Protein Expression and Purification 114 (2015) 71–76

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

An improved method for high-level soluble expression and purification of recombinant amyloid-beta peptide for in vitro studies Gaurav Chhetri a,1, Tripti Pandey a,1, Ramesh Chinta a, Awanish Kumar b,⇑, Timir Tripathi a,⇑ a b

Molecular and Structural Biophysics Laboratory, Department of Biochemistry, North-Eastern Hill University, Shillong 793022, India Department of Biotechnology, National Institute of Technology, Raipur 492010, India

a r t i c l e

i n f o

Article history: Received 27 April 2015 and in revised form 28 May 2015 Accepted 29 May 2015 Available online 25 June 2015 Keywords: Ab peptide Aggregation Ethanol Enterokinase Affinity chromatography Assembly PCR High-yield recombinant production

a b s t r a c t Amyloid-beta (Ab) peptide mediates several neurodegenerative diseases. The 42 amino acid (Ab1–42) is the predominant form of peptide found in the neuritic plaques and has been demonstrated to be neurotoxic in vivo and in vitro. The availability of large quantities of Ab peptide will help in several biochemical and biophysical studies that may help in exploring the aggregation mechanism and toxicity of Ab peptide. We report a convenient and economical method to obtain such a peptide biologically. Synthetic oligonucleotides encoding Ab1–42 were constructed and amplified through the polymerase cycling assembly (also known as assembly PCR), followed by the amplification PCR. Ab1–42 gene was cloned into pET41a(+) vector for expression. Interestingly, the addition of 3% (v/v) ethanol to the culture medium resulted in the production of large amounts of soluble Ab fusion protein. The Ab fusion protein was subjected to a Ni–NTA affinity chromatography followed by enterokinase digestion, and the Ab peptide was purified using glutathione Sepharose affinity chromatography. The peptide yield was 15 mg/L culture, indicating the utility of this method for high-yield production of soluble Ab peptide. Sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis and immunoblotting with anti-His antibody confirmed the identity of purified Ab fusion protein and Ab peptide. In addition, this method provides an advantage over the chemical synthesis and other conventional methods used for large-scale production of recombinant Ab peptide. Ó 2015 Published by Elsevier Inc.

1. Introduction Misfolding of peptide results in inappropriate cellular mechanism that cause debilitating diseases [1]. Amyloids belong to the category of misfolded peptide that undergo oligomerization and transform to fibril-like structures [2,3]. Fibril structures have the tendency of forming b-sheets that are responsible for the formation of the amyloid plaques [4]. These amyloid plaques are the pathological hallmark of several neurodegenerative diseases including Alzheimer’s and Parkinson’s diseases [5–7]. Recent studies have reported different peptide, such as Ab1–23, Ab1–13, Ab1–26, Ab1–18, Ab1–40, and Ab1–42, which are responsible for the formation of amyloid plaques [8–10]. It has been observed that Ab1–42 and Abbreviations: Ab, amyloid-b peptide; EK, enterokinase; GSH, reduced glutathione; GST, glutathione S-transferase; IPTG, isopropyl b-D-1-thiogalactopy ranoside; Ni–NTA, nickel–nitrilotriacetic acid. ⇑ Corresponding authors. E-mail addresses: [email protected] (A. Kumar), timir.tripathi@gmail. com, [email protected] (T. Tripathi). 1 Both authors contributed equally to the work. http://dx.doi.org/10.1016/j.pep.2015.05.015 1046-5928/Ó 2015 Published by Elsevier Inc.

Ab1–40 are the major and minor components of the brain plaques respectively [11–15]. The b-amyloid (Ab1–42) is a 4.5 kDa peptide released by the proteolysis from the membrane-spanning amyloid precursor protein, containing both extracellular and transmembrane domains obtained from its precursor. Ab has more tendency of interacting with other proteins, which results in blocking the neural cells and increasing the disease conditions [16,17]. The paths traversed during fibrillogenesis, the kinetics of the process, and the solution variables affecting the fibrillation are of considerable interest because of their relevance to disease mechanism [18]. Even though significant advances have been made to understand the intermediates formed during fibrillogenesis [18–23], still many questions remain unanswered regarding novel intermediates, their size, and structural and morphological characteristics. In order to investigate the aggregation mechanism and toxicity of these aggregated proteins, the production of high yields of Ab is a prerequisite. However, it is difficult to isolate the mass amount of Ab from the neural tissues [7]. These Ab peptide follow rapid aggregation; therefore, the isolation of Ab from the neural tissues is not beneficial when obtaining large quantities of peptide possessing

72

G. Chhetri et al. / Protein Expression and Purification 114 (2015) 71–76

appropriate biological activities [15]. The present genetic engineering tools provide us with an advantage for producing large quantities of Ab. Ab is a highly toxic and poorly soluble species that makes it difficult to be expressed in conventional Escherichia coli (E. coli) cells expression system. This limitation suggests adopting a construct having fusion tag that can express the Ab as a fusion protein in non-toxic and highly soluble form. In the present study, we report gene synthesis, molecular cloning, expression, and high-yield purification of soluble Ab peptide.

Table 1a Various primers used for Ab gene synthesis. Primer name

Primers 50 –30

T1 T2 T3 T4 T5 T6 T7 T8

CCCTCGAGATGGACGCTGAATTCCGTCACGACTCT GTGAACTTCGTAACCAGAGTCGTGACGGAATTCAG GGTTACGAAGTTCACCACCAGAAGCTGGTGTTCTTC ACCCACGTCTTCAGCGAAGAACACCAGCTTCTGGTG GCTGAAGACGTGGGTTCTAACAAGGGTGCTATCAT CCAACCATCAGACCGATGATAGCACCCTTGTTAGA CGGTCTGATGGTTG GTGGCGTTGTGCCATGGCATG CATGCCATGGCACAACGCCA

2. Materials and methods 2.1. Materials The molecular biology kits were purchased from Qiagen, CA, USA. The dNTPs and enzymes were purchased from New England Biolabs, MA, USA. Primers for the synthesis of gene Ab1–42 were ordered from GCC Biotech Pvt Ltd, India. All other reagents and chemicals were purchased either from Sigma–Aldrich Chemical Company, St. Louis, MO, USA, or Sisco Research Laboratories, Mumbai, India and were of the highest purity available. Bacterial culture media was purchased from Himedia Laboratories, Mumbai, India. 2.2. Synthesis and amplification of Ab1–42 gene The Ab1–42 gene was synthesized by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs, USA) according to the manufacturer’s guidelines. The PCR was performed in two steps: assembly PCR for gene synthesis and amplification PCR [24]. The first step was performed using the Phusion DNA polymerase, and the respective primers are shown in Table 1a. It was followed by the second step in which gene amplification was performed using the forward (F) and reverse (R) primers shown in Table 1b. Gene amplification primers introduced BamHI and HindIII restriction sites on the 50 and 30 ends of the gene, respectively. The PCR solution was prepared in the buffer supplied with the enzyme and contained 50 pmol of each T1, T2, T3, T4, T5, T6, T7, and T8 primers along with deoxynucleotide triphosphates (dNTPs). The PCR reaction was performed with the following cycle parameters: initial denaturation temperature of 98 °C for 30 s, 30 cycles of 98 °C for 10 s, 60 °C for 15 s, and 72 °C for 10 s, followed by a final extension of 72 °C for 5 min The PCR products were resolved using 12% agarose gel electrophoresis and amplicon of the expected size (150 bp) was purified using the QIAquick Gel Extraction Kit (Qiagen, CA, USA). 2.3. Cloning and sub-cloning of Ab1–42 gene The purified PCR product was ligated to pSK+ vector to generate recombinant Ab-pSK+ construct. The ligation product was transformed into competent E. coli DH5a cells. Plasmid was isolated from the positive clones and sequenced to ensure fidelity. Nucleotide sequencing was carried out at Xcelris lab. The plasmid was digested with both BamHI and HindIII and cloned to pET41a(+) vector to generate the recombinant Ab-pET41a(+) construct. pET41a(+) vector (5.9 kb) contains a N-terminal GST-tag, His-tag (at both N- and C-terminal), a N-terminal thrombin cleavage site and a N-terminal enterokinase cleavage site. The recombinant plasmids were transformed into chemically competent E. coli BL21 (DE3) expression host cells and then spread onto an agar plate containing kanamycin (50 lg/mL) to allow the selection of colonies that successfully incorporated the recombinant plasmids. Plasmid DNA extraction was performed using the QIAprep Midiprep plasmid purification kit (Qiagen, CA, USA).

Table 1b Primers used in amplification PCR. Primer name

Primers 50 –30

Forward (F) Reverse (R)

CGGGATCCCCCTCGAGATGGACGCTGAATTCCGTCACGACTCT CCAAGCTTCATGCCATGGCACAACGCCA

2.4. Optimization of recombinant Ab fusion protein expression Transformed colonies were screened on selective Luria–Bertani (LB) agar plates supplemented with kanamycin. A positive clone was picked up and grown overnight in 5 mL LB broth containing 50 lg/mL ampicillin at 37 °C with 180 rpm shaking. Optimal expression conditions were firstly standardized on 5 mL cultures. The isopropyl b-D-1-thiogalactopyranoside (IPTG) concentrations of 0.5 mM and 1 mM, along with two different incubation temperature at 23 °C and 37 °C, were tested for 16 h and 4 h induction time course respectively. In addition to increasing the expression level of recombinant protein, ethanol concentrations were also studied and optimized according to Chhetri et al.’s [25,26] study. 2.5. Large-scale culture and expression of recombinant Ab fusion protein 2 mL of primary culture was inoculated in 400 mL LB broth sterile media supplemented with 50 lg/mL kanamycin and incubated in 37 °C with 180 rpm shaking until the OD600 reached 0.5. Another 5 mL LB broth culture tube containing the above-mentioned antibiotics was inoculated with the primary culture and was kept as un-induced control. After the OD600 had reached the required level, the culture was induced with 0.5 mM IPTG and incubated for 16 h at 23 °C with continuous shaking. On the next day, the cells were harvested by centrifugation at 4 °C, and the pellet was resuspended in 20 mL of 50 mM Tris (pH 8.0) and 300 mM NaCl containing protease inhibitor cocktail. 2.6. Purification of recombinant Ab fusion protein by immobilized metal affinity chromatography (IMAC) Homogenized cells were lysed on ice using sonication at 50% amplitude for 60 cycles (30 s pulse on, 30 s pulse off). The crude lysate was centrifuged at 12,000 rpm for 20 min at 4 °C. The supernatant was filtered through a 0.45 lm pore size polyvinylidene difluoride (PVDF) membrane prior to the affinity chromatography. Then the matrix was extensively washed with 10–12 bed volumes of equilibration buffer (50 mM Tris [pH 8.0], 300 mM NaCl). The supernatant fraction was applied to Ni–NTA agarose matrix (Qiagen, USA) followed by washing with increasing concentration of imidazole. Recombinant protein was eluted with elution buffer (50 mM Tris (pH 8.0), 300 mM NaCl, and 300 mM imidazole). Protein concentration 46 mg/L was quantified by the Bradford method. The purification was analyzed by 15% sodium dodecyl

G. Chhetri et al. / Protein Expression and Purification 114 (2015) 71–76

73

sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). The protein was dialyzed overnight using dialysis buffer (20 mM phosphate [pH 8.0], 150 mM NaCl) at 4 °C.

2.7. Optimization of glutathione S-transferase (GST) tag cleavage from Ab fusion protein According to the manufacturer’s recommendation, Enterokinase (EK) cleavage for Ab fusion protein was carried out on an enzyme/substrate with the ratio ranging from 0.0001% to 0.5% (w/w) for 16 h at 25 °C. In order to ensure the optimum concentration of the enzyme, the pilot experiments with the small amounts of Ab fusion proteins and different concentrations of EK enzyme were first optimized. Further, 6.4 ng of EK was used to cleave the GST-tag from 1 mg of Ab fusion proteins. Following this, EK was removed by binding specifically to trypsin inhibitor-agarose.

2.8. Second-step purification of EK digested Ab fusion protein using an immobilized glutathione Sepharose column EK digested Ab fusion proteins supernatant was filtered through a 0.45 lm pore PVDF membrane and then loaded onto the immobilized glutathione Sepharose resin (GE, Healthcare). The column was equilibrated with 10 bed volume of PBS buffer (1). In order to ensure proper protein binding, the column was incubated in PBS buffer for 30 min at 4 °C. The Ab peptide was eluted in flow through and subjected to 20% SDS–PAGE analysis. Purified protein concentration was quantified by the Bradford method.

3. Results

Fig. 1. PCR amplification and restriction digestion of Ab positive gene. Lane 1, DNA ladder. Lane 2: amplified PCR product (150 bp). Lane 3: Ab-pSK+ digested with BamHI & HindIII; upper band represents the linear backbone of pSK+ vector (3 Kb) and lower band (150 bp) is the Ab gene. 1% agarose gel electrophoresis was used to visualize the bands.

3.1. Amplification, cloning and sub-cloning of Ab1–42 gene Ab gene was amplified using the PCR. The product was cloned in pSK+ vector and further sub-cloned in pET41a(+) expression vector (Fig. 1). Restriction digestion and gene sequencing confirmed the positive clone. Full sequencing of the insert was realized and aligned with the known sequence using multiple sequence analysis. This confirmed the identity of the gene with the nucleotide sequence of Ab1–42 gene present in the database. The final construct was named as pET41a(+)-Ab.

3.2. Ab fusion protein expression and solubility optimization Optimal IPTG concentration, expression time, and temperature were obtained from time course expression experiments at low (0.1 mM) and high (1 mM) inducer concentrations. The effect of 3% ethanol in inducing the overexpression of Ab fusion protein was also studied and analyzed by SDS–PAGE (Fig. 2). Temperature-dependent expression experiments were performed at 37 °C and 23 °C, and the latter expression was found to be higher than the former one (Fig. 3). The overexpressed His-tagged Ab fusion protein was confirmed by western blot analysis using anti-His antibody. Recombinant bacterial cells were collected by centrifugation and lysed by sonication. The supernatants and pellets were collected and subjected to 12% SDS–PAGE analysis. The results showed that the molecular weight of the expression product was 30 kDa, which corresponded to the predicted size of Ab fusion protein. The Ab fusion protein was predominantly present in the soluble fraction as compared to the pellet fraction (Fig. 4). About 90% of the total target protein was found to be in the soluble fraction.

3.3. First-step purification of Ab fusion protein by IMAC Purification of the recombinant Ab fusion protein was performed using an IMAC on Ni–NTA resin column. Following this, the protein was about 95% purified (Fig. 5). The yield of purified recombinant Ab fusion protein per liter culture (2.86 g) was approximately 46 mg/L; i.e. 5 mg of protein was obtained per g of dry cell pellet. Table 2 shows the amount of cells and purification fold after each step of chromatography. The SDS–PAGE analysis showed a single protein band with the expected molecular mass of the recombinant protein, i.e. 30 kDa (Fig. 5). 3.4. GST-tag cleavage from Ab fusion protein GST-tag cleavage was performed according to the protocol mentioned in the materials and method section. EK cleavage was confirmed to be 100%. Ab-GST fusion protein with the molecular weight of around 30 kDa was separated into two bands on 15% SDS–PAGE, where a GST-tag of 26 kDa and a small band of about 4 kDa were observed (Fig. 6). 3.5. Second-step purification of EK digested Ab fusion proteins The EK cleaved Ab fusion protein was subjected for a second step of purification using GSH affinity chromatography. Following this chromatography, the Ab peptide was observed to be purified to apparent homogeneity (Fig. 6). The yield of purified Ab peptide per liter culture was approximately 15 mg/L. Table 2 shows the amount of cells and purification fold after each step of

74

G. Chhetri et al. / Protein Expression and Purification 114 (2015) 71–76

chromatography. The purified Ab peptide was stored in 50% glycerol at 20 °C for long term storage so that it could be used further for in vitro studies.

4. Discussion

Fig. 2. SDS–PAGE analysis in presence of ethanol. Protein samples were separated by SDS–PAGE gels (12%), and stained with Coomassie brilliant blue. Lane 1, molecular weight markers (kDa). Lane 2, Ab fusion un-induced control. Lane 3, Ab fusion induced in presence of 3% ethanol. Lane 4, Ab fusion induced in absence of ethanol.

Fig. 3. Effect of temperature on the expression of Ab fusion protein. Lane 1: molecular weight marker; Lane 2: Ab fusion un-induced control; Lane 3: Ab fusion induced in the presence of 3% ethanol and incubated in 37 °C after induction for 4 h; Lane 4: Ab fusion induced in the presence of 3% ethanol and incubated in 23 °C after induction for 16 h. The expression was induced with 0.5 mM IPTG.

A comprehensive study of Ab, either in vivo or in vitro, requires an understanding of the conditions that drive peptide assembly toward one conformational state to another and the factors which regulate their formation [27]. Any change that affects the conformation of Ab likely affects its biological activity. A detailed characterization of the mechanism of formation of the intermediates and fibrils can facilitate the design and targeting of compounds that inhibit the growth or disaggregate fibrils. The present work on expression and purification of Ab peptide provides us with a large amount, i.e. 15 mg/L, of Ab peptide, which can help researchers to investigate the process of oligomerization or aggregation formation of amyloid fibrils without having to purchase costly synthetic Ab peptide. The expression fold of the recombinant fusion protein increased with the addition of 3% ethanol (v/v) [25,26]. Moreover, this addition also mimicked the heat shock response in E. coli and enhanced the solubility of recombinant protein [28,29]. The use of fusion protein helped in getting high solubility, thereby preventing Ab self-aggregation and allowing easy purification, resulting in high yields of Ab peptide. Furthermore, the use of EK cleavage yields purified the Ab peptide with no extra amino acid residues at the N-terminus. E. coli is a widely used system for recombinant protein production owing to its well-characterized genetics, cultivation conditions, and low cost [30–32]. Ab peptide is difficult to express in conventional E. coli cells because of its toxicity and poor solubility. Advances in recombinant DNA technology have generated several vectors that promote the expression of recombinant proteins in a soluble fraction. Many of these vectors contain a GST-tag that acts

Fig. 4. SDS–PAGE analysis of the soluble and insoluble fraction. Ab fusion protein was grown in presence of 3% ethanol, induced with 0.5 mM IPTG and incubated in 23 °C. Cells were sonicated and divided into pellet and supernatant fraction. Lane 1: molecular weight marker; Lane 2: Ab fusion un-induced control; Lane 3: Ab fusion cell debris fraction; Lane 4: Ab fusion soluble fraction.

G. Chhetri et al. / Protein Expression and Purification 114 (2015) 71–76

Fig. 5. SDS–PAGE analysis of Ab fusion un-induced, induced, IMAC and GSH purified protein. Lane 1: molecular weight marker. Lane 2: Ab fusion un-induced control cell lysate. Lane 3: Ab fusion induced cell lysate; Lane 4: Ab fusion IMAC purified protein.

Table 2 Amount of cells and fold purification after each step of chromatography. Crude cell pellet/L culture (g)

Total protein/L culture (mg)

Protein yield after IMAC/L culture (mg)

Protein yield after GSH affinity purification/L culture (mg)

2.86

212

46

15

Ab fusion protein concentration (mg/L)

Purified Ab peptide concentration (mg/L)

Refs.

0.00036

Zhang et al. [45] Garai et al. [7] Lee et al. [48] This study

1

9

2

40

3

3

25

4

4

45

15

Fig. 6. SDS–PAGE analysis of EK cleavage Ab fusion protein. Protein samples were separated by 15% SDS–PAGE gels. Lane 1: molecular weight marker. Lane 2: Ab fusion un-induced control cell lysate. Lane 3: Ab fusion purified protein; Lane 4: EK cleaved Ab fusion protein. Lane 5: purified Ab peptide.

and purified Ab peptide than the other existing reported methods. The concentration of final purified Ab peptide was found to be 15 mg/L, which is very high as compared to the other strategies adapted for the affordable source of Ab peptide [7,45,46]. The comparison of the amount of purified Ab peptide using different expression strategies and our protocol is given in Table 3. 5. Conclusion

Table 3 Comparison of the amount of purified Ab peptides using different expression strategies and our protocol. S. No

75

as a chaperone to facilitate protein folding and allow easy purification of recombinant protein along with good solubility. GST can also increase the protein yield by allowing efficient initiation of translation [33]. GST is a widely used tag for different biological systems, including E. coli [34–36], yeast [37,38], plant [39,40], insect [41,42], and mammalian cells [43,44]. Therefore, in an attempt to improve the solubility and simplify the means of production of Ab peptide, this gene was cloned in frame with a GST-tag in pET41a(+) vector. Some reports used GST-tag for Ab peptide production, but a part of the expressed protein was also found in the inclusion bodies [7,15,45], which reduced the production of purified Ab peptide. Our method is effective and an improved protocol to obtain large amount of recombinant, soluble

Other than the relatively high yield of production of Ab peptide, our protocol also allows researchers to avoid the use of human Alzheimer’s sample and chemical synthesis [47,48] of Ab peptide, which are time-consuming processes and require access to specialized equipments and are relatively expensive. High yield recombinant Ab peptide gives us the opportunity to understand the structure of amyloid oligomers, intermediates, and fibrils. A better understanding of the assembly mechanism is essential for combating the amyloid diseases as well as exploiting the potential benefits of peptide design. Acknowledgement The study was supported by a research grant from Department of Science and Technology, New Delhi, India (SR/FT/LS-206/2009). References [1] J.P. Cleary, D.M. Walsh, J.J. Hofmeister, G.M. Shankar, M.A. Kuskowski, D.J. Selkoe, K.H. Ashe, Natural oligomers of the amyloid-beta protein specifically disrupt cognitive function, Nat. Neurosci. 8 (2005) 79–84. [2] A.R. Koudinov, T.T. Berezov, Alzheimer’s amyloid-beta (A beta) is an essential synaptic protein, not neurotoxic junk, Acta Neurobiol. Exp. (Wars) 64 (2004) 71–79. [3] F. Chiti, C.M. Dobson, Protein misfolding, functional amyloid, and human disease, Annu. Rev. Biochem. 75 (2006) 333–366. [4] B.R. Roberts, T.M. Ryan, A.I. Bush, C.L. Masters, J.A. Duce, The role of metallobiology and amyloid-beta peptides in Alzheimer’s disease, J. Neurochem. 120 (Suppl. 1) (2012) 149–166.

76

G. Chhetri et al. / Protein Expression and Purification 114 (2015) 71–76

[5] M. Bucciantini, E. Giannoni, F. Chiti, F. Baroni, L. Formigli, J. Zurdo, N. Taddei, G. Ramponi, C.M. Dobson, M. Stefani, Inherent toxicity of aggregates implies a common mechanism for protein misfolding diseases, Nature 416 (2002) 507–511. [6] C.A. Ross, M.A. Poirier, Opinion: what is the role of protein aggregation in neurodegeneration?, Nat Rev. Mol. Cell Biol. 6 (2005) 891–898. [7] K. Garai, S.L. Crick, S.M. Mustafi, C. Frieden, Expression and purification of amyloid-beta peptides from Escherichia coli, Protein Expr. Purif. 66 (2009) 107–112. [8] L. Hou, H. Shao, Y. Zhang, H. Li, N.K. Menon, E.B. Neuhaus, J.M. Brewer, I.J. Byeon, D.G. Ray, M.P. Vitek, T. Iwashita, R.A. Makula, A.B. Przybyla, M.G. Zagorski, Solution NMR studies of the A beta(1–40) and A beta(1–42) peptides establish that the Met35 oxidation state affects the mechanism of amyloid formation, J. Am. Chem. Soc. 126 (2004) 1992–2005. [9] H.M. Sanders, R. Lust, J.K. Teller, Amyloid-beta peptide Abetap3-42 affects early aggregation of full-length Abeta1-42, Peptides 30 (5) (2009) 849–854. [10] R.W. Shin, K. Ogino, A. Kondo, T.C. Saido, J.Q. Trojanowski, T. Kitamoto, J. Tateishi, Amyloid beta-protein (Abeta) 1–40 but not Abeta1–42 contributes to the experimental formation of Alzheimer disease amyloid fibrils in rat brain, J. Neurosci. 17 (1997) 8187–8193. [11] D.J. Selkoe, The molecular pathology of Alzheimer’s disease, Neuron 6 (1991) 487–498. [12] D.J. Selkoe, Alzheimer’s disease: genes, proteins, and therapy, Physiol. Rev. 81 (2001) 741–766. [13] D.B. Teplow, Structural and kinetic features of amyloid beta-protein fibrillogenesis, Amyloid 5 (1998) 121–142. [14] M.T. Pastor, N. Kummerer, V. Schubert, A. Esteras-Chopo, C.G. Dotti, M. Lopez de la Paz, L. Serrano, Amyloid toxicity is independent of polypeptide sequence, length and chirality, J. Mol. Biol. 375 (2008) 695–707. [15] D.M. Walsh, E. Thulin, A.M. Minogue, N. Gustavsson, E. Pang, D.B. Teplow, S. Linse, A facile method for expression and purification of the Alzheimer’s disease-associated amyloid beta-peptide, FEBS J. 276 (2009) 1266–1281. [16] S.S. Sisodia, E.H. Koo, K. Beyreuther, A. Unterbeck, D.L. Price, Evidence that beta-amyloid protein in Alzheimer’s disease is not derived by normal processing, Science 248 (1990) 492–495. [17] D.M. Holtzman, In vivo effects of ApoE and clusterin on amyloid-beta metabolism and neuropathology, J. Mol. Neurosci. 23 (2004) 247–254. [18] R. Pellarin, A. Caflisch, Interpreting the aggregation kinetics of amyloid peptides, J. Mol. Biol. 360 (2006) 882–892. [19] M.J. Cannon, A.D. Williams, R. Wetzel, D.G. Myszka, Kinetic analysis of betaamyloid fibril elongation, Anal. Biochem. 328 (2004) 67–75. [20] Y. Fezoui, D.B. Teplow, Kinetic studies of amyloid beta-protein fibril assembly. Differential effects of alpha-helix stabilization, J. Biol. Chem. 277 (2002) 36948–36954. [21] J.D. Harper, S.S. Wong, C.M. Lieber, P.T. Lansbury Jr., Assembly of A beta amyloid protofibrils: an in vitro model for a possible early event in Alzheimer’s disease, Biochemistry 38 (1999) 8972–8980. [22] M.M. Pallitto, R.M. Murphy, A mathematical model of the kinetics of beta-amyloid fibril growth from the denatured state, Biophys. J. 81 (2001) 1805–1822. [23] C.M. Yip, J. McLaurin, Amyloid-beta peptide assembly: a critical step in fibrillogenesis and membrane disruption, Biophys. J. 80 (2001) 1359–1371. [24] B. Yazmin, Y. Ahmad Ramli Mohd, M. Tengku Sifzizul Tengku, S.-C. Alexander Chong, A. Amirul Al-Ashraf, N. Mohd Azizan Mohd, A. Yahya Mat, PCR assembly of synthetic human erythropoietin gene, Electron. J. Biotechnol. 12 (2009) 3, http://dx.doi.org/10.2225/vol12-issue3-fulltext-2. [25] G. Chhetri, A. Ghosh, R. Chinta, S. Akhtar, T. Tripathi, Cloning, soluble expression, and purification of the RNA polymerase II subunit RPB5 from Saccharomyces cerevisiae, Bioengineered 6 (1) (2015) 1–5. [26] G. Chhetri, T. Pandey, B. Kumar, M.S. Akhtar, T. Tripathi, Recombinant expression, purification and preliminary characterization of the mRNA export factor MEX67 of Saccharomyces cerevisiae, Protein Expr. Purif. 107 (2015) 56–61.

[27] J.W. Kelly, Mechanisms of amyloidogenesis, Nat. Struct. Biol. 7 (2000) 824–826. [28] J.F. Barroso, M. Elholm, T. Flatmark, Tight binding of deoxyribonucleotide triphosphates to human thymidine kinase 2 expressed in Escherichia coli. Purification and partial characterization of its dimeric and tetrameric forms, Biochemistry 42 (2003) 15158–15169. [29] J.G. Thomas, F. Baneyx, Protein misfolding and inclusion body formation in recombinant Escherichia coli cells overexpressing Heat-shock proteins, J. Biol. Chem. 271 (1996) 11141–11147. [30] C. Huang Jr., H. Lin, X. Yang, Industrial production of recombinant therapeutics in Escherichia coli and its recent advancements, J. Ind. Microbiol. Biotechnol. 39 (3) (2012) 383–399. [31] V. Babaeipour, S. Shojaosadati, R. Khalilzadeh, N. Maghsoudi, A. Farnoud, Enhancement of human c-Interferon production in recombinant E. coli using batch cultivation, Appl. Biochem. Biotechnol. 160 (2010) 2366–2376. [32] H. Nausch, J. Huckauf, R. Koslowski, U. Meyer, I. Broer, et al., Recombinant production of human interleukin 6 in Escherichia coli, PLoS ONE 8 (1) (2013) e54933, http://dx.doi.org/10.1371/journal.pone.0054933. [33] D.S. Waugh, Making the most of affinity tags, Trends Biotechnol. 23 (2005) 316–320. [34] J.V. Frangioni, B.G. Neel, Solubilization and purification of enzymatically active glutathione S-transferase (pGEX) fusion proteins, Anal. Biochem. 210 (1993) 179–187. [35] A. Schrodel, A. de Marco, Characterization of the aggregates formed during recombinant protein expression in bacteria, BMC Biochem. 6 (2005) 10. [36] M. Fang, W. Wang, Y. Wang, B. Ru, Bacterial expression and purification of biologically active human TFF3, Peptides 25 (2004) 785–792. [37] D.A. Mitchell, T.K. Marshall, R.J. Deschenes, Vectors for the inducible overexpression of glutathione S-transferase fusion proteins in yeast, Yeast 9 (1993) 715–722. [38] A.A. Rodal, M. Duncan, D. Drubin, Purification of glutathione S-transferase fusion proteins from yeast, Methods Enzymol. 351 (2002) 168–172. [39] C.P. Song, D.W. Galbraith, AtSAP18, an orthologue of human SAP18, is involved in the regulation of salt stress and mediates transcriptional repression in Arabidopsis, Plant Mol. Biol. 60 (2006) 241–257. [40] N. Zhang, Z. Qiao, Z. Liang, B. Mei, Z. Xu, R. Song, Zea mays Taxilin protein negatively regulates opaque-2 transcriptional activity by causing a change in its sub-cellular distribution, PLoS ONE 7 (2012) e43822. [41] X. Bao, W. Zhang, R. Krencik, H. Deng, Y. Wang, J. Girton, J. Johansen, K.M. Johansen, The JIL-1 kinase interacts with lamin Dm0 and regulates nuclear lamina morphology of Drosophila nurse cells, J. Cell Sci. 118 (2005) 5079–5087. [42] A. Wong, S.N. Albright, M.F. Wolfner, Evidence for structural constraint on ovulin, a rapidly evolving Drosophila melanogaster seminal protein, Proc. Natl. Acad. Sci. U.S.A. 103 (2006) 18644–18649. [43] F. Rudert, E. Visser, G. Gradl, P. Grandison, L. Shemshedini, Y. Wang, A. Grierson, J. Watson, PLEF, a novel vector for expression of glutathione Stransferase fusion proteins in mammalian cells, Gene 169 (1996) 281–282. [44] R.B. Thomson, T. Wang, B.R. Thomson, L. Tarrats, A. Girardi, S. Mentone, M. Soleimani, O. Kocher, P.S. Aronson, Role of PDZK1 in membrane expression of renal brush border ion exchangers, Proc. Natl. Acad. Sci. U.S.A. 102 (2005) 13331–13336. [45] L. Zhang, H. Yu, C. Song, X. Lin, B. Chen, C. Tan, G. Cao, Z. Wang, Expression, purification, and characterization of recombinant human beta-amyloid42 peptide in Escherichia coli, Protein Expr. Purif. 64 (2009) 55–62. [46] E.K. Lee, J.H. Hwang, D.Y. Shin, D.I. Kim, Y.J. Yoo, Production of recombinant amyloid-beta peptide 42 as an ubiquitin extension, Protein Expr. Purif. 40 (2005) 183–189. [47] A.K. Tickler, C.J. Barrow, J.D. Wade, Improved preparation of amyloid-beta peptides using DBU as Nalpha-Fmoc deprotection reagent, J. Pept. Sci. 7 (2001) 488–494. [48] M. Zarandi, K. Soos, L. Fulop, Z. Bozso, Z. Datki, G.K. Toth, B. Penke, Synthesis of Abeta[1–42] and its derivatives with improved efficiency, J. Pept. Sci. 13 (2007) 94–99.