DEVELOPMENTAL

BIOLOGY

150,306-318 (1992)

An Ecdysteroid-Inducible Manduca Gene Similar to the Drosophila DHR3 Gene, A Member of the Steroid Hormone Receptor Superfamily SUBBA REDDY PALLI, KIYOSHI HIRUMA, AND LYNN M. RIDDIFORD Department of Zoobgg, University of Washington, Seattle, Washington 98195

Accepted December 27, 1991

Using cDNAs for the human retinoic acid receptor (Y(hRARa) and Drosophila hormone receptor 3 (DHR3), we isolated a cDNA encoding a member of the steroid hormone receptor superfamily from the tobacco hornworm, Manduca se&a. Sequencing showed that this cDNA is most closely related to DHR3 (97 and 68% amino acid identity in the DNA and ligand binding regions, respectively) followed by hRARa (65 and 20% identity, respectively) and therefore is named MHR3. The cDNA hybridized to two mRNAs (3.8 and 4.5 kb) found in the epidermis during the ecdysteroid rises for the embryonic, larval, and pupal molts. Culture of fourth instar larval epidermis with 4 pM 20-hydroxyecdysone (2 pg/ml 20HE) caused the appearance of MHR3 mRNA within 3 hr and maximal expression by 6 hr; after 12 hr continuous exposure to 20HE, the mRNA level declined. The 4.5-kb mRNA appeared first, both were present in equal amounts by 12 hr, and by 20 hr the predominant transcript was 3.8 kb. Similar 20HE-induced expression was seen in epidermis explanted 1 day after the onset of wandering, although with a slower time course. The induction was largely independent of protein synthesis, but the subsequent decline required protein synthesis as is typical of the “early” puffs in Drosophila. Continuous exposure to 20HE was necessary for MHR3 expression; in its absence, the mRNA declined with a half-life of 2 hr. Thus, MHR3 is an ecdysteroid-inducible DNA binding protein that likely is a transcription factor involved in the . . cascade of gene activation and mactivation caused by ecdysteroids during the insect molt. o 1992 Academic PRSS. I~C. INTRODUCTION

Postembryonic development in insects consists of growth punctuated by a series of molts followed by metamorphosis. These molts are initiated and coordinated by the steroid hormone 20-hydroxyecdysone (20HE) and related ecdysteroids (Riddiford, 1985). Ecdysteroids act directly on genes to initiate transcription as first shown by Clever and Karlson (1960) with the induction of specific puffs in the salivary gland chromosomes of Chirmemus tentans. This action then causes a cascade of cellular events that result in the molt, some of which are dependent on the presence of ecdysteroids and others which are not. On the basis of studies of the puffing cascade in Drosophila rnelanogaster salivary gland chromosomes, Ashburner et al. (1974) postulated that the ecdysteroid-receptor complex acted to induce certain “early” genes whose proteins subsequently induced transcription of the “late” genes and suppressed transcription of the early genes. Moreover, the ecdysteroid-receptor complex was thought to suppress transcription of the late genes. Recently, three of the early genes have been cloned and found to encode various types of transcription factors (Burtis et ah, 1990; Segraves and Hogness, 1990; Thummel et ah, 1990; DiBello et al, 1991) which can be found at sites of the late puffs (Urness and Thummel,

306

0012-1606/92 $3.00 Copyright

0 1992 by Academic

All rights of reproduction

1990) or shown to be essential for transcription of late genes (Guay and Guild, 1991). The ecdysteroid receptor (EcR) of D. melanogaster (Koelle et aZ., 1991) is a member of the steroid hormone receptor superfamily typified by a set of two “zinc fingers” in the DNA binding domain (Evans, 1988; Schwabe et al, 1990) and binds to early and late puff sites on polytene chromosomes (W. S. Talbot and D. S. Hogness, unpublished as cited in Koelle et al, 1991). It also binds to a putative ecdysteroid response element (Riddihough and Pelham, 1987) of the ecdysteroid-induced small heat shock protein (hsp) 2’7 gene. A similar element has been shown to be necessary and sufficient for ecdysteroid induction of the ecdysoneinduced protein 28/29 (Cherbas et aL, 1991) and two other small heat shock proteins (Dobens et aL, 1991; Ozyhar et aL, 1991). Juvenile hormone (JH), a sesquiterpene, determines the type of molt and prevents metamorphosis (Riddiford, 1985). The presence of a nuclear JH receptor (Palli et al., 1990) and the weak JH activity of certain retinoids (Palli et aL, 1991) led to the use of the human retinoic acid receptor (Y(hRARcY; Petkovitch et aL, 1987) cDNA in an attempt to isolate a JH receptor gene from the tobacco hornworm (Manduca se&a) (Palli et aL, 1991). A genomic clone with a region that showed 13 of 14 amino acid identity with the C-terminal half of the second zinc finger of hRARa was found. Preliminary experiments

Press. Inc.

in any form reserved.

PALLI,

HIRUMA,

AND RIDDIFORD

showed that this gene was expressed during the molting rises of ecdysteroid and that its expression could be induced by 20HE. In this paper we show that the corresponding cDNA encodes a member of the steroid hormone receptor superfamily that is most similar to the Drosophila hormone receptor 3 (DHR3) (Koelle et ah, 1992). This first non-Drosophda insect member of the steroid hormone receptor superfamily is directly induced in Munduca epidermis by 20HE in a manner analogous to that of the early genes in Drosophila salivary glands (Ashburner et ah, 1974). In the continuous presence of 20HE, Manduca hormone receptor 3 (MHR3) mRNA increases and then decreases to a low level. Induction is independent of protein synthesis but the subsequent decline in expression requires protein synthesis. MATERIALS

Experimental

AND

METHODS

Animals

M. sexta larvae were reared on an artificial diet following the procedure described by Bell and Joachim (1976) in a 12:12 hr lightdark photoperiod at 255°C. Under these conditions, Manduca feeds, grows, and molts four times as a larva and then forms a pupa and subsequently an adult. The fourth instar larval stage lasts for 4 (Gate I; Truman, 1972) or 5 (Gate II) days. After ecdysis to the fifth instar, the larva grows for 4 (Gate I) or 5 (Gate II) days and then begins to wander in search of a pupation site. Four days later it forms a pupa. Animals were selected at the time of ecdysis to the fourth and fifth instar larval stage and individually staged by weight and various morphological markers (Truman, 1972; Truman and Riddiford, 1974; Curtis et al, 1984). Dissection and Culture For RNA isolation, the dorsal abdominal integument was dissected and cleaned of fat body and most muscles (Riddiford et al, 1979). For culture experiments the integument thus prepared was cut into pieces (3 x 7 mm for the fourth stage and 6 X 16 mm for the fifth); these were then cultured on the surface of 0.5 ml Grace’s medium (GIBCO) per culture well (Linbro trays, Flow Laboratories) at 25.5”C in a 95% O,-5% CO2 atmosphere on a slow rotary shaker (Hiruma and Riddiford, 1984). Hormone and inhibitor solutions were prepared as described in Hiruma et d (1991). Protein synthesis studies were done as described in Hiruma et al. (1991). RNA Isolation Total epidermal RNA was isolated by the guanidineHCl method of Cheley and Anderson (1984) and purified further by ethanol precipitation. The RNA concentra-

ikfamduca Hormone Receptor 3

307

tions were determined spectrophotometrically (Davis et al, 1986). Oligo(dT)-cellulose (Collaborative Research) chromatography (Aviv and Leder, 1972) was used to select poly(A)+ RNA. cDNA Library

Construction

Five micrograms of poly(A)+ RNA was isolated from the dorsal abdominal epidermis of a larva at the head capsule slippage (HCS) stage during the molt to the fifth instar and used to construct a cDNA library. For synthesis of the cDNA, the Gubler and Hoffman (1983) method was followed with the modification given in the Uni-ZAP cDNA cloning kit (Stratagene). The cDNA was size-selected for inserts > 1 kb by Sepharose CL-4B column chromatography. After digesting with XhoI, the cDNA was ligated to EcoRI-XhoI-digested Uni-ZAP (Stratagene) arms and packaged with Gigapack gold packaging extract (Stratagene). Five micrograms of poly(A)+ RNA yielded one million plaques. All 20 plaques tested were recombinants, indicating 100% recombinants in the library. The library was amplified in Escherichia coli strain PLK-F’ (Stratagene). cDNA Library

Screening

The amplified cDNA library was plated in E. coli strain XL1 Blue (Stratagene) at about 50,000 plaques per 150-mm petri dish and transferred to nitrocellulose (Benton and Davis, 1977). The filters were baked at 80°C for 2 hr and prehybridized at 37°C overnight in 5x SSC (IX SSC: 0.15 M NaCl, 0.015 M Na citrate), 10x Denhardt’s (Denhardt, 1966), 50 mlM sodium phosphate (pH 7.0), 40% formamide (v/v), and 250 pg/ml herring sperm DNA. Hybridizations were carried out in a fresh aliquot of the above solution containing 10% dextran sulfate and lo6 dpm/ml 32P-labelecl probe for 48 hr at 37°C. Filters were washed at 55°C for 60 min with three changes of 2x SSC and 0.1% SDS followed by 20 min each in lx SSC, 0.1% SDS and 0.5~ SSC, 0.1% SDS. Northern

and Dot-Blot

Hybridizaticuns

Ten micrograms of total RNA was separated on a formaldehyde-agarose (1%) gel and transferred to a Hybond N nylon membrane (Amersham; Lehrach et ah, 1977). For clot-blots, 3-10 pg of total RNA was denatured and spotted onto a Hybond N nylon membrane (Kafatos et ak, 1979). Either a 1.7- or a 0.9-kb fragment of the genomic clone that hybridized to the hRARa cDNA or a cDNA (3.5 or 3.7 kb) was used as a probe. The DNA was 32P-labeled by a random prime labeling method (Feinberg and Vogelstein, 1984). Hybridization and washes were performed as described in Horodyski et al. (1989). Quantitative analysis was clone by clensitometric scan-

308

DEVELOPMENTAL

BIOLOGY

ning using a quick scan R&D (Helena Laboratories). Total RNA isolated from the HCS stage was used as a standard and was loaded on each dot-blot. In vitro Transcription

Clone

cDNA

Clone

0.2Kb H

and Sequence Analysis

The cDNA in Bluescript (Stratagene) was sequenced from both directions by generating a series of subclones by the exonuclease III digestion method (Henikoff, 1984). Single-stranded DNA was isolated and sequenced by the dideoxy chain termination method (Sanger et ah, 197’7) using [35S]dATP (>lOOO Ci/mmole, Amersham) (Biggin et aL, 1983) and the enzyme Sequenase (U.S. Biochemical) (Tabor and Richardson, 1987). The Pustell DNA programs (International Biotechnologies, Inc.) (Pustell and Kafatos, 1984) were used for sequence analysis. Sequences in Genbank were searched by the FASTA method (Pearson and Lipman, 1988). RESULTS

Isolation

Genomic

150,1992

and Translation

In vitro transcription and translation were performed as described in Riddiford et al. (1990). Sequencing

VOLUME

of MHR3

cDNA

Initial screening of the Manduca genomic library with the hRARa cDNA yielded a genomic clone that contained a 1.7-kb SalI-Sal1 fragment with a region of high deduced amino acid sequence similarity to the second zinc finger of hRARa (Palli et al, 1991). Preliminary Northern and dot-blot hybridization analyses using dorsal abdominal epidermal RNA showed that this gene was expressed mainly during the molting rises of ecdysteroid during the last larval and the pupal molts. Based on these studies, a cDNA library was constructed in Uni-ZAP (Stratagene) using abdominal epidermal RNA isolated from fourth instar larvae at the time of HCS (29 hr before ecdysis to the fifth instar) during the larval molt. About a million plaques from the amplified cDNA library were screened using the 1.7-kb genomic fragment, but no hybridizing clones were obtained. We then probed a Southern blot containing three Drosophila members of the steroid hormone receptor superfamily (EcR, Koelle et al, 1991; E75B, Segraves and Hogness, 1990, DHR3, Koelle et aZ., 1992; a gift from M. Koelle and D. Hogness) with the 1.7-kb (SaZI-SaZI) genomic fragment and found that it hybridized only to DHR3. Using the DHR3 cDNA (a gift from M. Koelle and D. Hogness) as a probe, we isolated one positive clone through screening 300,000 amplified cDNA plaques. This clone had an insert of 3.5 kb. Twelve additional clones were obtained by using a 0.5-kb fragment near the 5’ end of the 3.5-kb cDNA as a probe. Two of

FIG. 1. Restriction maps of genomic and cDNA clones of MHRt The two exons identified in the genomic clone are shown as black boxes and denoted as zinc fingers I and II. The arrows denote the 1.7-kb &.+!I-SuZI fragment.

those had inserts of 3.7 kb; the others had inserts of 3.5 kb. Figure 1 shows the relationship between the genomic clone and the sequenced 3.7-kb cDNA clone. Hybridization of the 1.7-kb SalI-SuZI genomic fragment with this cDNA revealed that the fragment contained the DNA binding region composed of two exons separated by an intron of 365 bp (Fig. 1; see below). Further mapping of the genomic clone with the cDNA shows no hybridization except for the 1.4-kb SaZI-SaZI fragment adjacent to the 1.7-kb fragment at the 3’ end of the genomic clone. This 3.7-kb cDNA clone was sequenced from both directions and consisted of 3612 bp with a poly(A) tail at the 3’ end (Fig. 2). This sequence showed 100% nucleotide identity with the two exons contained within the 1.7-kb genomic fragment. The longest open reading frame (ORF) is 548 codons. In addition to the AUG at the start of this ORF, there are more AUGs at codons 28, 34, and 38. Although there is not a perfect match with the vertebrate consensus sequence flanking the translational start site (Kozak, 1984), there are several Drosophila genes which have similar sequences upstream from the translational start site (Cavener, 1987). The 548-codon ORF predicts a 61.5-kDa protein. In vitro transcription of RNA from MHR3 cDNA followed by in vitro translation yielded a protein of 63 kDa as determined by SDS-polyacrylamide gel electrophoresis (data not shown), indicating that this is probably the ORF used. Preceding this ORF is a Ill-bp AT-rich region which has several small ORFs, the longest being 9 codons starting with AUG. Following the long ORF, there is an 1854-bp AT-rich region ending in a poly(A) tail. There is an AATAAA polyadenylation signal (Proudfoot, 1990) 17 bp upstream to the poly(A) tail. The predicted amino acid sequence of this cDNA was compared to the sequences in the Genbank (Pearson and Lipman, 1988) and also to the known individual

1

CCGCAATCCGAATTCGATTCGCTCAAGATAATCACTCGCCCAAAATAACTTGAATTTATAAAAAAATAAAAT

AAAAAATAMAACTTTTTTCGGATTTGAATTTCC2.ACG

121

MT

CAG

TTC cm

GAG

CTT TTC GGG TCT GAG TGG CCG cm

GAC

cia

wit

CAC

TCG TCT GCG TCC

Am

Gin

Phe His

Gl"

Leu

Asp

Gln

HIS Gdy Gly

His

Se= Se= Ala

Se= Thr Met

Le"

CCA

CAG

ACC

ATG

CAG

CTG MG

AGA

ATG

Thr

Met

Gln

LB"

Lys

Arg

214

Pro Gin 307

400

493

586

679

772

865

950

1051

1144

1237

1330

1423

1516

1609

1702

GAC AGT ACG TCA CCA Asp

Phe Gly

Ser

Gln

GGT GGT

Pro

Pro

GAA CCA CAC

ACG

GAG GT-T GGA GTC ATG

Glu

Pm

Thr

Glu

"al

Trp

His

Gly

CAT

MC

CM

ATG

CGT

Val

Mat

His

As"

Gl"

Met

Gly Met

CCA

CCA

‘XC

AK

AGC GAG GGA

ATG

TTC GGC

CCT

ATA

TCT GGC ATG TTC

Ser

Thr

Se= Pro

Pro

Pro

Gly

SE‘

Ser G1" Gly

"et

Phe Gly

Pro

Ile

Ser Gly

AAA GTT TGC GGC CAC AAG TCG TCC GGC GTG

Met

Cvs LVS

TTC

AGG

CGT

TCG

CAG

AGC

ACA

GTG GTG MC

TAC CAG TGC CCG CCC MC

AA0 GCC TGT GTG GTG

Phe

Ara

Am

Ser Gin

Ser

Thr

Val

TYT Gln

L"B

KG Ala

CAA ATG AW Cl" Het Arg

CCC CA-2 MT Ala Cl,, Aan

ATG

CAC

TAT

Gffi

GTG

ATC

AWL

TGC

His

Tvr

Glv

Val

Ile

Thr

CYS Glu

GAC

‘XC

GTC MC

CGC MC

AGA TGC

As0

Ara

Val

Ara

Ara

C"‘

Val

GTC AAA TTC GGT 'XC Val Lys Phs Gly Arg

Ala

GAG GGC TGC AAA GGA TTC

TGC

GTG CGG TAC CAC AM Val ~rg Tyr His Lys

6~1 Val

Ser

Pro

GM ~1"

Gly

TCT ATT AGA

CCG

TGC CGC CTG CAG AAG TGC CTC AAA CTC GGC ATG AGC CGT GAT GCG CYS Am LB" Gin LYS CYS Le" LYS Le" Gl" "et Sex ArG Asp Ala

TCA GTC GCT

Ser

MC

Ile

Ala

TCA G'X

Thr

Asp

ATA

As,,

ACG

Ile

GCT

Ile

CYS Pro Ara

ATC

Ala

ATA

As”

GAC Asp

GCT

Gl"

Val

Thr Met

Ala

GAG

Val

Gln

Lys

Ile

SOT Cl"

Gln

Lys

ATC

LVS Ser

His

Val

Asn

ATG TCA AAG AAA CM Met .Ser Lya Lys Gl"

CAT CCC CCC WA ‘ZAC TCG GTG TM Asp Ala Ala Pro Asp Ser Val Tyr

GAC GCA CAG CAC Ala Gin Cln

Asp

Gl"

AS”

CGT GM Arg Glu

Ile

CYO LYS Gl"

Arg

Phe

CAG

TAC

C"B Gln

T"r

CCG

Thr

Pro

CAT

GGT

CAT TAC MT

G'ZA

TAC

CCT GGG TAC GCG TCG CC0 CTG TCG TCG TAC GGC TAC MC

MC

GCC GGC CCG CCG CTC ACT

TCC

Gly

His

Gly

Tyr

Pro

Asn

Ala

Ser

ARC

ATG

AGC

AGC

ATC

CM

As,, "et

Ser

Ser

11-e Gl"

SBI

Tyr

Gly

Tyr

Asn

Gln

CAG

GCT

CAG

CAG

CCG

TAC GAC TAC GCA GAC TCC ACC ACC ACC TAC GAG CCC AAG CAG CCG GGC TAC

Gln

Ala

Gln

Gin

Pro

Tyr

Gly

Gin

Val

Gl"

Asp

Ile

Asp Tyr

Ala

Asp Ser

AAA GTC CTT GTG MC

Ser Lys

Val

LB" Val

Lys

Thr

Thf

Thr

ALGT

CTG GCG GM

Ser

LB" Ala

Tyr

Gl"

Pro

His

Ala

GAG

TALC ATA MC

GAG

ATC

TTC ACT AAA CC'2 CRC GAC GTT TCC AAG CTG TTG TTC TAC AAC TCG ATG

ACG

TAC GAG

Tvr

Glu

"et

Phe Ser

Thr

T"r

LYE Pro

Gln

Aso

“al

Ser

LVS Leu

Leu

Phe TW As"

Ser "et

Lys

CGG CAC GCG AAC

G1" ArG

Gl"

Asn GAG

G1" Glu

Gln

Pro Gly

Tyr

ACA

AAT

AAA

Thr

Asn Pro E

ATG

TGG

Met Tm

TGC GCC

GAC

AA-2 CTG ACA GCG

ATC

ATA CAG MC

ATC ATA GM

TTC CCC AAA CTC ATA CCA GGG TTC ATG AAG CTT

ACG

CAA GAT

CJYS

Am

LYS La"

,4et

Ile

Ile

Phe Ala

Thr

Gin

Thr

Ala

CTG CTG TTA AAG TCA GGA TCG TTT GAG Leu Leu Leu L"s Ser Cl" Ser Phe Glu

Gln

AS”

Ile

Glu

GTA

CTG

CCA ATT

AWL

GM

TGT GTT CAT GCD CGT

GAC

CCG CCC GAT

LB"

Pro

Ile

An,

Glu

C"8

Val

ASD

Pro

Am

CTC AAG CTT

ACT

GAG TCT

GAG

TTG GCG TTA TAT CM

AK

TTA

Leu

Thr

Gl"

Gl"

Le"

Par LB"

TGT CTA TTC MC CYS Le" Phe As"

Ser

His

Ala

LYS Le"

Ile

Pro

Cl!,

Phs "et

CTT GCC ATC GTG CGT TTG TCG CGG CTG ATC GAC GTC MC Leu Ala Ile Val Arc, Le" Ser Am Le" Ile Am Val Am

Val

LYS Leu

Ala

La"

ATG TCA ATG TCG GCG ATG Het Ser Met Se1 Ala "et

Am

Tyr

Gl"

GAG

CTA

GTT TCG GGT

ATA

TTT

Leu

Val

Ile

Phe GlU Ala

GTG

CTG

CTT TGG CCA GM

CGT CAC GGT

Val

Le"

La"

Am

CGT CAT GAG ATT GM Am His Glu Ile Glu

Tm

Pro

GCG AAC

CAC

Ala

His

Am

Gl"

His

CAT

TTG

GGA

GCT

CTG

AGC

CGC

TTC

AA.3

His

Le"

Glv

Ala

Le"

Ser Arq

Phe

LYS Net

GCT CTT TAT AAG GAA CTG TTC TCT TTA GAC

AGT

GTT CTT GAT TAC ACA

Ala

Ser Val

Leu

T"r

LYB Glu

Le"

Phe Ser LB"

Le"

Asp

Leu Asp

Tyr

CAC

Thr His

ACG

GAG ATT CGA

Thr

Gl"

ATG

Ile

437

CCA

ATG

Gl"

AAC

Arq

499

"et

Ara

GGT

Met G1" Asn

Ala

CTT Le"

CTG

Phe

LVb Se= Ile

GCG CCT TTG AAA GGC GAT GTC ACA GTG TTG GAC ACG Ala Pro Le" LYS Gl" AQD Val Thr Val Le" ASD Thr

be"

Thr

ATC

Ala

468

TCA

Pro

GCC GCG AA-2 AGC ATT GCG CGA

Arq

Ser

Ila

GTA

GlV Val

CTT GCG AAG ATA CCC ACC TTC AGG GAA CTT Lw

ATT

406

Ala

Glv

CAG

344

GAG 'ZAG GTG TTA TAC GCA GAT GTG Glu Gin Val Le" TYT GlV Asp Val

CCC

Ser

GAC

Leu AS,J

ASD AS,, Gin

313

Am

ASD Met

ATG

GAT

CTC

282

375

'XC

LYS Lell

CCA

251

Ile

Le"

Ala

Thr

CCA

TTG

Ala

Le"

Pro

LB"

Am

Pro

CAG

Gly

Ile

Pro

Gin

GGC GAC ATC AK

Phe Ile

Ssr

‘XC

LB" Asp

Asp

Le"

Ala

TTG GAC GCT GAC TTT ATT GGC CAG CTA GM Ala

Se= Pro

158

AGC

TTC

Ala

127

220

ACG

Phe His

Tyr

96

TCC AGT SOT SBI Ser

CAG

Gin

Gl”

'Sly

65

1.99

CAT CM

ASI,

34

AAA GTG GAG CAT Lys Val Glu Asp

Asp

Tyr

3

ATG

GAT AAG AAA

Cl"

ASD

CTG CAC CAG CAG ACG

Asp

GCC CM

CYS Cl"

ATG

Pha "et

Ala

Val

~03

ATG MC MC Met Am Am

ACT

CAC

CCA

CAC

CAC

GTA

TTT

Thr

His

Pro

His

"IS

Val

Phe Pro

530

GGA TAA GATTATTTMACTATACAATTCCACGGCTATCTTTTCATTTGCTGGC Gly

---

540

1806

AGTTCGATCTCMCCCTCGGTGACGAGCAACGCMCG~~C~~CCTCTTTA~~CCACTT~TTC~CT-G~ATCTACATCT~GTTMCCTATTTATMTT~TATGTATGTACTCTGA~AC

1929 2052

TGTTAARRTGRTATTTACGTATMGTAC~TAC~TA-TATTM~~TAT-T~~TA~TMTTC-TCTM~TAC~T~A~~T~CT~A~TT~ACATTTA~TGTCA~~TAT~TA CTTTTTGTTACGGTTGTATCTTAATGCGGTTTGAGCGTATGAT~CACTGTTT~CTATATAT-TA~TMTG-CCMTTTTGTT~GTATTATATAT-GGTGTATCGT~TAT~T

2175 2290

TATTULTIVUGTGTATCTMCTTT-T--T~TMTTA~ATTATAT-~TATMTMTA-TA~=TTTTTATT--T-T--=TTAT~CG~T~TA~*=GTA IIAGATCAU\CGTTTCTTGCATATTG-CAGTTTTTT-TAG~CTTT~TTM~AT~TTM~GTTTTTTMGAC-TGTM~TGTTAT~ATTT-TGATTATTATTATTGATG

2421 2544 2667

TTTTGTCTTCAATGTAGTTTTTTTC~TTMGTTGTMTATAGGTMT-CGATACTGCC~TCTATMTATATT~~TTGTMTTT~CG~GT~~GTTGTCACATAG~TGGT-GC GGTATTT~~MTCCATTCACACATC~CC~CAT~TACTGCGGTGGTGT~ TGMTTAACCTCAMGTCATTMGCGCCG~TATT-C-TTA~MTA~~CC-T~TA~~~TA-~T=CCCTTA~TCAT-~ATTC~TT~TT~TTTTACAT

2790 2913

TTTTTGCTTTATATTATTGMTT~A~T~~-T~TA~ACAC~~CGAT~TCA~TTAT~~~CTM~GC~CG~-TAT~CTAC~TTTATACTAGCA GGCIU~TTTGTAGTAGATTlVUTTTGATCTCATTTGTG~CG~TTTC~TT~~GCCATTCG~TATCACAT~~GCATMT~

3036

GTA'PTAG-TWLGTATACGTMTTTTTMTTTTTMTTTTCCGCGTC~CAGCTKTATACGTACTT~~ATTTT~~MTTGCCTT

3159

TTTTCTAACACTT~UGGTCCACTTTTG~~~CG~~~~CCGT~~~TG~ATTC~TTTMGG~~TATCATGT~T~~TGCCAGAC~TACTAT~GCTG~TTCCG~~~~~T~T~G~GG

3282 3405

CCTTTCCGCTC~~ACCGCGGCCTGTACGCTMGTTTGTCGMTA~CTTTATTATA~~~TTTATATTMTGTT-GTATAT-TTCTTMCTTGTATTTTGT-~AGCT~T~TC ATATCTATTTTATATTAIUTATTATMGGDT CAAATTTTCCACATCGGCTCACGAGATTTGAATCTT

3528

TTGATCTTGTCT-TATTGTTTTTTTT-CCTTATCTATATA~ATATATTTTTT~TT~

CAATCTG;TATTGTCT

TGAACACAATTAAATGCATAATGTGTT

(A, n

FIG. 2. The DNA and predicted amino acid sequences of the MHR3 cDNA clone. Nucleotide numbers are on the left and the amino acid numbers are on the right. DNA binding and ligand binding regions determined by amino acid identity to the members of the steroid hormone receptor superfamily are bold and single underlined, respectively. The polyadenylation sequences are in bold type. 309

310

DEVELOPMENTAL BIOLOGY

VOLUME 150,1992 % Identity

a MER3 DKR3 ma

EISA SF &PAR ECR [email protected] hKR hMR hVDR

b Mm3 313 DHR3 255 hRARa 170 El5A =T 2c d?PAR ECR

hTRB MR hm hvDR

E75A -T 2c

&PAR ECR h'JR8 hER hm

............................ .F..Q.....Y....SA .R.....A..F....HS .V........K...QF

..S..--........Q

97

........................

.. ..IQKNM--V.T.E.D.N.IINK.T............FKV ......... ..IQQKI-QYKP.TR.QQ.SIL.I..........K..IAV .... ..S..K..VKKNL--T.S.RGSRN.PI.QNN..Q......K....M S ...... ..K.TVKKnL--T.A.RE.NN.II.KRQ........Y....TC .......

.SI...RA..K....Y .RI .. ..A..Y....RA..........TIRLKL-VYDK.D.--S.KIQ~...K.....FE...SV

.L....RA..Y..NAL .......... ..VTKSA--V.C.WGR..KM.MYM.RK..E...K...AV .V ..... AT.Y..R C .......... ..TIQKNLRPS.S.KYKGK..I.K.T..Q..E..FK..1YV .A..N.YA..Y....W S ... ..A..K..IQGKN--D.M..ATNQ.TI.KNR.KS..A...R..YKV .L....KA ..c .. ..V..GS..V..K.AVEGQH--..L.AGRNI).II.KIR.KN.PA.......QA .G .... RAT.F.6-NAI.l .......... ..MKRRA--LFT..F.GD.RITKD..RK..A...KR.VDI

****

l ***

l

***

l **

+

.. .. .. ..

65 62 61 58

.. .. .. .. .. ..

56 56 56 52 52 50

l

t

360 311

RLIDVNRBQVLYGDVVLPIR,ZCVURDPRDHALV--------------CU)~T~QUIIEI?~~~TQDDQI~G~~ . ..AVBD..R.QP...RI.Y.XNLGQ..L.....E...Q... . . . . . . ..L....R.S.........T.........Y...L.LSQUA......M..QB1FYTS-.SBB.R..--------------PALCQLGXYTTNNSSBQRVSLDIDL----.DKFSELS.KC.IKTV. . ..QL...TT..IA...T.I.AACLDIL.L.ICTE~~S.GL~.--Z~~~.T--------------QRAI'JCPSY.N.TLLACP.NPAPEMS.QF3SQWAEVIRGF.-D.&M . . ..QL.....~T...A.L.DAtP...ICI(G.SSRISIICL.D-~~~~..--------------YISLIJUZAR-.YPT.RYGQCWPRNlXZIDNICJ&MRUF SAV.W. .I. .P.PE.QVT. .',A. .RLVWS..FVLNA.pCSNPLHVAF.LAMG.EASPMAAD.V-VAPNDE---------------

249 244 431 236 315 737 198

RA.T~GDR.LTFLWGPYSTVQPD.KGAVSALCQVVNKQUWV.Y.RH4.E.AQVPL...VI...AAWI..L .ANVAWSI.SLDDGGG.GGGGLGEDGSBB.RSPGLQPQULNQSFSY8RNSAI mpCDI)&-----------~TLCMAEKTLVMMVAN ~~~~C.PQ~SVE~LT....A....~.D~..VT...Y.VY.~~..S.~~..NOPIT-.. NED----------QDG.RPPSBBDtRR~PPDB.ESOTDVS~I~ITILT.L.V....G..A.T.IP.E...T...PIC.S.~.WA.RY.ESSDS~~~.DS~. P~PLPBDI~.IVNAOBCC-~~S~--TKII.PA.~~...IIL.M.~.PCE......OC~.~L.MV.Y.PBS.~~~V..G--PLIWffiLCWS---------------~ALLD-~.ILY.EYOPRIPPS~.~~~L~.~..RV...M..~..VB..RCUIL.I~G.V~~.F~~..D.N~C---VECMVEIBDN----------~-EQsA.~B---------------SPVW'JL .NEPEIWAGYDSSFJD .A.NLLSTQblIQWKH..VL...RN.PIs... T.IQYSMW.SSFA..MRSYKiTNSQFLYFAPDL DSSSFSIILDLSgE.SDDPSVTLBLSPLS.LPIIL..L~YS..~.G...N....RD..SB...V....S~.~.SNBSPTD~~.NQD~.VSD~ES~.I---------------

KLEYIwEwFSKeQDVSKLLFYwsMT~

l

lmt3 DEP.3 hRARa

104 51 5s 245 200 104 102 264 102 185 603 24

l

l

l

l

*

--------SGIP-PsMXSITESELALYQSLVLL”PER,IGVWGW~IRCLVSWSWS~

--------.R..-QT.....B.....T...............N..R.....PR...L..N.I.Q.L.T............--------DLV.-AF.NQLLP.EMDDA.TG.LsUC.ICGD.QDLBQPDRVDN.QRPL,Z.UWVRKRR-

**

**

l

l

*

l

IEMFIAPLICQDVTVL-DTLLAKIPTFREUW RVlWTEPWEVPFALYKE----LPS . . ..NN..N..DI.IL.MBS..X..LQ..NV........----... .--SRPSMZ-PIW.N..TDL.SI.~VITL..BI.GSW.-.IQ.N---.PN

--------NLTDA.-IGLBC.I.PDRPCLRN.B.IBIOF--------.---------..B~.DL.T..TL.TB-----.L----V..RTEfl..----.LR ------VSAIFDRILSRLSV.RL"LDRBZLSC.XAIILYNPDIR.~ IXH33KWACLD.ECRUlZP..DGWAQL..R-L.AL.SI..KCQDE.BL.RI.SDRI'L-.FL.QLEAPPP KAGLLATS .m .1[SII.LNSCVYTB.SSTLXSLEBKDR.SRVLDKITDTLI .LMAKAGLT.QQQHQR.AQL..-ILSEI.XM.NKGMU.YSM.CENVWLYD-.L&.MLDARR5 --------gPX.~.N.RI.Ig.DDSDIS-.~ICCGD.P.~I~.~.~G~S..-.DDTFLF.RPK..Q.WDL.Q.“TS.AQL”Q”I.K.ESDAALSP.LQ.-IYSD”Y --------D~-Y.ILT~SD~G.~.LVglY.-----.---------..SIL~L.T.CSL.~--L.~.----~ --------DA..-DIXild.LS~.DDT.V..L.AVL.~SD.P.~.B-IPIQD.~---.~~.~.T~K..N.VTDL.~~.~LSR.~C.TELG.P.BL.---VPgD --------YR..Q.QVEKLKA .RVDSA.YSCUZ.I..BTTDAC.LSDV.E.ES.QEK.QC.LEEYCRTQY-.NQPTWGXL-..RLPSL-.TV.SQVIEQ.FPVRL'K4KT6!IETLIR-DMLLSGNS ---LCQGNRQ.S LQFVRLQTYEEY.XNKVL.LL.TIFI(D-GLKSQAAPE.N.TWYIPS ..mv.----IIS LRK.VTKCPN.SGQSWQR3YQ.T-lt..DSMXDLVSDL.EFCFYTF.ESEALKVW--------PPLI-W~~.N.B.E.g.~.~C~S.D.P..QDIUL.~QD~~LQTY.RCR.P.P.PGS~~-~~~~R~~L~~gC~~.~.----V.C

%

1duvcity 100 68 20 22 16 16 21

18 17 1s 15 20

FIG. 3. Sequence comparison of the conserved DNA binding (C region) (a) and the ligand binding (E region) (h) domains of MHR3 with the members of the steroid hormone receptor superfamily. Sequences shown are: DHR3, Drosophila hormone receptor 3 (Koelle et aL, 1992); hRARa, human retinoic acid receptor (Petkovich et al, 1987); E75A, Drosophila ecdysone-inducible gene (Segraves and Hogness, 1990); svp, Drosophila sewn-up (Mlodzik et aL, 1990); 2C (or usp or CFl), Drosophila steroid receptor homolog (Henrich et aL, 1990; Oro et aL, 1990; Shea et a& 1990); EcR, Drosophila ecdysone receptor (Koelle et aL, 1991); mPPAR, mouse peroxisome proliferator-activated receptor (Isseman and Green, 1990); hTR& human thyroid hormone receptor (Weinberger et ah, 1986); hER, human estrogen receptor (Greene et aL, 1986); hMR, human mineralocorticoid receptor (Arriza et al, 1987); hVDR, human vitamin D receptor (Baker et aL, 1988). Dots ( *) indicate identical amino acids; dashes (-) represent gaps; asterisks (*) are conserved amino acids in most of the members of the superfamily.

members of the steroid hormone receptor superfamily. It was most related to the DHR3 (Koelle et aZ., 1992) with 56% amino acid identity overall (Fig. 3, Table 1). The C (DNA binding) region showed 97% identity (Fig. 3a) and the E (ligand binding) region showed 68% identity (Fig. 3b). Since the sequence shows extensive similarity with DHR3 in all but the A/B region (Table l), we will refer to this gene as MHR3. Amino acid similarity between MHR3 and the other members of the steroid hormone receptor superfamily is limited to two regions, the DNA binding region (C) near the amino terminus (double underlined in Fig. 2) and the ligand binding region (E) near the carboxy terminus (underlined in Fig. 2) (Krust et aZ., 1986). Figure 3a shows the alignment of the deduced amino acid se-

quence of the MHR3 DNA binding region with the most closely related members of the steroid hormone receptor superfamily. After DHR3 the most similar is hRARa at 65% followed by Drosophila members of the steroid hormone receptor superfamily, then mammalian receptors for thyroid hormone, estrogen, mineralocorticoid, and vitamin D, and the mouse peroxisome proliferator-activated receptor. Figure 3b shows the comparison of the deduced amino acid sequence of the MHR3 ligand binding region with the most closely related members of the steroid hormone receptor superfamily. Except for DHR3 at 68% identity, none shows significant similarity except for a few small regions of conservation throughout the family. Comparison with DHR3 shows long stretches of

PALLI,

HIRUMA,

TABLE 1 AMINO ACIDS BETWEEN

bfanduca Hmme

AND RIDDIFORD

Receptor 3

311

identity with the few scattered changes being primarily conservative ones except for one region between 394 and 431 in MHR3 that shows only 47% identity and a few similarities among the changes.

at the onset of HCS during the molt to the fifth instar larva and also in the afternoon of the second day after the onset of wandering (W2) during the molt to the pupa. Ethidium bromide staining showed nearly equal loading of RNA in all lanes (Fig. 4a). Two mRNAs of 3.8 and 4.5 kb were also found in the embryo at 48 and 60% development, a time when the insect is undergoing the embryonic molt (Broadie et ab, 1991) (data not shown). A detailed dot-blot analysis of RNA isolated from epidermis collected at 4- to 12-hr intervals during the fourth and fifth larval instars up to pupal ecdysis showed major peaks of expression during the larval and prepupal molts and a small peak on the day of wandering (Fig. 4b). The two major peaks coincide with the ecdysteroid rises that cause the molt and the minor peak with the small rise that causes the pupal commitment of the epidermis (Riddiford, 1978). MHR3 expression was low during the fourth and fifth larval intermolt periods when no ecdysteroid is present.

Temporal

Induction

COMPARISON

OF DEDUCED

MHR3

AND DHR3

Number of Amino Acids Region’

DHR3

MHR3

% Identity

A/Bb

103

50

9

C

66

66

97.

D E F Total

143 226 10 548

138 225 8 487

54 68 40 56

‘Nomenclature of regions is based on Krust et al. (1986). b The A/B region may not be full length in either MHR3 or DHRS.

Expression

of MHR3

The 3.5-kb MHR3 cDNA was hybridized to a Northern blot containing total epidermal RNA isolated from fourth and fifth larvae and pupae at approximately 24hr intervals beginning at ecdysis to each stage. Two hybridizing mRNAs of 3.8 and 4.5 kb (Fig. 4a) were present

a -1 0

1

2

HCSYMOl

2

3W0

1

by 2OHE

Since the above results showed that MHR3 mRNA was present primarily during the molting rises of ecdysteroid, we asked whether MHR3 mRNA transcription was induced by 20HE. Integument explanted from Day 2 fourth instar larvae before the onset of the ecdysteroid

b

5nl

of MHR3

HCS

Pupa

WlW2TMB

FIG. 4. Developmental expression of MHR3. Ten micrograms of total abdominal epidermal RNA isolated at various times during the fourth and fifth instars and from pupae shortly after ecdysis was analyzed by Northern blot (a) or by dot-blots for quantitative analysis (b) with the MHR3 cDNA as a probe. (a) The top panel shows hybridization with the cDNA. The bottom panel shows ethidium bromide staining of the RNA. The RNA size markers are on the left. (b) The ecdysteroid titer in the top panel is based on Bollenbacher et al. (1981), Curtis et al. (19&Q, Wolfgang and Riddiford (1986), and Kato and Riddiford (1987). Points in bottom panel represent averages of individual RNAs from three to seven animals (*SD). Relative expression was referred to expression in the epidermis at the HCS stage as 10. L4 and L5, fourth and fifth larval instars; PTTH, prothoracicotropic hormone; HCS, time of head capsule slippage, 29 hr before ecdysis; YM, appearance of yellow mandibles, 10 hr before ecdysis; TMB, tanned metathoracic bars (19 hr before pupal ecdysis); WO-W4,O to 4 days after the onset of wandering.

312

VOLUME 150,1%2

DEVELOPMENTALBIOLOGY

307

a

b

n 20HE .g 204 Q) .g 8

3

6

12 20 hr

0 NO hormone _

IO-

0

0

-I-

3

6

Culture time

A-

12

18

24

(hr)

FIG. 5. Induction of MHR3 expression by 20HE. (a) Three micrograms of total RNA from Day 2 fourth instar larval epidermis cultured in Grace’s medium with (m) or without (0) 2 pg/ml20HE for various times was analyzed by dot-blots with the MHR3 cDNA as a probe. Relative expression was determined as described in Fig. 4. Bars represent averages + SD (N = 4-15). (b) Differential induction of the two MHR3 transcripts by 20HE. Ten micrograms of RNA isolated from Day 2 fourth instar epidermis cultured in 2 pg/ml 20HE for various times was analyzed by Northern blot with the MHR3 cDNA as a probe. This is typical of four replicates.

rise was cultured in Grace’s medium alone or with 2 pg/ml 20HE for various times up to 24 hr. Figure 5a shows that MHR3 mRNA was not detected in the fourth instar larval epidermis at the time of explantation or in the same epidermis cultured in Grace’s medium without 20HE up to 24 hr. Exposure to 20HE caused an increase in MHR3 mRNA levels beginning at 3 hr and rising to a maximum by 6 hr. After continuous exposure to 20HE for 12 hr, the mRNA levels declined. Northern hybridization analysis of RNA isolated after various times of 20HE exposure showed that the 4.5-kb mRNA appeared at 3 hr, was maximal by 6 hr, then declined to undetectable levels by 20 hr of 20HE exposure (Fig. 5b). By contrast, the 3%kb mRNA was first seen at 6 hr, was maximal by 12 hr, then declined. Thus, the two transcripts of MHR3 show different time courses of induction and subsequent decline. To determine the minimal concentration of 20HE required for the induction of MHR3 mRNA, we incubated Day 2 fourth instar larval epidermis in varying concentrations of 20HE for 6 hr, then MHR3 RNA was quantified by dot-blot hybridization. A significant induction of expression was first seen with 0.5 pg/ml20HE (1 piI!), and 2-3 pg/ml(4-6 piI!) 20HE caused induction to maximal in wivo levels (cf. Figs. 6 and 4b). This latter concentration is the same as the peak hemolymph ecdysteroid concentration [2-3 pg 20HE equivalents/ml of hemolymph (Curtis et al, 1984)] during the fourth larval molt. To determine whether 20HE has a similar effect on MHR3 transcription at the pupal molt, we explanted integument from fifth instar larvae 1 day after the onset of wandering (Wl) before the prepupal rise of ecdys-

teroid as indicated by ocellar retraction (Truman and Riddiford, 1974). MHR3 mRNA was not detected in the freshly explanted epidermis or in the same epidermis after culture in Grace’s medium without 20HE (Fig. 7a). The presence of 2 pg/ml(4 pi%!)20HE caused an increase in MHR3 mRNA starting at 3 hr and rising to a maximum similar to the in &JO level (Fig. 4b) by 12 hr; these

2oHE

QJgInll)

FIG. 6. Dose-response curve for induction of MHR3 mRNA by 20HE in vitro. Day 2 fourth instar larval epidermis was incubated in varying concentrations of 20HE for 6 hr, then total RNA was isolated and hybridized with the MHR3 cDNA. Relative expression was determined as described in Fig. 4. Points represent averages f SD (N = 4-8).

PALLI, HIRUMA, AND RIDDIFORD

Manducu Hwmne

b

.5 ‘O i! d

.-i

n

20HE

-

No hormone

313

Receptor S 6

12

24

45

hr

; 4.5t 3-8 t

5:

J a

O-

0

ii

P -

3

6 Culture

12 time

19

24

30

‘I4

(hr)

FIG. ‘7. (a) Induction of MHR3 transcription by 20HE during the pupal molt. Three micrograms of total RNA isolated from epidermis of larvae 1 day after wandering (Wl) that had been cultured in Grace’s medium with (m) or without (-) 2 pg/ml20HE for various times was hybridized with the MHR3 cDNA. Relative expression was determined as described in Fig. 4. Bars represent averages -t SD (N = 4-8). (b) Differential induction of the two MHR3 transcripts by 20HE. Ten micrograms of RNA isolated from Wl larval epidermis cultured in 2 fig/ml 20HE for various times was analyzed by Northern blot with the MHR3 cDNA as a probe. This hybridization is typical of three replicates.

levels Figure during 3.8-kb MHR3 molts, quent

stayed high until 30 hr and then slowly declined. 7b shows that only the 4.5-kb mRNA was present the first 24 hr of exposure to 20HE; by 45 hr the mRNA was the major form. Thus, 20HE induces mRNA during both the larval and the pupal although the time course of induction and subsedecline is slower in the latter.

Role of Protein

Synthesis in the Action of 20HE on MHR3

To determine if 20HE acts directly to initiate MHR3 mRNA transcription, we have used the protein synthesis inhibitors cycloheximide (CHX) and anisomycin (AMC) to study the effects of 20HE on fourth instar epidermis. Under these culture conditions, the presence of 10 pg/ml CHX for 6 hr caused 81% inhibition of protein synthesis, and the epidermal cells remained viable even 24 hr after CHX removal (Hiruma et uZ., 1991). Similarly, exposure to 5 pg/ml AMC for 6 hr caused 97-98s inhibition of protein synthesis (N = 4) and the epidermis appeared viable. However, by 10 hr of exposure the cells showed signs of deterioration. Figure 8 shows that both protein synthesis inhibitors caused a reduction in the level of MHR3 but neither completely prevented the induction by 20HE. At least half of the induction of MHR3 mRNA by 20HE was independent of protein synthesis and thus likely due to a direct action of 20HE on the MHR3 gene. Whether the reduction caused by the inhibitors is due to toxicity or whether protein synthesis is required for full response to 20HE cannot be resolved by these experiments. Prolonged exposure to either AMC or CHX caused cell death, and AMC was more toxic than CHX. Therefore, to study the role of 20HE and protein synthesis in the de-

cline of MHR3 mRNA after prolonged exposure to 20HE, we cultured Day 2 fourth instar larval epidermis in 2 pg/ml20HE for 6 hr to obtain maximal MHR3 expression and then cultured with or without the hormone and CHX. Figure 9a shows that MHR3 mRNA levels declined much more rapidly in the absence of 20HE than in its presence with a half-life of 2 hr. This rapid decline was not prevented by the presence of CHX, indicating that CHX had little effect on stabilization of this mRNA. The slow decline of MHR3 mRNA in the presence of 20HE, however, was prevented by CHX and

3 hr Culture

6 hr Culture

FIG. 8. Effect of protein synthesis inhibitors on the induction of MHR3 mRNA by 20HE. Day 2 fourth instar epidermis was cultured in Grace’s medium with 2 rg/ml20HE or with both 20HE and AMC (5 pg/ml) or CHX (10 rg/ml) or with the inhibitors alone for 3 or 6 hr. Three micrograms of total RNA was analyzed by dot-blots with the MHR3 cDNA as a probe. Relative expression was determined as described in Fig. 4. Bars represent averages + SD (N = 8-16).

314

DEVWPMENTAL

J

BIOLOGY

VOLUME 150,1992

a

30-

5 .f 20xa

W

.-z

0

2

(,,,,,,,,,,,,(,,~ 4 6 Time (hours

. . . . . . . . . . . . . . . . . . . . . . .. . . . 8

IO after

12 14 initial 20HE)

16

I8

20

FIG. 9. Role of 20HE in the decline of MHR3 mRNA. (a) Day 2 fourth instar larval epidermis was cultured in Grace’s medium with 2 pg/ml 20HE for 6 hr followed by an additional 14-hr culture in Grace’s medium (no hormone) with 2 wg/ml20HE (0) or 10 pg/ml cycloheximide (0) alone or with both 20HE and cycloheximide (m). Three micrograms of total RNA was analyzed by dot-blots with the MHRQ cDNA as a probe. Points are averages + SD (N = 4-20). (b) Ten micrograms of total RNA isolated from Day 2 fourth instar larval epidermis cultured in Grace’s medium with 2 pg/ml20HE for 6 hr followed by an additional 14-hr culture either in 2 fig/ml 20HE or in both 2 pg/ml20HE and 10 pg/ml CHX was analyzed on a Northern blot with the MHR3 cDNA as a probe. This is typical of four replicates.

therefore appears to require protein synthesis. When the RNAs were assessed by Northern hybridization, the presence of CHX was found to block the disappearance of both the mRNAs (Fig. 9b). Thus, MHR3 mRNA transcription and/or stabilization is directly dependent on 20HE. By contrast, the later decline of MHR3 mRNA in the continuous presence of 20HE requires protein synthesis. DISCUSSION

MHR3

is a Member

of the Steroid Hormone

Receptor

Supqfamily

Sequencing of the encoded cDNA shows that the Manduca gene that we obtained using a cDNA for hRARa (Petkovich et al, 1987) and originally named Manduca “RAR” (Palli et al, 1991) encodes a member of the steroid hormone receptor superfamily (Evans, 1988). Although this gene shows 65% identity in the DNA binding region to hRARcu, only 20% identity is found in the ligand binding region. The Manduca gene was found to be most similar to the Drosophila DHR3 gene (Koelle et a,!., 1992) with 97, 54, and 68% amino acid identity in the C (DNA binding), D, and E (ligand binding) regions, respectively. The N-terminal A/B region differs both in length (103 amino acids in MHR3 compared to 50 in DHRS) and in sequence (only 9% identity). In the DHR3 gene, there is a splice site at the 7th codon preceding the C region

(Koelle et aL, 1992); the similarity between MHR3 and DHR3 starts from this splice site and continues throughout the remainder of the coding region. There is evidence for multiple transcripts of both DHR3 (Koelle et c& 1992) and MHR3 (this paper) as there is for the ecdysteroid receptor (Koelle et aZ., 1991) and for E75 (Segraves and Hogness, 1990). In these latter cases, the Nterminal region varies due to alternative splicing or alternative promoters; a similar variation is likely for DHR3 and MHR3. The similarity in the ligand binding region between the proteins is less than the 85-90% identity seen among the different forms of the thyroid (Yaoita et aZ., 1990) and retinoic acid (De Luca, 1991) receptors either within or between species as divergent as frogs and rats, but the long stretches of identity may be the sites of interactions with the as yet unknown ligand. The high identity (67%) of the MHR3 and the DHR3 proteins exclusive of the A/B region compares well with the 73% overall identity seen between the dopa decarboxylases from Drosophila and Mandwa (M. S. Carter, K. Hiruma, and L. M. Riddiford, unpublished). Therefore, since the DNA binding domain is nearly identical and the ligand binding domain has long conserved regions, we feel that the Manduca receptor is likely the homolog of DHR3 and hence have named it MHR3. In all the vertebrate receptors and in Drosophila E75, the two hypothetical zinc fingers of the DNA binding region are encoded by two different exons (Segraves and

PALLI, HIRUMA, AND RIDDIFORD

Hogness, 1990 and references therein). By contrast, the Drosophila DHR3 and EcR genes encode both zinc fingers on the same exon (Koelle et al, 1991,1992). Both of the Manduca homologs, MHR3 and EcR (S. R. Palli and L. M. Riddiford, unpublished), are organized like the vertebrate genes and use two exons to encode this region. The most conserved region among the members of the steroid hormone receptor superfamily is the 66-68 amino acid DNA binding domain. This region has been shown to be involved in both DNA binding (Freedman et a.& 1988; Hard et al., 1990) and receptor dimerization (Kumar and Chambon, 1988). The second most conserved 225 amino acid region binds the ligand and is also involved in receptor dimerization (Kumar and Chambon, 1988; Guiochon-Mantel et aL, 1989; Glass et al., 1989), nuclear localization (Picard and Yamamoto, 1987), and binding to other proteins such as hsp90 or other trans-acting factors (Sanchez et aL, 1987; Pratt et aL, 1988; Glass et a& 1990). Both the DNA and the ligand binding regions of MHR3 contain the conserved amino acids that are typical of these regions in members of this family (Fig. 3). The ligand, however, is unknown as is true for all of the Drosophila members of this family except for the ecdysteroid receptor. This superfamily can be divided into several subfamilies based on 3 amino acids in the first zinc finger of the DNA binding region which determine the DNA sequence to which the receptor binds to regulate gene expression (Danielson et al, 1989; Mader et al, 1989; Umesono and Evans, 1989). By this criterion, MHR3 which has CEGCKG (Cys, Glu, Gly, Cys, Lys, and Gly, residues 122-126 in Fig. 2) at this coordination site for the zinc belongs to the hRAR-hTR-hVDR subfamily (Umesono et al, 1988; Schule et al, 1990). Also, the Drosophila EcR (Koelle et al, 1991), DHR3 (Koelle et al, 1992), E75A (Segraves and Hogness, 1990), and 2C (Henrich et aZ., 1990; Oro et ab, 1990; Shea et ab, 1990), as well as mPPAR (mouse peroxisome proliferator-activated receptor) (Isseman and Green, 1990), all belong to this subfamily. As might be expected, the consensus sequence of the ecdysone response element is similar to those of the hRAR, hTR, and hVDR response elements (Cherbas et CL, 1991).

Expression

of MHR3

Northern hybridization analysis showed that MHR3 encodes two mRNAs-3.8 and 4.5 kb-present mainly during the ecdysteroid rises for embryonic, larval, and pupal molts. The longest cDNA isolated so far is 3612 bp in length with a poly(A) tail at the 3’end (Fig. 2); its size corresponds to the 3.8-kb mRNA detected on Northern blots (Fig. 4a). Preliminary primer extension studies

Manduca Hormone Receptor 3

315

suggest that this cDNA is nearly full length (S. R. Palli and L. M. Riddiford, unpublished). Our culture experiments show that in both fourth and fifth instar epidermis, the 4.5-kb transcript appears first in response to 20HE, followed by the 3.8-kb transcript. One explanation is that the 3.8-kb transcript is simply a processed form of the 4.5-kb transcript. Alternatively, there may be two different transcripts with a common C-terminal region as observed in Drosophila E74 (Burtis et a& 1990), E75 (Segraves and Hogness, 1990), and EcR (W. S. Talbot and D. S. Hogness, personal communication), which are due to alternate promoters or alternate splicing or both. The Drosophila E74A (6 kb) and E74B (4.8 and 5.1 kb) transcripts appear in response to a 20HE exposure with delay times that coincide with the length of primary transcripts (Karim and Thummel, 1991); thus, the E74B transcript appears first. Preliminary PCR studies using oligonucleotide primers based on nucleotides either in the 5’ untranslated region or just prior to the DNA binding region of the 3.8-kb cDNA indicate that two cDNAs differing in the A/B region are present at the head capsule slippage stage (S. R. Palli and L. M. Riddiford, unpublished). Further work is necessary to resolve this issue.

MHR3

and Ecdysone Action

Induction and subsequent suppression of MHR3 mRNA by 20HE are similar to the ecdysteroid action on the early genes in Drosophila salivary gland chromosomes (Ashburner et a& 1974). Ashburner’s model proposes that the early genes are induced directly by the ecdysteroid-receptor complex and hence are independent of protein synthesis. The proteins produced by these early genes then are thought to activate late genes and inactivate early genes. Transcription of MHR3 was induced in fourth instar Manducu epidermis in less than 3 hr, and more than 50% of the induction was independent of protein synthesis. Moreover, expression depended on the presence of 20HE, and the loss of MHR3 mRNA in the continuous presence of 20HE was dependent on protein synthesis. Thus, MHR3 expression is similar to that of the early genes, i.e., it is directly induced by ecdysteroid and dependent on that ecdysteroid, and protein synthesis is necessary for its subsequent decline (Ashburner, 1973, 1974). Its appearance in response to 20HE is slower than that of the earliest genes in Drosophila (E74, Thummel et a& 1990; E75, Segraves and Hogness, 1990) but more in consonance with the puffing of the 46F chromosomal site to which DHR3 hybridized (Koelle et aZ., 1992) which occurs several hours after that of the sites at 74EF and 75B (Ashburner, 1972).

316

DEVELOPMENTAL BIOLOGY

Protein synthesis in response to 20HE appears to be required for the full expression of MHR3, indicating either that the MHR3 protein acts as a positive regulator in the early response or that another ecdysteroid-induced protein is necessary. Alternatively, since the inhibition of protein synthesis causes cell death after a lohr exposure, the decreased mRNA at 6 hr may merely indicate that some of the cells are already being adversely affected by the inhibition of protein synthesis. Once the mRNA has been induced by 20HE, it is remarkably stable in the presence of both 20HE and cycloheximide. These studies thus have identified an ecdysteroid-inducible gene in Manduca that encodes a DNA binding protein belonging to the steroid hormone superfamily. The appearance of this MHR3 mRNA in the fat body (R. Langelan and L. M. Riddiford, unpublished) and the nervous system (L. M. Riddiford and J. W. Truman, unpublished) as well as in the epidermis at the time of the molts suggests that it likely is a transcription factor necessary for the cascade of gene activation and inactivation by ecdysteroids during the molt. We thank Dr. Pierre Chambon for the human retinoic acid receptor cDNA clone; Mr. Michael Koelle and Professor David Hogness for the Southern blot of Drosophila receptor cDNAs and for the DHR3 cDNA, and Professor James W. Truman for critical comments on the manuscript. Supported by NSF DCB88-188’76 and NIH AI12.459. REFERENCES Arriza, J. L., Weinberger, C., Cerelli, G., Glaser, T. M., Handelin, B. L., Housman, D. E., and Evans, R. M. (1987). Cloning of human mineralocorticoid receptor complementary DNA: Structural and functional kinship with the glucocorticoid receptor. Science 237,268-275. Ashburner, M. (1972). Patterns of puffing activity in the salivary gland chromosome of Drosophila. IV. Induction by ecdysone in salivary glands of D. melanoga&er cultured in vitro. Chronwsoma 38, 255-281. Ashburner, M. (1973). Sequential gene activation by ecdysone in polytene chromosomes of Drosophila mehwwgaster. I. Dependence upon ecdysone concentration. Dev. Biol 35,47-61. Ashburner, M. (1974). Sequential gene activation by ecdysone in polytene chromosomes of Drosophila melanogaster. II. The effects of inhibitors of protein synthesis. Dev. Bid 39,141-157. Ashburner, M., Chihara, C., Meltzer, P., and Richards, G. (1974). Temporal control of puffing activity in polytene chromosomes of Drosophila melanogaster. Cold Spring Harbor Symp. Quad. Bid 38, 655-662. Aviv, H., and Leder, P. (1972). Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose. Prcc. Natl Ad Sci. USA 69,1408-1412. Baker, A. R., McDonnell, D. P., Hughes, M., Crisp, T. M., Mangelsdorf, D. J., Haussler, M. R., Pike, J. W., Shine, J., and O’Malley, B. W. (1988). Cloning and expression of full-length cDNA encoding human vitamin D receptor. Proc. Nati Ad Sti USA 85,3294-3298. Bell, R. A., and Joachim, F. G. (1976). Techniques for rearing laboratory colonies of tobacco hornworms and pink bollworms. Ann. Entomol. Soc. Am 69,365-373. Benton, W. D., and Davis, R. W. (1977). Screening of Xgt recombinant

VOLUME 150.1992

clones by hybridization to single plaques in situ Science 196,182184. Biggin, M. D., Gibson, T. J., and Hong, G. F. (1983). Buffer gradient gels and %S label as an aid to rapid DNA sequence determination. Proc. Natl. Acad Sci. USA 80,3963-3965. Bollenbacher, W. E., Smith, S. L., Goodman, W., and Gilbert, L. I. (1981). Ecdysteroid titer during larval-pupal-adult development of the tobacco hornworm, Manduca sexta. Gen Comp. Endocrinol 44, 302-306. Broadie, K. S., Bate, M., and Tublitz, N. J. (1991). Quantitative staging of embryonic development of the tobacco hawkmoth, Manducu sex&. Rwx’s Arch. Dev. Biol 199,327-334. Burtis, K. C., Thummel, C. S., Jones, C. W., Karim, F. D., and Hogness, D. S. (1990). The Drosophila 74EF early puff contains E74, a complex ecdysone-inducible gene that encodes two et-s-related proteins. Cell 61.85-99. Cavener, D. R. (1987). Comparison of the consensus sequence flanking translational start sites in Drosophila and vertebrates. Nucleic Acids Res. 15,1353-1361. Cheley, S., and Anderson, R. (1984). A reproducible microanalytical method for the detection of specific RNA sequences by dot-blot hybridization. Anal. Biochem. 137,15-19. Cherbas, L., Lee, K., and Cherbas, P. (1991). Identification of ecdysone response elements by analysis of the Drosophila Eip 28/29 gene. Genes Dev. 5,120-131. Clever, U., and Karlson, P. (1960). Induktion von Puff-Versnderungen in den Speicheldriisen-chromosomen von Chironomow tentans durch Ecdyson. Exp. Cell Res. 20,623-626. Curtis, A. T., Hori, M., Green, J. M., Wolfgang, W. J., Hiruma, K., and Riddiford, L. M. (1984). Ecdysteroid regulation of the onset of cuticular melanization in allatectomized and black mutant Mandm sextu larvae. J. Insect Physiol. 30,597~606. Danielsen, M., Hinck, L., and Ringold, G. M. (1989). Two amino acids within the knuckle of the first zinc finger specify DNA response element activation by the glucocorticoid receptor. CeU 57,1131-1138. Davis, L. G., Dibner, M. D., and Battey, J. F. (1986). “Basic Methods in Molecular Biology,” pp. 388. Elsevier, Amsterdam. De Luca, L. M. (1991). Retinoids and their receptors in differentiation, embryogenesis, and neoplasia. FASEB J. 5,2924-2933. Denhardt, D. (1966). A membrane-filter technique for the detection of complementary DNA. Biochem. Biophys. Res. Commun 23,641-651. DiBello, P. R., Withers, D. A., Bayer, C. A., Fristrom, J. W., and Guild, G. M. (1991). The Drosophila broad-wmpkx encodes a family of related proteins containing zinc fingers. Genetics 129,385-397. Dobens, L., Rodolph, K., and Berger, E. M. (1991). Ecdysterone regulatory elements function as both transcriptional activators and repressors. Mol. Cell Biol. 11,1846-1853. Evans, R. M. (1988). The steroid and thyroid hormone receptor superfamily. Science 240,889-895. Feinberg, A. P., and Vogelstein, B. (1984). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. And Biodem 137,266-267. Freedman, L. P., Luisi, B. F., Korszun, Z. R., Basavappa, R., Sigler, P. B., and Yamamoto, K. R. (1988). The function and structure of the metal coordination sites within the glucocorticoid receptor DNA binding domain. Nature 334,543~546. Glass, C. K., Lipkin, S. M., Devary, 0. V., and Rosenfeld, M. G. (1989). Positive and negative regulation of gene transcription by a retinoic acid-thyroid hormone heterodimer. CeU 59.697-708. Glass, C. K., Devary, 0. V., and Rosenfeld, M. G. (1990). Multiple cell type specific proteins differentially regulate target sequence recognition by the retinoic acid receptor. Cell 63,729-738. Greene, G. L., Gilna, P., Waterfield, M., Baker, A., Hort, Y., and Shine,

PAILI,

HIRUYA,

AND RIDDIFORD

J. (1986). Sequence and expression of human estrogen receptor complementary DNA. science 231,1150-1153. Guay, P. S., and Guild, G. M. (1991). The ecdysone-induced puffing cascade in Drosophila salivary glands: A brood-complex early gene regulates intermolt and late gene transcription. Genetics 129,169175. Gubler, U., and Hoffman, B. J. (1983). A simple and very efficient method for generating cDNA libraries. Gene 25,263-269, Guiochon-Mantel, A., Loosfelt, H., Lescop, P., Sar, S., Atger, M., Perrot-Applanat, M., and Milgrom, E. (1989). Mechanisms of nuclear localization of the progesterone receptor: Evidence for interaction between monomers. Cell 57,1147-1&t. Hard, T., Kellenbach, E., Boelens, R., Maler, B. A., Dahlman, K., Freedman, L. P., Carlstedt-Duke, J., Yamamoto, K. R., Gustafsson, J., and Kaptein, R. (1990). Solution structure of the glucocorticoid receptor DNA-binding domain. Science 249,157-160. Henikoff, S. (1984). Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28351-359. Henrich, V. C., Sliter, T. J., Lubahn, D. B., MacIntyre, A., and Gilbert, L. I. (1990). A steroid/thyroid hormone receptor superfamily member in Drosophila melanogaster that shares extensive sequence similarity with a mammalian homologue. Nucleic Acids Res. 18. 4143-4148. Hiruma, K., and Riddiford, L. M. (1984). Regulation of melanization of tobacco hornworm larval cuticle in vitro. J. Exp. ZooL 230,393-403. Hiruma, K., Hardie, J., and Riddiford, L. M. (1991). Hormonal regulation of epidermal metamorphosis in vitro: Control of expression of a larval-specific cuticle gene. Dev. Biol 144,369-378. Horodyski, F. M., Riddiford, L. M., and Truman, J. W. (1989). Isolation and expression of the eclosion hormone gene from the tobacco hornworm, Manduca sexta. Proc. Nat1 Acud Sci USA 86,8123-8127. Issemann, I., and Green, S. (1990). Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature 347,645-650. Kafatos, F. C., Jones, C. W., and Efstratiadis, A. (1979). Determination of nucleic acid sequence homologies and relative concentrations by a dot hybridization procedure. Nucleic Acids Res. 7,1541-1552. Karim, F. D., and Thummel, C. S. (1991). Ecdysone coordinates the timing and amounts of E74A and E74B transcription in Drosophila Genes Dev. 5,1067-1079. Kato, Y., and Riddiford, L. M. (1987). The role of 20-hydroxyecdysone in stimulating epidermal mitosis during larval-pupal transformation of the tobacco hornworm, Man&co sexta Development 100, 227-236. Koelle, M. R., Talbot, W. S., Segraves, W. A., Bender, M. T., Cherbas, P., and Hogness, D. S. (1991). The L?rosophiZu EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily. Cell 67,59-77. Koelle, M. R., Segraves, W. A., and Hogness, D. S. (1992). DHR3: A new Drosophila steroid receptor homolog. Proc Natl. Acad. Sci USA, Submitted for publication. Kozak, M. (1984). Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucleic Acids Res. 12,857-872. Krust, A., Green, S., Aargos, P., Kumar, V., Walter, P., Bornert, J. M., and Chambon, P. (1986). The chicken oestrogen receptor sequence: Homology with v-erbA and the human oestrogen and glucocorticoid receptors. EMBO J 5,891-897. Kumar, V., and Chambon, P. (1988). The estrogen receptor binds tightly to its responsive element as a ligand-induced homodimer. Cell 55,145-156. Lehrach, H., Diamond, D., Wozney, J. M., and Boedtker, H. (1977). RNA molecular weight determination bvu -eel eleetronhoresis ~~~ ~~._~~.~ .-.- under .~~~-..

Man&m

H ornwne Receptor 3

317

denaturing conditions, a critical reexamination. Biochemistry 16, 4743-4751. Mader, S., Kumar, V., Verneuil, H. D., and Chambon, P. (1989). Three amino acids of the oestrogen receptor are essential to its ability to distinguish an oestrogen from a glucocorticoid-responsive element. Nature 338,271-274. Mlodzik, M., Hiromi, Y., Weber, U., Goodman, C. S., and Rubin, G. M. (1990). The Drosophila seven-up gene, a member of the steroid receptor gene superfamily, controls photoreceptor cell fates. CeU 60, 211-224. Oro, A. E., McKeown, M., and Evans, R. M. (1990). Relationship between the product of the Drosophila ultra&de locus and the vertebrate retinoid X receptor. Nature 347,298-301. Ozyhar, A., Strangmann-Diekmann, M., Kiltz, H-H., and Pongs, 0. (1991). Characterization of a specific ecdysteroid receptor-DNA complex reveals common properties for invertebrate and vertebrate hormone-receptor/DNA interactions. Eur. J. B&hem 200, 329335. Palli, S. R., Osir, E. O., Eng, W-S., Boehm, M. F., Edwards, M., Kulcsar, P., Ujvary, I., Hiruma, K., Prestwich, G. D., and Riddiford, L. M. (1990). Juvenile hormone receptors in larval insect epidermis: Identification by photoaffinity labeling. Proc. Nat1 Ad Sci. USA 87, 796-800. Palli, S. R., Riddiford, L. M., and Hiruma, K. (1991). Juvenile hormone and “retinoic acid” receptors in Manduca epidermis. Insect Biothem. 21,7-15. Pearson, W. R., and Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proc. Natl. Awd Sci USA 85,2444-2448. Petkovich, M., Brand, N. J., Krust, A., and Chambon, P. (1987). A human retinoic acid receptor which belongs to the family of nuclear receptors. Nature 330,444-450. Picard, D., and Yamamoto, K. R. (1987). Two signals mediate hormone-dependent nuclear localization of the glucocorticoid receptor. EMBO J. 6,3333-3340. Pratt, W. B., Jolly, D.‘J., Pratt, D. V., Hoilenberg, S. M., Giguere, V., Cadepond, F. M., Schweizer, G. G., Catelli, M. G., Evans, R. M., and Baulieu, E. E. (1988). A region in the steroid binding domain determines formation of the non-DNA binding, 9 S glucocorticoid receptor complex. J. Biol Chem. 263,267-273. Proudfoot, N. (1990). Poly(A) signals. CeU 64,671-674. Pustell, J., and Kafatos, F. C. (1984). A convenient and adaptable package of computer programs for DNA and protein sequence management, analysis and homology determination. Nucleic Acids Res. 12, 643-655. Riddiford, L. M. (1978). Ecdysone-induced change in cellular commitment of the tobacco hornworm, Man&co sexta, at the initiation of metamorphosis. Gen Comp. Endocrinol. 34,438-446. Riddiford, L. M. (1985). Hormone action at the cellular level. In “Comprehensive Insect Physiology, Biochemistry, and Pharmacology” (G. A. Kerkut and L. I. Gilbert, Eds.), Vol. 8, pp. 37-84. Pergamon, Oxford. Riddiford, L. M., Curtis, A. T., and Kiguchi, K. (1979). Culture of the epidermis of the tobacco hornworm Manducu se&u. Tissue Culture Assn Manual 5,975-985. Riddiford, L. M., Palli, S. R., Hiruma, K., Li, W.-C., Green, J., Hice, R., Wolfgang, W. J., and Webb, B. A. (1990). Developmental expression and secretion of insecticyanin by the epidermis of the tobacco hornworm Manduca sextu. Arch. Insect Biochem. Phgsiol. 14,171-190. Riddihough, G., and Pelham, H. R. B. (1987). An ecdysone response element in the Drosophila hsp27 promoter. EMBO J. 6,3729-3734. Sanchez, E. R., Meshinchi, S., Tienrungroj, W., Schlesinger, M. J., Toft, D. O., and Pratt, W. B. (1987). Relationship of the 90-kDa murine heat shock protein to the untransformed and transformed states of the L cell glucocorticoid receptor. J. Biol. Chem. 262,6986-6991. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing

318

DEVELOPMENTAL BIOLOGY

with chain terminating inhibitors. Proc. Natl. Acad Sci. USA 74, 5463-5467. Schule, R., Umesono, K., Mangelsdorf, D. J., Bolado, J., Pike, J. W., and Evans, R. M. (1990). Jun-Fos and receptors for vitamins A and D recognize a common response element in the human osteocalcin gene. Cell 61,497-504. Schwabe, J. W. R., Neuhaus, D., and Rhodes, D. (1990). Solution structure of the DNA-binding domain of the oestrogen receptor. Nature 348,458461. Segraves, W. A., and Hogness, D. S. (1990). The E75 ecdysone-inducible gene responsible for the 75B early puff in Drosophila encodes two new members of the steroid receptor superfamily. Genes Dev. 4, 204-219. Shea, M. J., King, D. L., Conboy, M. J., Mariani, B. D., and Kafatos, F. C. (1990). Proteins that bind to Drosophila chorion &-regulatory elements: A new CzH, zinc finger protein and a C&z steroid receptor-like component. Genes Dev. 4,1128-1140. Tabor, S., and Richardson, C. C. (1987). DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc Nat1 Acad Sci USA 84,4767-4771. Thummel, C. S., Burtis, K. Cl., and Hogness, D. S. (1990). Spatial and temporal patterns of E74 transcription during DmwphiZa development. Cell 61,101-111. Truman, J. W. (1972). Physiology of insect rhythms. I. Circadian orga-

VOLUME 150.1992

nization of the endocrine events underlying the moulting cycle of larval tobacco hornworms. J. E3ep. Bid 57,805~832. Truman, J. W., and Riddiford, L. M. (1974). Physiology of insect rhythms. III. The temporal organization of the endocrine events underlying pupation of the tobacco hornworm. J. Exp. Bid 60,371382. Umesono, K., and Evans, R. M. (1989). Determinants of target gene specificity for steroid/thyroid hormone receptors. CeU 57, 11391146. Umesono, K., Giguere, V., Glass, C. K., Rosenfeld, M. G., and Evans, R. M. (1988). Retinoic acid and thyroid hormone induce gene expression through a common responsive element. Nature 336,262-265. Urness, L. D., and Thummel, C. S. (1990). Molecular interactions within the ecdysone regulatory hierarchy: DNA binding properties of the L?rosophila ecdysone-inducible E74A protein. Cell 63,47-61. Weinberger, C., Thompson, C. C., Ong, E. S., Lebo, R., Gruol, D. J., and Evans, R. M. (1986). The c-e&A gene encodes a thyroid hormone receptor. Nature 324,641~646. Wolfgang, W. J., and Riddiford, L. M. (1986). Larval cuticular morphogenesis in the tobacco hornworm, Mandum se&a, and its hormonal regulation. Deu. Biol: 113,305-316. Yaoita, Y., Shi, Y-B., and Brown, D. D. (1990). Xenopns Levis (Yand /3 thyroid hormone receptors. Proc. Nat1 Acad Sci USA 87, 70907094.

An ecdysteroid-inducible Manduca gene similar to the Drosophila DHR3 gene, a member of the steroid hormone receptor superfamily.

Using cDNAs for the human retinoic acid receptor alpha (hRAR alpha) and Drosophila hormone receptor 3 (DHR3), we isolated a cDNA encoding a member of ...
3MB Sizes 0 Downloads 0 Views