Amino acid substitutions in the DNA-binding domain of the human androgen receptor are a frequent cause of receptor-binding positive androgen resistance.

Amino Acid Substitutions in the DNABinding Domain of the Human Androgen Receptor Are a Frequent Cause of Receptor-Binding Positive Androgen Resistance

S. Zoppi, M. Marcelli, M. J. McPhaul

J.-P. Deslypere,

Department of Internal Medicine University of Texas Southwestern Dallas, Texas 75235-8857

J. E. Griffin,

J. D. Wilson,

and

Medical Center

In some subjects with genetic and endocrine evidence of androgen resistance, no defect is demonstrable in the binding of androgen to its receptor in cultured genital skin fibroblasts. We have defined the molecular defect in the androgen receptor in four unrelated subjects in this category (termed receptor positive) with the phenotype of compete or incomplete testicular feminization. In these patients we detected amino acid substitutions in either exon 2 or exon 3, which encodes the DNA-binding domain of the androgen receptor. In one patient with incomplete testicular feminization, two separate mutations were present in exon 3. Introduction of these amino acid substitutions into the androgen receptor-coding segment leads to the expression of receptor proteins that bind ligand in a normal fashion but do not activate the transcription of the androgen-responsive mouse mammary tumor virus promoter. Mobility shift assays using androgen receptor fusion proteins produced in E. co/i indicate that these mutations impair binding of the receptor to specific DNA sequences. In the subject with incomplete testicular feminization, a Ser-Gly substitution at amino acid residue 595 is able to partially restore DNA-binding activity to a mutant receptor protein that carries an Arg-Pro substitution at position 615. These findings indicate that mutations in amino acid residues crucial to the binding of the androgen receptor to target DNA sequences are a common cause of receptorbinding positive androgen resistance and that variable impairment of DNA binding can lead to distinctive phenotypes. (Molecular Endocrinology 6: 409415,1992)

to genotypic males with a female phenotype (1). This clinical diversity is associated with a variety of qualitative and quantitative abnormalities in androgen receptor-binding properties in cultured genital skin fibroblasts. Using such assays, four broad categories of receptor abnormalities have been defined: subjects in which no androgen binding is detected (receptor-binding negative), those in whom receptor levels are decreased (receptor-binding reduced) or qualitatively abnormal (qualitative binding abnormality), and those in which no abnormality can be demonstrated (receptorbinding positive) (1). Receptor-binding positive androgen resistance is believed to be caused by defects in the androgen receptor not evident using ligand-binding assays. Alternatively, the androgen resistance might be due to defects in genes other than the androgen receptor itself. We identified the genetic defect in one subject with the phenotype of complete testicular feminization but in whom no abnormality of the androgen receptor could be detected by ligand-binding assays in cultured genital skin fibroblast cultures (2). In this woman, androgen resistance was caused by a single amino acid substitution in the DNA-binding domain of the androgen receptor. In the current studies we examined three additional unrelated subjects with similar clinical and biochemical profiles. In each case a mutation of the DNAbinding domain interferes with the binding of the receptor to target DNA sequences when assayed in vitro.

RESULTS INTRODUCTION

Identification of Mutations Receptor Gene

Androgen resistance encompasses a broad spectrum of clinical disorders, ranging from mild undervirilization

in the Androgen

Our prior identification of a mutation in the DNA-binding domain of the androgen receptor gene of a woman with receptor-binding positive androgen resistance (2) led us to examine the nucleotide sequence of the androgen

0888.8809/92/0409-0415$03 00/O Molecular Endocrinology Copyright 0 1992 by The Endocme Swlety

409

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 16 November 2015. at 20:00 For personal use only. No other uses without permission. . All rights reserved.

MOL 410

Vol6

END0.1992

receptor gene in three unrelated subjects with similar clinical syndromes. The clinical phenotypes and functional properties of the androgen receptors in these patients are summarized in Table 1 and described in greater detail in Materials and Methods. In two subjects (P864 and P881), single nucleotide substitution mutations were present in exon 2 at positions 1832 (G-A) and 1883 (T+C), respectively. In subject P866, however, two separate mutations were detected in exon 3 at nucleotide positions 2006 (G-C) and 1945 (A-G). Apart from these nucleotide sequence differences in exons 2 and 3, the remainder of the coding sequence of the androgen receptor gene in each patient was identical to the nucleotide sequence of the normal androgen receptor gene, except for a minor degree of heterogeneity in the length of the glutamine homopolymerit segment, as noted in Fig. 1. The sequence of the glycine homopolymeric region was not examined. The positions of the mutations and the amino acid substitutions resulting in the predicted amino acid sequence of the androgen receptors are shown in Fig. 1. Hormone-Binding Characteristics of Eukaryotic Cells Transfected with cDNAs Encoding the Mutant Androgen Receptors The hormone-binding kinetics observed in the fibroblast strains established from subjects P864 and P881 predict that the mutations in the androgen receptor gene should not affect binding of ligand by the mutant receptor proteins. By contrast, ligand-binding characteristics of the fibroblasts from subject P866 suggest that either one or both mutations should result in a subtle alteration in the rate of dissociation of hormone from the receptor. To examine the binding properties, cDNAs encoding each of the mutant receptors (see Fig. 2) were stably transfected into the Chinese hamster ovary (CHO) cell line using the dominant selectable marker pSV2neo (6).

Table

1. Androgen

Receptor

Patient No.

Phenotype’

704 P321 P864 P866 P881

Normal CTF CTF ITF CTF

Characterization 6 maxb 37 31 35 32 29

in Genital

No. 3

After selection with the antibiotic G418, pools of resistant cells (50-150 independent colonies each) were propagated and used in monolayer binding assays (Table 2). The binding kinetics of the androgen receptor in cells transfected with the mutant receptors P881 and P864 are nearly indistinguishable from those of the normal androgen receptor. However, cells transfected with the P866-2 expression plasmid demonstrate an increased rate of ligand dissociation compared to that of the P321 expression plasmid. These results suggest that the mutation at position 595 accounts for the abnormalities of hormone binding in the P866 fibroblast strain. Capacity of the Mutant Receptors to Stimulate the Mouse Mammary Tumor Virus (MMTV) Promoter Is Impaired To examine the capacity of the mutant receptors to stimulate androgen-responsive genes, each mutation was introduced into the coding segment of a normal androgen receptor cDNA. These mutant cDNAs and an androgen-responsive reporter gene [MMTV-chloramphenicol acetyltransferase (CAT)] were transfected into CVI cells and assayed for their capacity to stimulate activation of the MMTV promoter in cotransfection assays (7-9), as shown in Fig. 3. The data derived from quantitation of the maximal level of CAT activity attained by the normal and mutant receptors are summarized in Table 3. The capacity of each of the mutant receptors to activate transcription of the MMTV-LTR is impaired, but substitution at amino acid 595 alone causes less impairment than that observed for the amino acid replacements at residue 557, 574, or 615 (subjects 881, 864, and P321, respectively). The amino acid substitutions at positions 557 and 574 replace highly conserved cysteine residues and would be expected to alter receptor function due to

Skin Fibroblasts

Apparent hM)b 0.3 0.1 0.2 0.3 0.3

Kd

Up-Regulation” (f2-3 fold) (T2.3 fold) (tl.7 fold) ND’ (T2.7 fold)

Thermolabilityd No No No No No

Dissociation Rates Normal Normal Normal Accelerated Normal

a CTF, Complete testicular feminization; ITF, incomplete testicular feminization. b B,, (binding capacity, expressed in femtomoles of &$H]dihydrotestosterone bound per mg protein) and apparent & of the receptor were calculated in intact monolayer cultures of genital skin fibroblast cultures established from genital skin biopsies of each patient using the method of Griffin and Durrant (3). c Up-regulation refers to the B,,, in binding assays using 2 nM [3H]mibolerone for 1 and 24 h at 37 C, as described previously (4). An increase of 1.5 or greater between the 1 and 24 h values is considered normal. d Thermolability is assayed by performing monolayer binding assays using [3H]dihydrotestosterone at 37 and 41 C (3) and calculating the B,,, of androgen binding. Thermolability is defined as the finding of high affinity androgen binding (Bmax) at 41 C of less than 60% of the value at 37 C. ’ The dissociation rate is assayed as previously described (4). A percentage of baseline binding at 5 h of less than half that in the control strain was considered abnormal. ’ Not done.


411

Mutations in the DNA-Binding Domain

KFR

SGCHY G A

0

Table 2. Binding Characteristics of the Mutant Androgen Receptor Expressed in Eukaryotic Cells Stably Transfected with Androgen Receptor Expression Plasmids

R

Dissociation Rate

Thermolability

Fig. 1. Positions of Mutations in the Androgen Receptor Gene That Cause Receptor-Binding Positive Androgen Resistance The position of each of the mutations identified is shown relative to the structure of the DNA-binding domain of the human androgen receptor. The amino acid numbering coordinates are those of Tilley et a/. (5). The remainder of the sequence of the eight coding exons was identical to the sequence of Tilley et al. (5) except for the number of glutamine residues in the amino-terminal sequences. The glutamine homopolymeric domains contained 21 (P321 and 868) or 22 (P881 and P864) residues. The length of the glycine homopolymeric segment was not determined.

CMV Promoter

+I+/-I+]+/-]+]+I-I+I+(-/+/+1-j

DHT

Amino Aad Substitution I Ill nd III

GH Polyade;ylation

No Normal 32 0.4 Normal Normal 35 0.5 No 321 ND 76 1.0 No 866-l Accelerated 39 0.5 No 866-2 Normal 104 0.8 No 881 CHO cells were stably transfected with the indicated androgen receptor expression plasmids and the dominant selectable marker pSV2neo (6). After selection with the antibiotic G418, the cell pools were analyzed to determine binding capacity (B,.J. &, thermolability and dissociation rate, as described in Table’l. ND, Not done. -

CMV CMV CMV CMV CMV

P321 P664 P661 P&56-1 P066-2

CMV P321-Lys CMV P321-Gin

A%5

A%5

-

A&.,5 Arg,,5

-

Cy9557

Q’%, S%s, Se'595

P’OSIS Trp557

A%4

‘i

i

'31~595

G’y595 P%5

LYS Gin

Fig. 2. Schematic of Normal and Mutant Androgen Receptor Expression Vectors The androgen expression plasmid employed is depicted schematically to the left. The specific amino acid residue(s) mutated are indicated along with the nomenclature employed for each plasmid containing the corresponding mutation(s). In each instance, the mutations were inserted into an androgen receptor cDNA that encodes 20 glutamine residues and 23 glycine residues in the amino-terminal homopolymeric domains (5). The expression plasmid cytomegalovirus (CMV) P866-2 corresponds to the mutant receptor (containing mutations at amino acids 615 and 594) predicted for subject P866. Plasmids 866-l and 321 refer to plasmids that encode the mutations at amino acids 615 and 594, respectively. CMV P321-Lys and P321 -Gin have lysine or glutamine substitutions at amino acid 615.

effects on the coordination of metal ions. The effect of the amino acid substitution at position 615, however, is less obvious. To examine the effect of amino acid substitutions at this position, additional mutagenesis was performed to introduce either a glutamine or a lysine residue at the position (Table 3). Mutant receptors with a glutamine residue at this position are unable to stimulate the MMTV-long terminal repeat (LTR). Replacement of this residue with a lysine residue also impairs the capacity to stimulate transcription but not to the degree observed in mutant 321.

-III-II Normal

661

664

866-Z

321

Fig. 3. Amino Acid Substitutions in the DNA-Binding Domain of the Human Androgen Receptor Detected in Subjects with Androgen Resistance Markedly Impair Its Capacity to Activate a Reporter Gene CVl cells were transfected with 200 ng androgen receptor expression plasmid, 10 pg MMTV-CAT reporter plasmid, and 1 pg of a control plasmid (pCH110) encoding p-galactosidase. After stimulation for 48 h with no steroid or 2 nM 5or-dihydro.testosterone, the cells were harvested and assayed for CAT and P-galactosidase activities. +, Samples incubated with 5a-dihydrotestosterone (DHT); -, samples incubated with no steroid added.

Mutations Androgen Properties

in the DNA-Binding Domain of the Receptor Alter the DNA-Binding of the Receptor

We employed a mobility shift assay to determine whether the mutant receptors are able to bind to specific target DNA sequences. After the transfer of each of the mutations into the bacterial expression vector

pGEX-2T (10, 1l), the androgen receptor fusion proteins were isolated and purified by affinity chromatography. Aliquots of the partially purified proteins were

incubatedwith labeledtarget DNA sequencesderived from the MMTV-LTR

(11,12) (Fig. 4). The fusion protein

containingthe hormone-and DNA-bindingsegmentsof the normalandrogen receptor forms specific DNA-protein complexes

with the target DNA sequences

(11). By

contrast, fusion proteins encoding the same segment of the receptor derived from P881, P864, or P321 are


Vol6 No. 3

MOL ENDO. 1992 412

3. Transcriptional Activation Capacities of Mutant Androgen Receptors as Assayed in Transient Cotransfection Assays

Table

Androgen Expression

Receptor Plasmid

Normal 864 866-l 866-2 881 321 321 -Lys

321 -Gin

Ms”W&y Assay

% of Transcnptional Activation Capacity

100 0.3 21 2.5 0.6 5.6

11.2 1.3

The transcription activation capacities of the normal and mutant androgen receptors were assayed by cotransfection of the indicated androgen receptor expression plasmids, the reporter gene MMTV-CAT, and the control plasmid pcH110 into CVl cells. After transfection, the cells were incubated with 2 nM 5a-dihydrotestosterone for 48 h, harvested, and assayed for CAT and p-galactosidase activity. Each value represents the mean of two or more experiments containing at least two individual measurements for each mutant. The values represent the CAT activity assayed after stimulation of the normal or mutant receptors with Sa-dihydrotestosterone normalized to the activity of the normal androgen receptor included in each experiment.

unable to form specific DNA-protein complexes. However, the P866-2 mutant fusion protein containing amino acid substitutions at residues 595 and 615 did form complexes with the target DNA, although at a reduced level compared to normal. These differences in the formation of DNA-protein complexes are not caused by differences in the amount of fusion protein included in each assay (Fig. 4, lower pane/).

DISCUSSION These findings indicate that substitution mutations in the DNA-binding domain of the human androgen receptor are a frequent cause of receptor-binding positive androgen resistance. In four unrelated subjects, androgen resistance has resulted from amino acid substitutions that have little or no effect on androgen binding on the receptor but impair the capacity of the receptor to activate transcription. This impairment is caused by inefficient binding of the mutant androgen receptors to target DNA sequences. In the case of patients 881 and 864, the alterations are caused by amino acid substitutions that change residues crucial to the coordination of metal ions to form an essential component of the DNA-binding structure. These results are consistent with extensive in vitro mutagenesis studies on the glucocorticoid (14-l 6), progesterone (17), and estrogen receptor (18) proteins. The current results together with analogous studies of mutations in the vitamin D receptor (19, 20) establish that such findings can be extended to the in vivo behavior of steroid receptors.

lmmunoblot

-46

Fig. 4. Mutations in the DNA-Binding Domain of the Human Androgen Receptor Impair the Capacity of Androgen Receptor Fusion Proteins to Bind to Target DNA Sequences The capacity of the glutathione-S-transferase-androgen receptor fusion proteins to bind to target DNA sequences was examined using a mobility shift assay. Upper panel, Three x 1O4dpm end-labeled GRE were incubated with 1 fmol affinitypurified glutathione-S-transferase-human androgen receptor fusion protein. Shifted bands corresponding to specific DNA fusion protein complexes are visible in the lanes containing the fusion protein encoding normal androgen receptor sequence and the mutant 866-2 hAR fusion proteins. No shifted complexes are detected in the lanes containing the 321, 864, and 866 mutant androgen receptor fusion proteins. Lower panel, Fifty-microliter aliquots of each affinity-purified androgen receptor fusion protein were assessed by immunoblot, using antibodies directed at the carboxy-terminus of the receptor protein (rabbit 489) (13). The amounts employed for immunoblot analysis correspond to 8.8 fmol (866-2) 1.4 fmol (864) 10.4 fmol (881) 8.2 fmol(321), and 4.02 fmol (normal AR) of the receptor fusion protein used in A.

The reason for the effect of the mutation at amino acid 615, present in patients 321 and 866, however, is less obvious. This mutation replaces an amino acid, arginine, that is not conserved in all steroid receptors. Thus, in the thyroid hormone and vitamin D receptors, a lysine residue is present in this position instead of arginine (21). Our studies indicate that the defective DNA binding of mutant receptors containing the arginine to proline substitution at residue 615 is caused by two effects of this mutation. First, insertion of a proline residue into this segment may interrupt the conformation of the tertiary structure of this portion of the DNAbinding domain, as this segment is likely to exist in an a-helical conformation, based on nuclear magnetic res-


Mutations in the DNA-Binding Domain

onance imaging and crystallographic studies of the DNA-binding domain of the glucocorticoid receptor (22, 23). While effects on the higher order structure of this region are certainly important, additional mutagenesis at this residue indicates that the specific amino acid at position 615 is also important. Thus, replacement of amino acid 615 with a glutamine residue leads to the synthesis of a receptor that is severely impaired in assays of transcriptional activation, and replacement of this residue with a different positively charged residue, lysine, does not restore full receptor function. Three of the four subjects studied in this report (P321, P881, and P864) have a phenotype of complete testicular feminization. Consistent with this phenotype is the presence in each of the mutations that impair receptor function and abolish the capacity of the receptor to bind to DNA. Thus, in these subjects the phenotype is in accord with the biochemical findings. Subject P866 is distinctive in two respects. First, the phenotype is that of incomplete testicular feminization. Despite this slightly virilized phenotype, two distinct genetic mutations are present in exon 3: an amino acid substitution at residue number 595 and a second substitution at position 615. Remarkably, this second mutation (arginine 615 proline) is identical to that detected in subject P321, who has complete testicular feminization. The probable basis of the differences in phenotype between subjects P321 and P866 was revealed when the mutant receptors were studied. In transfection assays the receptors predicted for P321 and P866 are both severely impaired, whereas in assays of DNA binding, the amino acid substitution at amino acid 595 in patient P866 partially restored DNA binding compared to the P321 receptor. This low level of receptor function not evident in the transfection assays may be responsible for the slight virilization in subject P866. The results presented here have several implications. First, they reinforce the supposition that findings in in vitro systems or transfection assays provide insight into the behavior of steroid receptors in intact organisms. Second, at this juncture. the category of receptorbinding positive androgen resistance comprises a relatively homogenous group in which the mutant receptors predicted for such individuals contain mutations within the DNA-binding domain of the receptor that impair binding to target DNA sequences. Finally, the phenotype and the biochemical properties of the mutant P866 receptor indicate that a mutation at position 595 (Ser+Gly) partially overcomes the effect of the arginine to proline substitution at amino acid residue 615, implying a compensatory change in conformation that would be difficult to predict on the basis of available structural information. In the only previously identified mutant androgen receptor containing two amino acid substitutions, the two substitutions interacted to impair receptor function (24). It is likely that other examples in which two mutations interact to ameliorate or accentuate receptor function remain to be uncovered.

413

MATERIALS Patient

AND METHODS

Material

The binding characteristics of the androgen receptor (3) and the underlying mutation (2) have been reported for subject 321, a 17-yr-old woman with complete testicular feminization, Subject 864 was a 46,XY phenotypic woman with normal breast development and a negative family history, who was evaluated by Dr. Michael Soules of Seattle, WA, for primary amenorrhea and who had male levels of plasma testosterone and the ohvsical features and laoaroscooic findinas of complete testioular feminization. Subject 881 was a- 15-yr-old, 46,XY girl, a patient of Drs. Gloria Weinstein and Lawrence Vidrine of Tacoma, WA, who had the phenotype of complete testicular feminization, a plasma testosterone level of 6 rig/ml, and a similarly affected sister and maternal first cousin. Subject 866, a patient of Dr. Michael Soules of Seattle, WA, was a 25yr-old, 46,XY woman with a plasma testosterone level of 6.5 rig/ml and a negative family history, who was evaluated for primary amenorrhea and was classified as having incomplete testicular feminization because of the presence of facial hirsutism, normal axillary and pubic hair, and clitoromegaly. On the basis of the initial studies of ligand binding, subject 866 was originally classified as having receptor-positive resistance (1); however, when a dissociation rate abnormality was identified, she was reclassified as having a qualitative abnormality of the androgen receptor. The various characteristics of ligand binding in the four patients studied here are summarized in Table 1. Polymerase

Chain

Reaction

Segments of the androgen receptor gene were amplified from genomic DNA using the polymerase chain reaction (25). These segments were subcloned into bacteriophage Ml 3. Nucleotide sequence analysis was performed using Sanger dideoxy sequencing protocols (26). Each mutation was confirmed in fragments derived from at least two separate amplification reactions. Mutagenesis

The point mutations detected in the androgen receptor gene of subjects 321,864,866, and 881 (see Fig. 1) were introduced into the sequence of the normal androgen receptor cDNA using the polymerase chain reaction (25). In each instance, two pairs of oligonucleotides were employed to obtain the DNA fragments containing the desired mutations. The sequences of the oligonucleotides used to introduce the mutations using the polymerase chain reaction are shown in Table 4. The oligonucleotide pairs were used in separate reactions to insert the desired mutation into overlapping segments of the normal androgen receptor cDNA-coding segment. The product of each reaction was isolated, mixed, and amplified using the flanking oligonucleotides 218 Saul and 710 Xba for 864 and 881 samples. To obtain the 866 mutant cDNAs, the overlapping segments were amplified using oligonucleotides mutH3 and 710 Xbal. In the case of the 866 mutations, we performed mutagenesis reactions using two different templates: the normal androgen receptor cDNA and the P321 cDNA (2), the former giving rise to the mutation encoded by the plasmid P866-1 and the second giving rise to the mutations encoded by plasmid 866-2. In each instance, mutations were transferred into an expression plasmid by digestion of the amplified fragments with the restriction endonucleases Xbal and Saul (for the 864 and 881 cDNAs) or with Xbal and Hindlll (for the 866-l and 866-2 cDNAs), followed by ligation into the androgen receptor expression plasmid that had been digested previously with the appropriate restriction endonucleases (see Fig. 2). The resulting plasmids, designated CMV864, CMV881, CMW866-1, CMV866-2, and CMV321,


MOL 414

ENDO.

Table

4. Oligonucleotides

Androgen

Vol6

Used

in Mutagenesis

Experiments

Receptor

Expression Plasmid Desianation

Ohgonucleotide

Oligonucleotide

Pair 1

CMV321

Ref. 2

(Ref.

CMV864

Oligonucleotide (sense) CCCAGAAGACCTACCTGATCTGTGGA

Oligonucleotide (antisense) TCCACAGATCAGGTAGGTCTTCTGGG -

Oiigonucleotide (see Ref. 25)

CMV881

CMV866-1

(antisense)

71 OXbal

71 OXbal

(antisense)

71 OXbal

2)

(antisense)

Oligonucleotide (see above)

218Saui

Normal

AR cDNA

Normal

AR cDNA

Normal

AR cDNA

Normal

AR cDNA

(sense)

Oligonucleotide (see Ref. 25)

mutH3

(sense)

Oligonucleotide (antisense) GCAATCATTTCTGCCGGCGCACAGGTA

(antisense)

cDNA Template

Oligonucleotide 218Saul (sense) ACGAATTCACGGCTACACTCGGCCCCCTCAGGGGCT

Oligonucleotide (antisense) GCAATCATTTCTGCCGGCGCACAGGTA

Oligonucleotide (sense) TACCTGTGCGCCGGCAGAAATGATTGC Oligonucleotide (see Ref. 25)

Pair 2

Oiigonucleotide (antisense) CTTGCAGCTTCCACGTGTGAGAGCTCCATA

Oligonucleotide (sense) TACCTGTGCGCCGGCAGAAATGATTGC Oligonucleotide (see Ref. 25)

CMV866-2

71 OXbal

Oligonucleotide (sense) TATGGAGCTCTCACACGTGGAAGCTGCAAG Oligonucleotide (see Ref. 25)

Oligonucleotide (see Ref. 25)

contain the nucleotide substitution detected in the androgen receptor genes of these subjects. The oligonucleotides employed and a schematic of the expression plasmids used are included in Table 4 and Fig. 2. In each case the presence of the desired substitutions and the absence of other mutations in the expression plasmids were verified by nucleotide sequence analysis. Cell Culture

No. 3

and Transfection

The CHO and CVl cell lines were obtained from the American Type Culture Collection (Rockville, MD). The CHO cell line was maintained in Ham’s F-l 2 medium containing 10% fetal bovine serum. The CVl cell line was maintained in Minimum Essential Medium containing 10% fetal bovine serum. Fibroblast cell lines were established from foreskin or genital skin biopsies and were grown in Dulbecco’s Modified Essential Medium supplemented with 10% fetal bovine serum and 1% penicillin and 1% streptomycin. Cell transfection was performed using the calcium phosphate precipitation method (27). Transient transfection of CVl cells were performed using 200 ng androgen receptor expression vector, 10 pg MMTV-CAT reporter plasmid, and 1 rg pgalactosidase expression plasmid pCHll0 as the control (28). Cells were stimulated for 48 h in 5% serum treated with dextran-coated charcoal containing no steroid or 2 nM 5~ dihydrotestosterone beginning 12 h after transfection. Cells were scraped and assayed for CAT and P-galactosidase activities. To study the effects of the mutations on thermostability, Kd, and dissociation rate of ligand from the androgen receptor, CHO cells were stably transfected with the androgen receptor expression vector and the selectable marker pSV2neo. Stable

mutH3

CMV

P321

cDNA

(sense)

transfected cells (-50-I 50 independent colonies) were selected using G418 and propagated as pools of cells. The androgen receptor expressed in these stably transfected cells was then characterized. Ligand

Binding

The ligand-binding properties of the mutant androgen receptors were examined by stable transfection of CHO cells with the expression vectors encoding normal and mutant androgen receptors and the dominant selectable marker pSV2neo (6). After selection with the antibiotic G418, pools of the resistant cells (50-l 00 each) were characterized in monolayer binding assays to determine the binding capacity of dihydrotestosterone binding, the apparent K,, of the receptor, the rate of ligand dissociation, and the stability of the hormone-receptor complex at elevated temperatures (3,4). Mobility

Shift Assays

Mobility shift assays were performed using a partially purified preparation of the normal and mutant androgen receptorglutathione fusion proteins (10). In these experiments the synthetic glucocorticoid response element (GRE) was derived from the sequence of the GRE previously defined within the MMTV-LTR (11, 12). Approximately 45 fmol(30,OOO cpm; 1.2 x 10’ dpm/pg) end-labeled GRE were incubated with 1 fmol human androgen receptor fusion proteins in mobility shift buffer [lo mM Tris (pH 7.5) 1 mM dithiothreitol, 50 mM KCI, and 10% glycerol] and 1 fig poly(dl/dC) at 4 C for 30 min and at 37 C for 30 min. After incubation, the samples were electrophoresed on 4% native polyacrylamide gels at 4 C, dried, and


Mutations

in the DNA-Binding

visualized by autoradiography. The quantities of human androgen receptor fusion protein were controlled in two ways. First, the amount of receptor added was adjusted such that each incubation included 1 fmol labeled human androgen receptor fusion protein, as detected by labeling with [3H]mibolerone (10). These quantities were further verified by subjecting these preparations to immunoblot analysis using antibodies directed at the carboxy-terminus of the receptor protein, as previously described (13).

Acknowledgments

Received September 23, 1991. Revision received December 9, 1991. Accepted December 11, 1991. Address requests for reprints to: Michael J. McPhaul, M.D., Department of Internal Medicine, University of Texas Southwestern Medical Center. 5323 Harrv Hines Boulevard, Dallas, Texas 75235-8857. This work was supported by Grant DK-03892 from the NIH, a Basil O’Connor Award from the March of Dimes (no. 5-694) the Medical Life and Health Insurance Medical Research Fund, the Charles E. Culpeper Foundation, Inc., the Robert A. Welch Foundation (no. l-1090) and a grant from the Perot Family Foundation.

REFERENCES 1. Griffin JE, Wilson JD 1989 The androgen resistance syndromes: &reductase deficiency, testicular feminization, and related disorders. In: Striver CR, Beaudet AL, Sly WS, Valle D (eds) The Metabolic Basis of Inherited Disease. McGraw-Hill, New York, DD 1919-l 944 2. Marcelli M, Zoppi. S, Grino PB, Griffin JE, Wilson JD, McPhaul MJ 1991 A mutation in the DNA-bindinq domain of the androgen receptor gene causes complete Testicular feminization in a patient with receptor-positive androgen resistance. J Clin Invest 87:1123-l 126 3. Griffin JE, Durrant JL 1982 Qualitative receptor defects in families with androgen resistance: failure of stabilization of fibroblast cytosol androgen receptor. J Clin Endocrinol Metab 551465-474 4. Grino PB, Isidro-Gutierrez RF, Griffin JE, Wilson JD 1989 Androgen resistance associated with a qualitative abnormality of the androgen receptor and responsive to high dose androgen therapy. J Clin Endocrinol Metab 68:578-

584 5. Tillev

415

Domain

WD. Marcelli M. Wilson JD. McPhaul MJ 1989 Characterization and expression of g cDNA encoding the human androgen receptor. Proc Natl Acad Sci USA 86:327-331 6. Southern PJ, Berg P 1982 Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter. J Mol Appl Genet 11327-341 7. Darbre P, Page M, King RJB 1986 Androgen regulation by the long terminal repeat of mouse mammary tumour virus. Mol Cell Biol 6:2847-2854 8. Cato ACB, Henderson D, Ponta H 1987 The hormone response element of the mouse mammary tumour virus DNA mediates the progestin and androgen induction of transcription in the proviral long terminal repeat region. EMBO J 6:363-368 9. Ham J, Thomson A, Neddham M, Webb P, Parker M 1988 Characterization of response elements for androgens, glucocorticoids, and progestins in mouse mammary tumor virus. Nucleic Acids Res 16:5263-5277 10. Smith DB, Johnson KS 1988 Single-step purification of polypeptides expressed in E. co/i as fusion proteins with g1utathione-Stransferase. Gene 67:31-40

11. Roehrborn CG, Zoppi S, Gruber JA, Wilson CM, McPhaul MJ, Expression and characterization of full-lenath and partial androgen receptor fusion proteins. Implicazons for the production and applications of soluble steroid receptors in E. co/i. Mol Cell Endocrinol. in Dress 12. Payvar F, Defranco D, Firestone GL, Edgar B, Wrange 0, Okret S, Gustaffson J-A, Yamamoto KR 1983 Seauencespecific binding of glucocorticoid receptor to MT\/ DNA at sites within and upstream of the transcribed region. Cell 35:381-392 13. Husmann DA, Wilson CM, McPhaul MJ, Tilley WD, Wilson JD 1990 Antipeptide antibodies to two distinct regions of the androgen receptor localize the receptor protein to the nuclei of target cells in the rat and human prostate. Endocrinoloav 126:2359-2368 14 Hollenberg CM, Giguere V, Sequi P, Evans RM 1987 Colocalization of DNA-binding and transcriptional activation functions in the human glucocorticoid receptor. Cell 49:39-46 15 Schena M, Freedman LP, Yamamoto KR 1989 Mutations in the glucocorticoid receptor zinc finger region that distinquish interdiqitated DNA bindina and transcriotional enhancement activities. Genes Dev3:1590-1601 ’ 16 Danielsen M, Hinck L, Ringold GM 1989 Two amino acids within the knuckle of the first zinc finger specify DNA response element activation by the glucocorticoid receptor. Cell 57:1131-l 138 17 Gronenmeyer H, Turcotte B, Quirin-Stricker C, Bocquel MT, Mever ME, Krozowski Z. Jeltsch JM. Lerouae T. Garnier JM, Chambon P 1987 The chicken progest&one receptor: sequence, expression, and frunctional analysis. EMBO J 6:3985-3994 18. Mader S, Kumar V, de Verneuil H, Chambon P 1989 Three amino acids of the estrogen receptor are essential to distinguish an estrogen from a glucocorticoid responsive element. Nature 338:271-274 19 Hughes MR, Malloy PJ, Kieback DK, Kesterson RA, Pike JW, Feldman D, O’Malley BW 1988 Point mutations in the human vitamin D receotor aene associated with hv-, pocalcemic rickets. Science 2451702-l 705 20 Sone T, Scott RA, Hughes MR, Malloy PJ, Feldman D, O’Malley BW, Pike JW 1989 Mutant vitamin D receptors which confer hereditary resistance to 1,25-dihvdroxvvitamin D3 in humans are transcriptionally inactive in vi&o. J Biol Chem 264:20330-20234 21. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889-895 22 Hard T, Kellenback E, Boelens R, Maler BA, Dahlman K, Freedman LP, Carlstedt-Duke J, Yamamoto KR, Gustafsson J-A, Kaptein R 1990 Solution structure of the glucocorticoid receptor DNA-binding domain. Science 249:157-l 60 23. Luisi BF, Xu WX, Otwinowski Z, Freedman LP, Yamamoto KR, Sigler PB 1991 Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352:497-505 24 McPhaul MJ, Marcelli M, Tilley WD, Griffin JE, IsidroGutierrez RF, Wilson JD 1991 Molecular basis of androaen resistance in a familv with aualitative abnormalitv of The androgen receptor and responsive to high-dose’androgen therapy. J Clin Invest 87:1413-l 421 25. Marcelli M, Tilley WD, Griffin JE, Wilson JD, McPhaul MJ 1990 Definition of the human androqen receptor aene structure permits the identification of mutations that cause androgen resistance: premature termination of the receptor protein at amino acid residue 588 causes complete androgen resistance. Mol Endocrinol4:1105-1116 26. Sanger F, Carlson AR, Barrel1 BG, Smith AJH, Roe BA 1980 Cloning in single-stranded bacteriophage as an aid to rapid DNA-sequencing. J Mol Biol 143:161-1,78 27. Frost E, Williams J 1978 Mapping temperature sensitive and host-range mutations of adenovirus type 5 by marker rescue. Viroloov 91:39-50 28. Hall C, Jacob-P, Ringold G, Lee F 1983 Expression and regulation of Escherichia co/i LacZ gene fusions in mammalian cells. J Mol Appl Genet 2:101-l 09


Definition of the human androgen receptor gene structure permits the identification of mutations that cause androgen resistance: premature termination of the receptor protein at amino acid residue 588 causes complete androgen resistance.

A mutation in the DNA-binding domain of the androgen receptor gene causes complete testicular feminization in a patient with receptor-positive androgen resistance.

Domain functions of the androgen receptor.

Immunoreactive androgen receptor expression in subjects with androgen resistance.

Amino acid substitutions in the sixth transmembrane domain of P-glycoprotein alter multidrug resistance.

Androgen receptor splice variants activating the full-length receptor in mediating resistance to androgen-directed therapy.

Structure of the homodimeric androgen receptor ligand-binding domain.

Expression of Androgen Receptor in Estrogen Receptor-positive Breast Cancer.

Ketoconazole binds to the human androgen receptor.

Location of androgen receptor in human skin.

Androgen resistance associated with a mutation of the androgen receptor at amino acid 772 (Arg----Cys) results from a combination of decreased messenger ribonucleic acid levels and impairment of receptor function.

Decreased levels of the androgen receptor in the mature rat phallus are associated with decreased levels of androgen receptor messenger ribonucleic acid.

Characterization of human androgen receptor overexpressed in the baculovirus system.

Androgen-binding proteins in rat epididymis: properties of a cytoplasmic receptor for androgen similar to the androgen receptor in ventral prostate and different from androgen-binding protein (ABP).

Promoter-dependent activity on androgen receptor N-terminal domain mutations in androgen insensitivity syndrome.

Retinoic acid receptor beta and angiopoietin-like protein 1 are involved in the regulation of human androgen biosynthesis.

Characterization of niphatenones that inhibit androgen receptor N-terminal domain.

Androgen receptor roles in insulin resistance and obesity in males: the linkage of androgen-deprivation therapy to metabolic syndrome.

Androgen suppresses the proliferation of androgen receptor-positive castration-resistant prostate cancer cells via inhibition of Cdk2, CyclinA, and Skp2.

The 56 kDa androgen-binding protein in human genital skin fibroblasts: its relation to the human androgen receptor.

Sintokamide A Is a Novel Antagonist of Androgen Receptor That Uniquely Binds Activation Function-1 in Its Amino-terminal Domain.

Neutral amino acid transport in an androgen-dependent epithelium.

An exonic point mutation of the androgen receptor gene in a family with complete androgen insensitivity.

Amino acid substitutions in the factor VIII coagulation protein that cause hemophilia A in man.