ptg bacteriophage T4 gene 32 protein (US Biochemical, Cleveland, OH) and 0.25 U Amplitaq (Perkin-Elmer Cetus, Norwalk, CT). PCR Profile: 94°C for 1 minute; 55°C for 1 minute; 72°C for 3 minutes; 35 cycles followed by 10 minute incubation at 72°C. Sequence of PCR Product: ACCCTATGTGTCCATTTCTGCACACACGTATACCTCGGCATGGCCGCGTCACTTCTCTGATTATGTGCCCTGGCCAGGGACCAGCGCCCTTGCACATGGGCATGGTTGAATCTGAAACCCTCCTTCTGTGGCAACTTGTACTGAAAATCTGGTGCTCAAT
*
To whom correspondence should be addressed
REFERENCES 1. Wiginton,D.A., Kaplan,D.L.. States,J.C., Akeson,A.L., Perme,C., Bilyk,l., Vaughn,A., Lattier,D.L and Hutton,J.J. (1986) Biochemistry 25, 8234-8245. 2. Martin,D. and Gelfand,E. (1981) Annu. Rev. Biochem. 50, 845-877.
600'100.00-
Figure 1. Amplification of human adenosine deaminase STS. Lane 1, 100 bp marker DNAs (Gibco-BRL, Gaithersburg, MD), sizes of some marker fragments are given in bp in the margin; Lane 2, adenosine deaminase STS obtained using conditions described.
5084 Nucleic Acids Research, Vol. 19, No. 18
An STS in the human adenosine deaminase (located 20q1 2-q1 3.1 1)
gene
Brian C.Freeman and J.Christopher States* Center for Molecular Biology, Wayne State University, Detroit, MI 48201, USA Submitted June 21, 1991 The human adenosine deaminase gene has been characterized in detail (1). The adenosine deaminase gene product, as part of the purine catabolic pathway, catalyzes the irreversible deamination of adenosine and deoxyadenosine. Deficiency of this activity in humans is associated with an autosomal recessive form of severe combined immunodeficiency disease (2). Recently, this genetic deficiency disease has been targeted for the first attempts at gene therapy in humans. Using the polymerase chain reaction (PCR) described below, a fragment of the expected size (160 bp) was amplified from human genomic DNA (Figure 1). The amplified fragment was sequenced to confirm that it contained the expected sequence encoded by the 3' untranslated region of exon 12 from positions 31855 to 32014 (1). Amplification of the STS using a human/hamster hybrid chromosome panel properly mapped the adenosine deaminase gene to chromosome 20 (data not shown). Thus, the usefulness of the STS has been confirmed. PCR Primers: Forward (1-16) ACCCTATGTGTCCATT Reverse (160-144) ATTGAGCACCAGATTT PCR Components in a 10 Al Reaction: 50 ng DNA, 1 Al 10xPCR buffer D (100 mM Tris-HCl, pH 8.8, 500 mM KCI, 60 mM MgCl2, 10 mM dithiothreitol), 100 nM of each oligonucleotide, 200 ptM dNTPs, 1.0 ptg bacteriophage T4 gene 32 protein (US Biochemical, Cleveland, OH) and 0.25 U Amplitaq (Perkin-Elmer Cetus, Norwalk, CT). PCR Profile: 94°C for 1 minute; 55°C for 1 minute; 72°C for 3 minutes; 35 cycles followed by 10 minute incubation at 72°C. Sequence of PCR Product: ACCCTATGTGTCCATTTCTGCACACACGTATACCTCGGCATGGCCGCGTCACTTCTCTGATTATGTGCCCTGGCCAGGGACCAGCGCCCTTGCACATGGGCATGGTTGAATCTGAAACCCTCCTTCTGTGGCAACTTGTACTGAAAATCTGGTGCTCAAT
*
To whom correspondence should be addressed
REFERENCES 1. Wiginton,D.A., Kaplan,D.L.. States,J.C., Akeson,A.L., Perme,C., Bilyk,l., Vaughn,A., Lattier,D.L and Hutton,J.J. (1986) Biochemistry 25, 8234-8245. 2. Martin,D. and Gelfand,E. (1981) Annu. Rev. Biochem. 50, 845-877.
600'100.00-
Figure 1. Amplification of human adenosine deaminase STS. Lane 1, 100 bp marker DNAs (Gibco-BRL, Gaithersburg, MD), sizes of some marker fragments are given in bp in the margin; Lane 2, adenosine deaminase STS obtained using conditions described.
