Nucleic Acids Research, Vol. 19, No. 20 5793
An STS at the Dl 6S290 locus L.Z.Chen, Y.Shen, K.Holman, A.Thompson, S.Lane, R.I.Richards, G.R.Sutherland and D.F.Callen Department of Cytogenetics and Molecular Genetics, Adelaide Children's Hospital, North Adelaide, South Australia 5006, Australia Submitted August 13, 1991 A DNA clone (T102) prepared from a cosmid library of flowsorted human chromosome 16 (1) screened by hybridization to a tetranucleotide repeat (AGAT)n was sequenced. T102 contains a poly (T) tract of 40 nucleotides interrupted by five cytosines. Using PCR conditions described below, a fragment of the expected size (275 bp) was amplified and located at 16ql2. 1 by analysis of the mouse-human somatic cell hybrid-panel (2, 3) in the interval between CY132 and CY140 (see figure). PCR analysis of 20 unrelated caucasian individuals failed to detect any polymorphism at this locus. PCR Primers: Forward CGTAAGAAGAGGTTTGCACC Reverse CAAGAGCGAAACTCCGTCTC PCR Components: 100 ng of human genomic DNA, 150 ng of each oligodeoxyribonucleotide primer, 0.5 U Amplitaq DNA Polymerase (Perkin Elmer Cetus), and 7 mM MgCl2 in 20 1ld of PCR reaction mix (4).
PCR Profile: 94°C for 1 minute 60°C for 1.5 minutes 72°C for 1.5 minutes for 10 cycles 94°C for 1 minute 55°C for 1.5 minutes 72°C for 1.5 minutes for 25 cycles The final elongation cycle was 10 minutes at 720C.
Sequence of the PCR product:
CGTAAGAAGAGGTTTGCACCCCACCTGGCCTGGCCGTGTCCTCTGGGCTGCCCTGTCGGCTGCCTGCTGGGCTTAGCTTAAGAATGGCTGAGATGAATCTGTGCTGGGCAGGGGACAGTCCTGCTGCATCTGAAAGAAGGGTGCCCCATATCCCACTCATTGGGGATGGTGGCCTGGGCTCTAGGGTCGCCATGTGGGAGATGAGATGGATTTTTTTTTCTTTTCTTTTTTCTTTTTCTTTTTCTTTTTTTTTTTGAGACGGAGTTTCGCTCTTG
REFERENCES 1. 2. 3. 4.
Stallings,R.L. et al. (1990) Proc. Natl. Acad. Sci. USA 87, 6218-6222. Callen,D.F. et al. (1990) Ann. Genet. 33, 190-195. Chen,L.Z. et al. (1991) Genomics 10, 308-312. Richards,R.I. et al. (1991) Am. J. Hum. Genet. 48, 1051-1057.
00 c1r) 00--4
275bp
cZ1 -4
m