408
EXPRESSION IN YEAST
[34]
[34] a-Factor Leader-Directed Secretion of Heterologous Proteins from Yeast B y A N T H O N Y J. B R A K E
The development of a wide variety of useful plasmid vectors, promoters, and host strains, combined with the foundation of classical genetic and biochemical methods, has resulted in the emergence of the bakers' yeast Saccharomyces cerevisiae as the most widely used eukaryotic microorganism for the expression of heterologous proteins. Almost any gene product can now be expressed at some level in yeast, and there are many examples of foreign proteins being expressed at levels higher than any endogenous yeast protein.l With the well-developed methods available for the propagation of yeast to very high cell densities and in large volumes of inexpensive media, such recombinant yeast strains are ideal for the production of proteins on an industrial scale. On the other hand, readily available vectors and strains, 2 as well as simple equipment and media requirements, make the production of proteins for research use possible in virtually any biology or biochemistry laboratory. The secretion of heterologous proteins from yeast is particularly desirable, since the level of endogenous secreted proteins is quite low, thus greatly simplifying the purification of the desired protein. In addition, disulfide bonds are more likely to be properly formed in proteins passing through the secretory pathway than in proteins expressed in the reducing environment of the cytoplasm and then oxidized after cell breakage. A number of different leader sequences have been employed to direct the secretion of proteins from S. cerevisiae. In a few cases, expression of the naturally occurring precursor forms of foreign proteins has resulted in the secretion of the correctly processed, mature proteins. 3-5 More commonly, fusions of leader sequences from yeast proteins such as invertase 6,7 have P. J. Barr, A. J. Brake, and P. Valenzuela, "Yeast Genetic Engineering." Butterworth, Stoneham, Massachusetts, 1989. 2 S. A. Parent, C. M. Fenimore, a n d K. A. Bostian, Yeast 1, 83 (1985). 3 R. A. Hitzeman, D. W. Leung, L. J. Perry, W. J. Kohr, H. L. Levine, and D. V. Goeddel, Science 219, 620 (1983). 4 M. A. Innis, M. J. Holland, P. C. McCabe, G. E. Cole, V. P. Wittman, R. Tal, K. W. K. Watt, D. H. Gelfand, J. P. Holland, and J. H. Meade, Science 228, 21 0985). s T. Sato, S. Tsunasawa, Y. Nakamura, M. Emi, F. Sakiyawa, and K. Matsubara, Gene 50, 247 (1986). 6 R. A. Smith, M. J. Duncan, and D. T. Moir, Science 229, 1219 (1985). 7 C. N. Chang, M. Matteucci, L. J. Perry, J. J. Wulf, C. Y. Chen, and R. A. Hitzeman, Mol. Cell. Biol. 6, 1812 (1986).
METHODS IN ENZYMOLOGY, VOL. 185
Copyright© 1990by AcademicPress,Inc. All rightsof reproductionin any formreserved.
[34]
YEAST SECRETION OF HETEROLOGOUSPROTEINS
409
been used to direct the secretion of heterologous proteins. The focus of this article is on the use of the leader sequence of the precursor of the yeast mating hormone a-factor, which has been the leader most widely used for the secretion of foreign proteins from yeast,s Secretion in S a c c h a r o m y c e s c e r e v i s i a e Saccharomyces cerevisiae has become an important model system for the study of protein transport secretion. Of particular importance has been the isolation of a large collection of sec mutants blocked at specific points in the secretory pathway at a nonpermissive temperature? Considerable biochemical and genetic evidence demonstrates that the pathways of protein transport and secretion in yeast appear to have much in common with those in other eukaryotic organisms) °,~ The large amount of research being carried out on protein transport and secretion in yeast continues to provide an increasingly detailed understanding of the underlying cell biology and biochemistry. As in other eukaryotes, N-linked and O-linked carbohydrate chain addition occurs onto proteins transported to the cell surface or to the lysosome-like vacuole. This is an important consideration when attempting to secrete heterologous proteins containing sites (Asn-X-Thr/Ser) for asparagine-linked or O-linked carbohydrate addition. Although the structure of the core oligosaccharide transferred to Asn residues of yeast glycoproteins is identical to that found in mammalian glycoproteins, subsequent modifications of these chains are quite different in yeast) 2 Instead of the extensive "trimming" of the oligosaccharide core and subsequent addition of sialic acid, galactose, and N-acetylglucosamine as in mammalian cells, secreted yeast glycoproteins undergo less extensive trimming of the core followed by elongation with long "outer chains" of mannose residues (50 or more). As a result of these differences, heterologous glycoproteins secreted from yeast may be inactive or antigenically different from the natural proteins. This may be especially important in the case of proteins
8A. J. Brake, in "Yeast Genetic Engineering"(P. J. Barr, A. J. Brake, and P. Valenzuela, eds.), p. 269. Butterworth,Boston,Massachusetts,1989. 9 p. Novick,C. Field,and R. Schekman,Cell 21,205 (1980). toR. Schekman and P. Novick, in "The Molecular Biologyof the Yeast Saccharomyces cerevisiae: Metabolism and Gene Expression"(J. N. Strathern, E. W. Jones, and J. R. Broach, eds.), p. 361. Cold Spring Harbor Laboratory,Cold Spring Harbor, New York, 1982. 11R. Schekman,Annu. Rev. CelIBiol. 1, 115 (1985). ~2C. E. Ballou, in "The MolecularBiologyof the Yeast Saccharomyces cerevisiae:Metabolism and Gene Expression"(J. N. Strathern, E. W. Jones, and J. R. Broach,eds.), p. 335. Cold Spring Harbor Laboratory,Cold SpringHarbor, New York, 1982.
410
EXPRESSION IN YEAST
[34]
destined for human therapeutic use.'3 Efforts have been made to eliminate or minimize this problem through the use of yeast mutants defective in the ability to add outer-chain oligosaccharides. '4,'5 Secreted yeast proteins also contain short mannooligosaccharide chains of one to four residues attached to serine and threonine residues. As in the case of mammalian glycoproteins, no defined amino acid sequence signal for this modification has been found. Heterologous proteins secreted from yeast have been found to be O-glycosylated at the same sites found in the natural p r o d u c t s . 4,16,17 Biosynthesis of a-Factor Haploid S. cerevisiae cells of the a mating type secrete a 13-residue peptide required for efficient mating with cells of the opposite a mating type. ~s Like other peptide hormones, a-factor is derived from larger precursor polypeptides encoded by two structural genes, MFotl and MFa2.'9,20 The protein sequence deduced from the major structural gene M F a l , shown in Fig. l, is a 165-residue polypeptide containing four repeats of the mature a-factor peptide, each preceded by a spacer peptide of 6-8 residues with the structure Lys-Arg-(Glu/Asp-Ala)2_a. These repeats are preceded by an 83-residue leader sequence containing a hydrophobic signal sequence and three potential sites for Asn-linked oligosaccharide addition. The minor M F a 2 gene encodes a similar precursor polypeptide containing only two repeats of the mature a-factor peptide. Immunochemical analysis of a-factor-related species, resulting from in vitro translation during passage through the secretory pathway in various sec mutants confirmed that a-factor is derived from larger, glycosylated ,a M. A. Innis, in "Yeast Genetic Engineering" (P. J. Barr, A. J. Brake, and P. Valenzuela, eds.), p. 233. Butterworth, Stoneham, Massachusetts, 1989. ,4 D. T. Moir and D. R. Dumais, GeneS6, 209 (1987). is C. L. Yip, S. K. Welch, T. Gilbert, and V. L. MacKay, Yeast 4, $457 (1988). ,6 j. F. Ernst, J.-J. Mermod, J. F. DeMarter, R. J. Mattaliano, and P. Moonen, Bio/Technology 5, 831 (1987). ~ J. N. Van Arsdell, S. Kwok, V. L. Schweichart, M. B. Ladner, D. H. Gelfand, and M. A. Innis, Bio/Technology 5, 691 (1987). ,s j. Thorner, in "The Molecular Biology of the Yeast Saccharomyces cerevisiae: Life Cycle and Inheritance" (J. N. Strathern, E. W. Jones, and J. R. Broach, eds.), p. 143. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 198 I. 19j. Kurjan and I. Herskowitz, Cell 30, 933 (1982). 20 A. Singh, E. Y. Chen, J. M. Lugovoy, C. N. Chang, R. A. Hitzeman, and P. W. Seeburg, Nucleic Acids Res. 11, 4049 (1983). 2~ A. Brake, D. Julius, and J. Thorner, Mol. Cell. Biol. 3, 1440 (1983). 22 O. Emter, B. Mechler, T. Achstetter, H. Miiller, and D. H. Wolf, Biochem. Biophys. Res. Cornmun. 116, 822 (1983). 23 D. Julius, R. Schekman, and J. Thorner, Cel136, 309 (1984).
[34]
YEAST SECRETION OF HETEROLOGOUS PROTEINS c~o
. :,. ,
oHo c ~
KIrX2
~
KE),(2
l
KF'N2
411
KIrX2
ill
GluAlaAspAlaGluAla]TrpHisTrpLeuGInLeuL ysProGlyGInProMetTyrJLysAro t
t STE13
t
~-FACTOR
t
t
KEXI
FIG. 1. Structure and processingpathway of prcpro-(x-factor.The translation product of the MFcH gene has three sites for Asn-linked oligosaccharideaddition (CHO) and sites for endoproteolytic cleavage by signal peptidase and the Kex2 protease. An expanded view (below) of the peptide releasedby Kex2 cleavageshows sites for exoproteolyticprocessingby products of the STE13 and KEXI genes. precursor polypeptides. 21-23 The translocation and processing o f prepro-ctfactor have also been studied in vitro. 24-26 Processing o f prepro-a-factor requires four different proteolytic activities. The availability o f mutations in the appropriate genes as well as the corresponding cloned genes has resulted in ix-factor being the first peptide h o r m o n e whose processing pathway has been genetically definedY Signal peptidase cleavage occurs between residues 19 and 20 o f the prepro-a-factor. 28 The apparent lack o f an intermediate resulting from signal peptide cleavage of the primary translation product appears to have been due to anomalous gel mobility of the two species. Signal peptide cleavage is blocked in s e c l l mutants, suggesting that S E C l l m a y be the structural gene for signal peptidase. 29 The glycosylated p r o ~ - f a c t o r is subsequently cleaved by an endoproteinase cleaving on the carboxyl side o f the Lys-Arg sequence in the "spacer" peptide o f each repeat. This cleavage is blocked in k e x 2 mutants, resulting in a mating defect in M A T a strains, failure to secrete active killer toxin peptide, and in the secretion o f a hyperglycosylated form of pro-txfactor. 3°,3~ The K E X 2 gene was cloned on the basis o f complementation o f 24j. A. Rothblatt and D. Meyer, Ce1144, 619 (1986). 2s W. Hansen, P. B. Garcia, and P. Walter, Ce1145, 397 (1986). 26M. G. Waters and G. Blobel,J. Cell Biol. 102, 1543 (1986). 27R. S. Fuller, R. E. Sterne, and J. Thorner, Annu. Rev. Physiol. 50, 345 (1988). 2s M. G. Waters, E. A. Evans, and G. Blobel,J. Biol. Chem. 263, 6209 (1988). 29p. C. Bohni, R. J. Deshaies, and R. W. Schekman, J. CellBiol. 106, 1035 (1988). 3oM. J. Leibowitzand R. B. Wickner, Proc. Natl. Acad. Sci. U.S.A. 73, 2062 (1976). 31D. Julius, A. Brake, L. Blair, R. Kunisawa, and J. Thorner, Cell 37, 1075 (1984).
412
EXPRESSION IN YEAST
[34]
kex2 mutants and has been shown to be a membrane-bound, calciumdependent serine protease homologous to subtilisin and related proteases. 32-34
Following excision of each of the repeats from pro-a-factor, maturation to mature a-factor requires exoproteolytic processing at both the C and N termini. The STE13 gene encodes a membrane-bound, heat-stable dipeptidylaminopeptidase, which is responsible for removal of Glu-Ala and Asp-Ala dipeptides from the N terminus of each r e p e a t . 35 Mutations in this gene result in sterility o f a haploids due to the defect in a-factor processing, with no other known phenotype. Also required for maturation of a-factor is removal of the arginyl and lysyl residues at the C terminus of each of the first three repeats. The KEX1 gene has been shown to encode a serine protease (of the trypsin family) with the required carboxypeptidase B-like specificity for C-terminal Lys and Arg residues on a-factor and killer toxin precursors,as The KEX1 gene is essential for production of active killer toxin peptide. The failure of kexl mutants to show an a-specific sterile phenotype is apparently due to the fact that the a-factor species derived from the fourth repeat of preproa-factor does not possess C-terminal Lys and Arg residues, and that a-factor production at a reduced level (presumably about 25% that of an isogenic KEX1 strain) is apparently sufficient for normal mating. Expression in Yeast of Hybrid Proteins Containing the a-Factor Leader In order to determine whether the leader sequence of prepro-a-factor contained sufficient sequence information for targeting a-factor for secretion and processing, and whether this could be utilized for a general secretion system, gene fusions were constructed which joined the prepro region to various other proteins. The first such hybrid protein reported contained a portion of the M F a l gene encoding the leader region of prepro-a-factor fused to a portion of the SUC2 gene encoding the secreted yeast enzyme invertase.37 Yeast transformants expressing this fusion exported active invertase to the cell surface. This report was soon followed by 32 K. Mizuno, T. Nakamura, T. Ohshima, S. Tanaka, and H. Matsuo, Biochem. Biophys. Res. Commun. 156, 246 (1988). 33 R. S. Fuller, A. Brake, and J. Thorner, Proc. Natl. Acad. Sci. U.S.A. 86, 1434 (1989). R. S. Fuller, A. J. Brake, and J. Thorner, Science 245, 482 (1989). 35 D. Julius, L. Blair, A. Brake, G. Sprague, and J. Thorner, Cell32, 839 (1983). 36 A. Dmochowska, D. Dignard, D. Henning, D. Y. Thomas, and H. Bussey, Cell 50, 573 (1987). 37 S. D. Emr, R. Schekman, M. C. Flessel, and J. Thorner, Proc. Natl. Acad. Sci. U.S.A. 80, 7080 (1983).
[34]
YEAST SECRETION OF HETEROLOGOUS PROTEINS
413
reports of the expression of fusions of the a-factor leader to proteins foreign to yeast. In these studies, the fusion partners were the human proteins epidermal growth factor (hEGF), 3s fl-endorphin, a consensus interferon a (IFN-cont), 39 and interferon a l (IFN-al). 4° These genes encoded none of the leader sequences present in the human precursor proteins and therefore must have been targeted for secretion and processing in yeast by the a-factor leader sequence, since direct expression of mature hEGF and IFN-al in yeast had resulted in no secretion of these proteins. 41'42 In fact, expression of hEGF as a fusion resulted in an increase in production level from ~30 gg/liter for internal expression to greater than l mg/liter for secretion. In the case of IFN-al, secretion directed by the a-factor leader resulted in more efficient export and more precise processing than that seen for secretion directed by the naturally occurring IFN signal sequence. Since these reports, many other proteins have been successfully secreted using the a-factor leader system,s thus demonstrating its general utility, as well as providing insight into the biosynthesis and secretion of a-factor and other yeast proteins. " I m p r o v e m e n t s " in a-Factor Secretion Systems Although there is an increasing list of proteins which have been efficiently expressed and secreted from yeast using the a-factor leader, other proteins have proved refractory to efficient secretion and/or processing using the same expression. A number of laboratories have introduced modifications to overcome limitations or problems which have arisen in the basic a-factor expression system for secretion of various heterologous proteins. Initial studies on expression of a-factor fusions took advantage of a convenient HindlII site in the M F a l gene at the junction of the leader and the first a-factor repeat (Fig. 2). The resulting fusions thus contained spacer peptide sequences, requiring the action of the STEI3 gene product for complete maturation of the secreted product. It was found that a large 38 A. J. Brake, J. P. Merryweather, D. G. Coit, U. A. Hebedein, F. R. Masiarz, G. T. Mullenbach, M. S. Urdea, P. Valenzuela, and P. J. Barr, Proc. Natl. Acad. Sci. U.S.A. 81, 4642 (1984). 39 G. A. Bitter, K. K. Chen, A. R. Banks, and P.-H. Lai, Proc Natl. Acad. Sci. U.S.A. 81, 5330 0984). 40 A. Singh, J. M. Lugovoy, W. J. Kohr, and L. J. Perry, Nucleic Acids Res. 12, 8927 0984). 4, M. S. Urdea, J. P. Merryweather, G. T. Mullenbach, D. Coit, U. Heberlein, P. Valenzuela, and P. J. Barr, Proc. Natl. Acad. Sci. U.S.A. 80, 7461 (1983). 42 R. A. Hitzeman, F. E. Hagie, H. L. Levine, D. V. Goeddel, G. Ammerer, and B. D. Hall, Nature (London) 293, 717 0981).
414
EXPRESSION IN YEAST
[34]
A MF~I
GluGluGlyValSerLeuAspLysArgGluAlaGluAla GAAGAAGGGGTATCTTTGGATAAAAGAGAGGCTGAAGCTT CTTCTTCCCCATAGAAACCTATTTTCTCTCCGACTTCGAA HindIII
pABI26
GluGluGlyValSerLeuAspLysArg GAAGAAGGGGTATCTCTAGATAAAAGA CTTCTTCCCCATAGAGATCTATTTTCT XbaI
B a-Factor Leader ---GluGluGlyValSer ---GAAGAAGGGGTATCT - - -CTTCTTCCCCATAGAGATC
AdaPtor LeuAspLysArg CTAGATAAAAGG TATTTTCC XbaI
He~oloaous Protein r I cDNA or Synthetic Gene
// // // 4/
Adap~o r
MFG1 Terminator
AM OC TAGTAAG TCGACTTTGTTCCCAC-ATCATTCAGCT GAAACAAGGGTG- SalI
Fro. 2. Sequences around the junction of a-factor leader fusions. (A) DNA sequences and protein translation of the M F a l gene and the modification found in pAB126. (B) Strategy to clone a hypothetical heterologous gene, with blunt ends, into the a-factor leader vector pAB 126, using synthetic oligonucleotide adaptors.
fraction of the secreted hEGF, IFN, and p-endorphin contained an N-terminal extension corresponding to the (Glu-Ala), spacer sequence. This indicated that the STE13-encoded dipeptidylaminopeptidase is present in an amount insufficient to process the high levels of protein expressed by these synthetic genes. This had been encountered previously in strains overexpressing a-factor due to the presence of the MFa I gene on a highcopy plasmid: 5 These strains secreted forms of a-factor similar to that secreted by stel3 mutants. Two approaches have used to overcoming this problem for proteins secreted from yeast. The first method was initially described for a-factor leader fusions of hEGF 3s and IFN-a 1,4° and involved site-directed mutagenesis of the fusion genes to delete the portion of these genes encoding the spacer (Glu-Ala), dipeptides. Such modified genes were found to result in efficient secretion of the heterologous proteins at levels similar to that seen for the original, spacer-containing fusions. These results indicated that the spacer regions of prepro-a-factor were not essential for transport or processing by the KEX2 protease. Subsequent a-factor leader fusions have thus usually utilized this direct joining of the heterologous protein to the Lys-Arg processing site of the a-factor leader.
[34]
YEAST SECRETION OF HETEROLOGOUS PROTEINS
415
The second approach to circumventing the limiting amount of the STEI3 dipeptidylaminopeptidase present in yeast host strains is to increase the expression of this enzyme by including the cloned S T E I 3 gene on the same plasmid as the a-factor leader fusion gene. Although there have been no reports of the use of this approach for heterologous proteins, a plasmid containing both the M F a l and STE13 genes was reported to increase the amount of active a-factor over that produced from a plasmid containing only the M F a l gene.43 The expression of some a-factor leader fusions lacking spacer peptide sequences has resulted in the intracellular accumulation or secretion of unprocessed and partially processed forms, while the same fusions conraining (Glu-Ala) spacers are efficiently processed by the KEX2 protease. Zsebo et al.~ carded out Western blot analysis of proteins secreted from yeast strains expressing a-factor leader-IFN-a 1 fusions. Fusions lacking a spacer peptide resulted in secretion of considerable levels (> 50%) of unprocessed, heavily glycosylated fusion protein. This product is analogous to the hyperglycosylated pro-a-factor species secreted from kex2 mutants. 31 Yeast transformants expressing similar fusions including a (Glu-Ala)2 spacer efficiently secreted fully processed IFN. Thus, some fusions linked directly to the Lys-Arg processing site must be poor substrates for the KEX2 protease. However, the presence of the charged spacer peptide may convert such fusions to good substrates. The expression of the STEI3 gene may have to be increased as described above to provide complete processing of such spacer-containing fusions. Increased expression of the KEX2 gene provides an alternative solution to poor processing at the Lys-Arg site. This approach has been employed to improve the secretion of correctly processed transforming growth factor a (TGF-a) from an a-factor leader-TGF-a fusion. 45 Expression of an a-factor leader-TGF-a fusion resulted in the secretion of both properly processed TGF-a and higher molecular weight species, which were presumably variously glycosylated forms of the uncleaved fusion protein. Insertion of the KEX2 gene into the multicopy plasmid carrying the a-factor leader-TGF-a fusion gene resulted in the elimination of these unprocessed forms of the fusion protein with a corresponding increase in the secretion of properly processed TGF-a. 43 D. Barnes, L. Blair, A. Brake, M. Church, D. Julius, R. Kunisawa, J. Lotko, G. Stetler, and J. Thorner, Recent Adv. Yeast Mol. Biol. 1,295 (1982). 44 K. M. Zsebo, H.-S. Lu, J. C. Fieschko, L. Goldstein, J. Davis, K. Duker, S. V. Suggs, P.-H. Lai, and G. A. Bitter, J. Biol. Chem. 261, 5858 (1986). 45 p. j. Barr, H. L. Gibson, C. T. Lee-Ng, E. A. Sabin, M. D. Power, A. J. Brake, and J. R. Shuster, in "Industrial Yeast Genetics" (M. Korhola and H. Nevalainen, eds.), p. 139. Foundation for Biochemical and Industrial Fermentation Research, Heisinki, 1987.
416
EXPRESSION IN YEAST
[34]
As is the case when any yeast secretion system is used for the production of heterologous proteins, N-linked glycosylation of Asn residues in these proteins may result in undesirable differences between the yeast-produced and natural proteins, as discussed above. Site-directed mutagenesis of the sites for addition of N-linked oligosaccharide can be used to eliminate the production of glycosylated proteins entirely.~6.46.47However, such modified genes will still result in production of proteins which may be antigenically distinct from the naturally occurring proteins. As discussed above, one may also use host yeast strains carrying mutations which reduce the amount of outer-chain mannose a d d i t i o n . 14,15,4g,49 It is not currently possible, however, to produce giycoproteins in yeast with oligosaccharide structures identical to those found in mammalian cells. In addition to defined modifications of the a-factor secretion system, one may screen, using either an immunological or enzymatic assay, for random mutations resulting in improved secretion efficiency. Such an approach resulted in the isolation of yeast mutants showing improved secretion efficiency of bovine prochymosin produced from invertase leader fusions. 6 Two of these mutants also showed increase secretion efficiency for a-factor leader-prochymosin fusions. Finally, the transcription of a-factor leader gene fusions may be increased by substituting a stronger promoter, such as one of the promoters of the structural genes for the glycolytic enzymes, for that of the MFal, or placed under control of an easily regulated promoter such as that of the ADH2 gene encoding the repressible alcohol dehydrogenase.5° Interestingly, it has been reported that the use of a weaker promoter results in increased secretion of insulin-like growth factor I (somatomedin C). 5~ Construction of a-Factor Fusions A number of different cloning strategies have been used for construction of genes encoding fusions of the a-factor leader with heterologous proteins. Initial studies utilized a fortuitously positioned HindIII site at the ,5 V. L. MacKay, in "Biological Research on Industrial Yeasts" (G. G. Stewert, I. Russell, R. D. Klein, and R. R. Hiebsch, eds.), Voi. 2, p. 27. CRC Press, Boca Raton, Florida, 1986. 4v A. Miyajima, K. Otsu, J. Schreurs, M. W. Bond, J. S. Abrams, and K. Arai, Embo J. 5, 1193 (1986). P. K. Tsai, J. Frevert, and C. E. Ballou, J. Biol. Chem. 259, 3805 (1984). 49 p. W. Robbins, in "Biological Research on Industrial Yeasts" (G. G. Stewert, I. Russell, R. D. Klein, and R. R. Hiebsch, eds.), Vol. 2, p. 193. CRC Press, Boca Raton, Florida, 1986. 5oj. R. Shuster, in "Biological Research on Industrial Yeasts" (G. G. Stewert, I. Russell, R. D. Klein, and R. R. Hiebsch, eds.), Vol. 2, p. 20. CRC Press, Boca Raton, Florida, 1986. 51 j. F. Ernst, DATA 5, 483 (1986).
[34]
417
YEAST SECRETION OF HETEROLOGOUS PROTEINS ~8amHl
I
pAB126 Lambda
B amH I...~
MFa 1 Terminator
SalI1
..BamHI
FIG. 3. Map of the plasmid vector pAB126. The asterisk indicates that the XbaI site is methylated, and thus resistant to cleavage, in dam + strains of Escherichia coli.
junction of the a-factor leader and the mature a-factor sequence and a SalI site 20 base pairs beyond the translational termination codon of MFa 1, as shown in Fig. 2. Subsequently, various workers modified the prepro-a-factor coding region to include convenient restriction sites which allow precise fusions to be made directly to the Lys-Arg processing site using specific oligonucleotide adaptors. 38,44,52 Described here is one such modified vector, pAB126, that is commonly used in our laboratory. A map of this plasmid is shown in Fig. 3. It contains a segment of the MFa I gene encoding the leader region, which has been modified to include an XbaI restriction site as shown in Fig. 2. This gene has been fused to the GAP promoter 53 which was derived from the TDH3 gene, one of three structural genes for glyceraldehyde-3-phosphate dehydrogenase. A large (8.2 kb) XbaI-SalI fragment of bacteriophage ;t has been inserted into the MFal gene and is replaced by a gene encoding a protein of interest. 52 A. Miyajima, M. W. Bond, K. Otsu, K. Arai, and N. Arai, Gene37, 155 0985). ~3 S. Rosenberg, D. Coit, and P. Tekamp-Olsen, this volume [28].
418
EXPRESSION IN YEAST
[34]
In order to construct an a-factor leader fusion, pAB 126 is digested with XbaI and SalI and the 4.7-kb vector fragment isolated by preparative
agarose gel electrophoresis. A eDNA or synthetic gene encoding the protein one wishes to have secreted is ligated to this vector after addition of synthetic oligonucleotide adaptors as shown in Fig. 2. The 5' XbaI adaptor is designed to include the K E X 2 processing site and be compatible with a blunt end or an overhang of a convenient restriction site in the heterologous gene, thus producing an in-frame fusion. The 3' SalI adaptor should likewise ligate to an end produced by a restriction site near the 3' end of the heterologous gene, and should include a translational termination codon if one is not contained within the heterologous gene fragment. Once a plasmid containing the correct gene fusion is isolated, the expression "cassette" is excised by digestion with B a m H I and the resulting fragment inserted into a B a m H I site of any appropriate yeast plasmid vector, most of which have unique B a m H I sites. 2 We routinely use the plasmid pAB24 shown in Fig. 4. The expression plasmid may be introduced by transformation of spheroplasts 54 or lithium-treated whole cells55 of an appropriate yeast strain carrying either a ura3 or leu2 mutation. Because the leu2-d allele present in this vector is partially defective,56,57 Leu + transformants cannot be obtained by the lithium transformation method, but must be obtained by spheroplast transformation or by leucine selection of transformants obtained initially by uracil selection. Because of this defective leu2-d allele, however, leucine selection results in extremely high plasmid copy number. Host strains defective for the major proteases, encoded by the P R A 1 (PEP4), PRB1, and PRC1, are particularly useful to minimize proteolytic degradation of secreted products. Such strains can be obtained from the Berkeley Yeast Genetic Stock Center. 5s Analysis of Secretion Products Yeast transformants expressing the a-factor leader fusion are grown in the appropriate liquid selective medium. 59 Yeast cells are removed by centrifugation and the resulting culture supernatant analyzed by sodium dodecyl sulfate (SDS) gel electrophoresis. 6° Usually, the solution must be 54A. Hinnen,J. B. Hicks,and G. R. Fink,Proc. Natl. Acad. Sci. U.S.A. 75, 1929(1978). 55H. Ito, Y. Fukuda,and A. Kimara,J, Bacteriol. 153, 163 (1983). 56j. D. BeRgs,Nature (London) 275, 104 (1978) 57E. Erhart and C. Hollenberg,J. Bacteriol. 156, 625 (1983). 5sYeast GeneticStock Center, Departmentof Biophysicsand MedicalPhysics,Universityof California,Berkeley,California94720. 59F. Sherman, G. R. Fink, and J. B. Hicks, "Methods in Yeast Genetics." Cold Spring Harbor Laboratory,Cold SpringHarbor, New York, 1986. 6oU. K. Laemrnli,Nature (London) 227, 680 (1970).
[34]
YEAST SECRETION OF HETEROLOGOUS PROTEINS
419
ICa L XbaI~ IR
~~u2-d
tet "~t~
am~/t'/
ClaI/ "-#...._.~ ~ \\cl.i* / Hpal XbaI Fro. 4. Map of the yeast plasmid vector pAB24. This plasmid contains the A form of the yeast 2-/lm plasmid (this volume [22]) cloned at the ClaI site of the E. coil vector pBR322, as well as the S. cerevisiae LEU2 and URA3 genes. The asterisks indicate that two of the Clal sites are methylated in dam + strains of E. coil. concentrated to obtain sufficient concentrations to allow visualization of the secreted products. A useful general m e t h o d involves precipitation by trichloroacetic acid (TCA). T o the culture supernatant is added one-fourth volume o f a solution o f 50% TCA, 0.2% sodium deoxycholate (w/v). After 30 min at 00, the precipitate is collected by centdfugation. The resulting pellet is washed first with 10% TCA, then with acetone, and dried under vacuum. This pellet can then be dissolved in SDS gel sample buffer and a
420
EXPRESSION IN YEAST
[34]
sample representing up to 10 ml of culture electrophoresed. The resolved proteins may be visualized by staining with Coomassie blue, silver chloride, 6~ or by Western blot 62 using antibodies directed to the heterologous protein. The cultures analyzed should include a control of the host strain transformed with the vector lacking an expression cassette. Alternatively, the secreted proteins may be concentrated by ultrafiltration or by chromatography using an ion-exchange or hydrophobic interaction resin. In order to determine whether secreted products have been modified by Asn-linked carbohydrate, the concentrated secreted proteins are dissolved by boiling in a small volume of a solution of 1% (w/v) SDS, then diluted and digested with endoglycosidase H. 63 The resulting deglycosylated proteins are then analyzed as described previously. This will sometimes require concentration by one of the previously described methods to avoid undesirable salt effects during electrophoresis. To examine products which may remain cell-associated, cells from the same culture are lysed by boiling in SDS sample buffer, then analyzed by SDS electrophoresis and Western blotting. Alternatively, both secreted and cell-associated products can be analyzed by metabolically labeling yeast cells with radioactive amino acids or 35S-labeled sulfate, then specifically immunoprecipitating proteins using antibodies directed against the heterologous protein. 2a
Conclusion Expression systems based on the yeast a-factor leader have proved to be generally useful for directing the secretion of a wide variety of proteins of both commercial and research interest. Proteins originating from organisms ranging from bacteria to humans have been successfully secreted using the a-factor leader. These proteins vary in size from 14 amino acids (somatostatin~) to over 800 residues (Epstein-Barr virus envelope glycoprotein65), and include a number of proteins which have been refractory to efficient expression using other recombinant DNA systems. A number of these proteins have progressed to the stage of clinical trials, and, in fact, the first recombinant protein approved for use in food products, bovine chy6, C. R. Merril, R. C. Switzer, and M. L. Van Keuren, Anal. Biochem. 105, 361 (1980). 62 W. N. Burnette, Anal. Biochem. 112, 195 (1981). 63 R. B. Trimble and F. Maley, Anal. Biochem. 141, 515 0984). 64 y. Bourbonnais, D. Bolin, and D. Shields, J. Biol. Chem. 263, 15342. 65 L. D. Schultz, J. Tanner, K. J. Hofmann, E. A. Emini, J. H. Condra, R. E. Jones, E. Kieff, and R. W. Ellis, Gene 54, 113 0987).
[35]
SECRETION OF HETEROLOGOUS PROTEINS FROM YEAST
421
mosin, is being produced using the S. cerevisiae a-factor leader in another budding yeast, Kluyveromyces lactis. 66 Although efficient secretion using a-factor leader-based systems is commonly achieved, much more remains to be learned about the basic biology of a-factor secretion, and secretion in general, before optimization of these systems can be achieved. 66 K. Rietveld, J. G. Bakhuis, N. J. Jansen in de Wai, R. W. van Leen, A. C. M. Noordermeer, A. J. J. van Ooyen, A. Schaap, and J. A. van den Berg, Yeast 4, S163 (1988).
[35] U s e o f H e t e r o l o g o u s a n d H o m o l o g o u s S i g n a l Sequences for Secretion of Heterologous Proteins from Yeast By RONALD A. HITZEMAN, CHRISTINAY. CHEN, DONALD J. DOWBENKO, MARK E. RENZ, CnUNG LIU, ROGER PAI, NANCY J. SIMPSON,WILLIAMJ. KOHR, ARJtJN SINGH, VANESSA CHISHOLM, ROBERT HAMILTON,and CHUNG NAN CHANG Introduction The development of yeast genetic engineering has made possible the expression of heterologous genes and the secretion of their protein products from yeast. This article deals exclusively with the yeast Saccharomyces cerevisiae (bakers' yeast). The advantages of secretion (export) of heterologous gene products are clearly exemplified by human serum albumin (HSA), and are discussed in this article. This 65-kDa blood protein has no N-linked glycosylation sites but does have 35 cysteines;1 in the blood, this protein monomer has 17 disulfide linkages3 HSA is misfolded when produced intracellulady in yeast without its amino-terminal secretion peptide sequence. This conclusion is based on its insolubility, loss of greater than 90% of its antigenicity (as compared to human-derived HSA), and formation of large protein aggregates. Using its natural secretion signal to promote secretion into the media of yeast, HSA is soluble and appears to have the same disulfide linkages as the human blood-derived material. As a pharmaceutical product, which will be potentially used in gram amounts in humans, recombinant HSA will require such identity with the natural product. Other advantages of secreting a product into the growth media of yeast are proper R. M. Lawn, J. Adelman, S. C. Bock, A. E. Franke, C. M. Houck, R. C. Najarian, P. H. Seeburg, and K. L. Wion, Nucleic Acids Res. 9, 6103 ( 1981). 2 j. R. Brown, "Albumin Structure, Function, and Uses," p. 27. Pergamon, New York, 1977.
METHODS IN ENZYMOLOGY. VOL. 185
Copyright© 1990by AcademicPress,Inc. All rightsof reproductionin any formreserved.
EXPRESSION IN YEAST
[34]
[34] a-Factor Leader-Directed Secretion of Heterologous Proteins from Yeast B y A N T H O N Y J. B R A K E
The development of a wide variety of useful plasmid vectors, promoters, and host strains, combined with the foundation of classical genetic and biochemical methods, has resulted in the emergence of the bakers' yeast Saccharomyces cerevisiae as the most widely used eukaryotic microorganism for the expression of heterologous proteins. Almost any gene product can now be expressed at some level in yeast, and there are many examples of foreign proteins being expressed at levels higher than any endogenous yeast protein.l With the well-developed methods available for the propagation of yeast to very high cell densities and in large volumes of inexpensive media, such recombinant yeast strains are ideal for the production of proteins on an industrial scale. On the other hand, readily available vectors and strains, 2 as well as simple equipment and media requirements, make the production of proteins for research use possible in virtually any biology or biochemistry laboratory. The secretion of heterologous proteins from yeast is particularly desirable, since the level of endogenous secreted proteins is quite low, thus greatly simplifying the purification of the desired protein. In addition, disulfide bonds are more likely to be properly formed in proteins passing through the secretory pathway than in proteins expressed in the reducing environment of the cytoplasm and then oxidized after cell breakage. A number of different leader sequences have been employed to direct the secretion of proteins from S. cerevisiae. In a few cases, expression of the naturally occurring precursor forms of foreign proteins has resulted in the secretion of the correctly processed, mature proteins. 3-5 More commonly, fusions of leader sequences from yeast proteins such as invertase 6,7 have P. J. Barr, A. J. Brake, and P. Valenzuela, "Yeast Genetic Engineering." Butterworth, Stoneham, Massachusetts, 1989. 2 S. A. Parent, C. M. Fenimore, a n d K. A. Bostian, Yeast 1, 83 (1985). 3 R. A. Hitzeman, D. W. Leung, L. J. Perry, W. J. Kohr, H. L. Levine, and D. V. Goeddel, Science 219, 620 (1983). 4 M. A. Innis, M. J. Holland, P. C. McCabe, G. E. Cole, V. P. Wittman, R. Tal, K. W. K. Watt, D. H. Gelfand, J. P. Holland, and J. H. Meade, Science 228, 21 0985). s T. Sato, S. Tsunasawa, Y. Nakamura, M. Emi, F. Sakiyawa, and K. Matsubara, Gene 50, 247 (1986). 6 R. A. Smith, M. J. Duncan, and D. T. Moir, Science 229, 1219 (1985). 7 C. N. Chang, M. Matteucci, L. J. Perry, J. J. Wulf, C. Y. Chen, and R. A. Hitzeman, Mol. Cell. Biol. 6, 1812 (1986).
METHODS IN ENZYMOLOGY, VOL. 185
Copyright© 1990by AcademicPress,Inc. All rightsof reproductionin any formreserved.
[34]
YEAST SECRETION OF HETEROLOGOUSPROTEINS
409
been used to direct the secretion of heterologous proteins. The focus of this article is on the use of the leader sequence of the precursor of the yeast mating hormone a-factor, which has been the leader most widely used for the secretion of foreign proteins from yeast,s Secretion in S a c c h a r o m y c e s c e r e v i s i a e Saccharomyces cerevisiae has become an important model system for the study of protein transport secretion. Of particular importance has been the isolation of a large collection of sec mutants blocked at specific points in the secretory pathway at a nonpermissive temperature? Considerable biochemical and genetic evidence demonstrates that the pathways of protein transport and secretion in yeast appear to have much in common with those in other eukaryotic organisms) °,~ The large amount of research being carried out on protein transport and secretion in yeast continues to provide an increasingly detailed understanding of the underlying cell biology and biochemistry. As in other eukaryotes, N-linked and O-linked carbohydrate chain addition occurs onto proteins transported to the cell surface or to the lysosome-like vacuole. This is an important consideration when attempting to secrete heterologous proteins containing sites (Asn-X-Thr/Ser) for asparagine-linked or O-linked carbohydrate addition. Although the structure of the core oligosaccharide transferred to Asn residues of yeast glycoproteins is identical to that found in mammalian glycoproteins, subsequent modifications of these chains are quite different in yeast) 2 Instead of the extensive "trimming" of the oligosaccharide core and subsequent addition of sialic acid, galactose, and N-acetylglucosamine as in mammalian cells, secreted yeast glycoproteins undergo less extensive trimming of the core followed by elongation with long "outer chains" of mannose residues (50 or more). As a result of these differences, heterologous glycoproteins secreted from yeast may be inactive or antigenically different from the natural proteins. This may be especially important in the case of proteins
8A. J. Brake, in "Yeast Genetic Engineering"(P. J. Barr, A. J. Brake, and P. Valenzuela, eds.), p. 269. Butterworth,Boston,Massachusetts,1989. 9 p. Novick,C. Field,and R. Schekman,Cell 21,205 (1980). toR. Schekman and P. Novick, in "The Molecular Biologyof the Yeast Saccharomyces cerevisiae: Metabolism and Gene Expression"(J. N. Strathern, E. W. Jones, and J. R. Broach, eds.), p. 361. Cold Spring Harbor Laboratory,Cold Spring Harbor, New York, 1982. 11R. Schekman,Annu. Rev. CelIBiol. 1, 115 (1985). ~2C. E. Ballou, in "The MolecularBiologyof the Yeast Saccharomyces cerevisiae:Metabolism and Gene Expression"(J. N. Strathern, E. W. Jones, and J. R. Broach,eds.), p. 335. Cold Spring Harbor Laboratory,Cold SpringHarbor, New York, 1982.
410
EXPRESSION IN YEAST
[34]
destined for human therapeutic use.'3 Efforts have been made to eliminate or minimize this problem through the use of yeast mutants defective in the ability to add outer-chain oligosaccharides. '4,'5 Secreted yeast proteins also contain short mannooligosaccharide chains of one to four residues attached to serine and threonine residues. As in the case of mammalian glycoproteins, no defined amino acid sequence signal for this modification has been found. Heterologous proteins secreted from yeast have been found to be O-glycosylated at the same sites found in the natural p r o d u c t s . 4,16,17 Biosynthesis of a-Factor Haploid S. cerevisiae cells of the a mating type secrete a 13-residue peptide required for efficient mating with cells of the opposite a mating type. ~s Like other peptide hormones, a-factor is derived from larger precursor polypeptides encoded by two structural genes, MFotl and MFa2.'9,20 The protein sequence deduced from the major structural gene M F a l , shown in Fig. l, is a 165-residue polypeptide containing four repeats of the mature a-factor peptide, each preceded by a spacer peptide of 6-8 residues with the structure Lys-Arg-(Glu/Asp-Ala)2_a. These repeats are preceded by an 83-residue leader sequence containing a hydrophobic signal sequence and three potential sites for Asn-linked oligosaccharide addition. The minor M F a 2 gene encodes a similar precursor polypeptide containing only two repeats of the mature a-factor peptide. Immunochemical analysis of a-factor-related species, resulting from in vitro translation during passage through the secretory pathway in various sec mutants confirmed that a-factor is derived from larger, glycosylated ,a M. A. Innis, in "Yeast Genetic Engineering" (P. J. Barr, A. J. Brake, and P. Valenzuela, eds.), p. 233. Butterworth, Stoneham, Massachusetts, 1989. ,4 D. T. Moir and D. R. Dumais, GeneS6, 209 (1987). is C. L. Yip, S. K. Welch, T. Gilbert, and V. L. MacKay, Yeast 4, $457 (1988). ,6 j. F. Ernst, J.-J. Mermod, J. F. DeMarter, R. J. Mattaliano, and P. Moonen, Bio/Technology 5, 831 (1987). ~ J. N. Van Arsdell, S. Kwok, V. L. Schweichart, M. B. Ladner, D. H. Gelfand, and M. A. Innis, Bio/Technology 5, 691 (1987). ,s j. Thorner, in "The Molecular Biology of the Yeast Saccharomyces cerevisiae: Life Cycle and Inheritance" (J. N. Strathern, E. W. Jones, and J. R. Broach, eds.), p. 143. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 198 I. 19j. Kurjan and I. Herskowitz, Cell 30, 933 (1982). 20 A. Singh, E. Y. Chen, J. M. Lugovoy, C. N. Chang, R. A. Hitzeman, and P. W. Seeburg, Nucleic Acids Res. 11, 4049 (1983). 2~ A. Brake, D. Julius, and J. Thorner, Mol. Cell. Biol. 3, 1440 (1983). 22 O. Emter, B. Mechler, T. Achstetter, H. Miiller, and D. H. Wolf, Biochem. Biophys. Res. Cornmun. 116, 822 (1983). 23 D. Julius, R. Schekman, and J. Thorner, Cel136, 309 (1984).
[34]
YEAST SECRETION OF HETEROLOGOUS PROTEINS c~o
. :,. ,
oHo c ~
KIrX2
~
KE),(2
l
KF'N2
411
KIrX2
ill
GluAlaAspAlaGluAla]TrpHisTrpLeuGInLeuL ysProGlyGInProMetTyrJLysAro t
t STE13
t
~-FACTOR
t
t
KEXI
FIG. 1. Structure and processingpathway of prcpro-(x-factor.The translation product of the MFcH gene has three sites for Asn-linked oligosaccharideaddition (CHO) and sites for endoproteolytic cleavage by signal peptidase and the Kex2 protease. An expanded view (below) of the peptide releasedby Kex2 cleavageshows sites for exoproteolyticprocessingby products of the STE13 and KEXI genes. precursor polypeptides. 21-23 The translocation and processing o f prepro-ctfactor have also been studied in vitro. 24-26 Processing o f prepro-a-factor requires four different proteolytic activities. The availability o f mutations in the appropriate genes as well as the corresponding cloned genes has resulted in ix-factor being the first peptide h o r m o n e whose processing pathway has been genetically definedY Signal peptidase cleavage occurs between residues 19 and 20 o f the prepro-a-factor. 28 The apparent lack o f an intermediate resulting from signal peptide cleavage of the primary translation product appears to have been due to anomalous gel mobility of the two species. Signal peptide cleavage is blocked in s e c l l mutants, suggesting that S E C l l m a y be the structural gene for signal peptidase. 29 The glycosylated p r o ~ - f a c t o r is subsequently cleaved by an endoproteinase cleaving on the carboxyl side o f the Lys-Arg sequence in the "spacer" peptide o f each repeat. This cleavage is blocked in k e x 2 mutants, resulting in a mating defect in M A T a strains, failure to secrete active killer toxin peptide, and in the secretion o f a hyperglycosylated form of pro-txfactor. 3°,3~ The K E X 2 gene was cloned on the basis o f complementation o f 24j. A. Rothblatt and D. Meyer, Ce1144, 619 (1986). 2s W. Hansen, P. B. Garcia, and P. Walter, Ce1145, 397 (1986). 26M. G. Waters and G. Blobel,J. Cell Biol. 102, 1543 (1986). 27R. S. Fuller, R. E. Sterne, and J. Thorner, Annu. Rev. Physiol. 50, 345 (1988). 2s M. G. Waters, E. A. Evans, and G. Blobel,J. Biol. Chem. 263, 6209 (1988). 29p. C. Bohni, R. J. Deshaies, and R. W. Schekman, J. CellBiol. 106, 1035 (1988). 3oM. J. Leibowitzand R. B. Wickner, Proc. Natl. Acad. Sci. U.S.A. 73, 2062 (1976). 31D. Julius, A. Brake, L. Blair, R. Kunisawa, and J. Thorner, Cell 37, 1075 (1984).
412
EXPRESSION IN YEAST
[34]
kex2 mutants and has been shown to be a membrane-bound, calciumdependent serine protease homologous to subtilisin and related proteases. 32-34
Following excision of each of the repeats from pro-a-factor, maturation to mature a-factor requires exoproteolytic processing at both the C and N termini. The STE13 gene encodes a membrane-bound, heat-stable dipeptidylaminopeptidase, which is responsible for removal of Glu-Ala and Asp-Ala dipeptides from the N terminus of each r e p e a t . 35 Mutations in this gene result in sterility o f a haploids due to the defect in a-factor processing, with no other known phenotype. Also required for maturation of a-factor is removal of the arginyl and lysyl residues at the C terminus of each of the first three repeats. The KEX1 gene has been shown to encode a serine protease (of the trypsin family) with the required carboxypeptidase B-like specificity for C-terminal Lys and Arg residues on a-factor and killer toxin precursors,as The KEX1 gene is essential for production of active killer toxin peptide. The failure of kexl mutants to show an a-specific sterile phenotype is apparently due to the fact that the a-factor species derived from the fourth repeat of preproa-factor does not possess C-terminal Lys and Arg residues, and that a-factor production at a reduced level (presumably about 25% that of an isogenic KEX1 strain) is apparently sufficient for normal mating. Expression in Yeast of Hybrid Proteins Containing the a-Factor Leader In order to determine whether the leader sequence of prepro-a-factor contained sufficient sequence information for targeting a-factor for secretion and processing, and whether this could be utilized for a general secretion system, gene fusions were constructed which joined the prepro region to various other proteins. The first such hybrid protein reported contained a portion of the M F a l gene encoding the leader region of prepro-a-factor fused to a portion of the SUC2 gene encoding the secreted yeast enzyme invertase.37 Yeast transformants expressing this fusion exported active invertase to the cell surface. This report was soon followed by 32 K. Mizuno, T. Nakamura, T. Ohshima, S. Tanaka, and H. Matsuo, Biochem. Biophys. Res. Commun. 156, 246 (1988). 33 R. S. Fuller, A. Brake, and J. Thorner, Proc. Natl. Acad. Sci. U.S.A. 86, 1434 (1989). R. S. Fuller, A. J. Brake, and J. Thorner, Science 245, 482 (1989). 35 D. Julius, L. Blair, A. Brake, G. Sprague, and J. Thorner, Cell32, 839 (1983). 36 A. Dmochowska, D. Dignard, D. Henning, D. Y. Thomas, and H. Bussey, Cell 50, 573 (1987). 37 S. D. Emr, R. Schekman, M. C. Flessel, and J. Thorner, Proc. Natl. Acad. Sci. U.S.A. 80, 7080 (1983).
[34]
YEAST SECRETION OF HETEROLOGOUS PROTEINS
413
reports of the expression of fusions of the a-factor leader to proteins foreign to yeast. In these studies, the fusion partners were the human proteins epidermal growth factor (hEGF), 3s fl-endorphin, a consensus interferon a (IFN-cont), 39 and interferon a l (IFN-al). 4° These genes encoded none of the leader sequences present in the human precursor proteins and therefore must have been targeted for secretion and processing in yeast by the a-factor leader sequence, since direct expression of mature hEGF and IFN-al in yeast had resulted in no secretion of these proteins. 41'42 In fact, expression of hEGF as a fusion resulted in an increase in production level from ~30 gg/liter for internal expression to greater than l mg/liter for secretion. In the case of IFN-al, secretion directed by the a-factor leader resulted in more efficient export and more precise processing than that seen for secretion directed by the naturally occurring IFN signal sequence. Since these reports, many other proteins have been successfully secreted using the a-factor leader system,s thus demonstrating its general utility, as well as providing insight into the biosynthesis and secretion of a-factor and other yeast proteins. " I m p r o v e m e n t s " in a-Factor Secretion Systems Although there is an increasing list of proteins which have been efficiently expressed and secreted from yeast using the a-factor leader, other proteins have proved refractory to efficient secretion and/or processing using the same expression. A number of laboratories have introduced modifications to overcome limitations or problems which have arisen in the basic a-factor expression system for secretion of various heterologous proteins. Initial studies on expression of a-factor fusions took advantage of a convenient HindlII site in the M F a l gene at the junction of the leader and the first a-factor repeat (Fig. 2). The resulting fusions thus contained spacer peptide sequences, requiring the action of the STEI3 gene product for complete maturation of the secreted product. It was found that a large 38 A. J. Brake, J. P. Merryweather, D. G. Coit, U. A. Hebedein, F. R. Masiarz, G. T. Mullenbach, M. S. Urdea, P. Valenzuela, and P. J. Barr, Proc. Natl. Acad. Sci. U.S.A. 81, 4642 (1984). 39 G. A. Bitter, K. K. Chen, A. R. Banks, and P.-H. Lai, Proc Natl. Acad. Sci. U.S.A. 81, 5330 0984). 40 A. Singh, J. M. Lugovoy, W. J. Kohr, and L. J. Perry, Nucleic Acids Res. 12, 8927 0984). 4, M. S. Urdea, J. P. Merryweather, G. T. Mullenbach, D. Coit, U. Heberlein, P. Valenzuela, and P. J. Barr, Proc. Natl. Acad. Sci. U.S.A. 80, 7461 (1983). 42 R. A. Hitzeman, F. E. Hagie, H. L. Levine, D. V. Goeddel, G. Ammerer, and B. D. Hall, Nature (London) 293, 717 0981).
414
EXPRESSION IN YEAST
[34]
A MF~I
GluGluGlyValSerLeuAspLysArgGluAlaGluAla GAAGAAGGGGTATCTTTGGATAAAAGAGAGGCTGAAGCTT CTTCTTCCCCATAGAAACCTATTTTCTCTCCGACTTCGAA HindIII
pABI26
GluGluGlyValSerLeuAspLysArg GAAGAAGGGGTATCTCTAGATAAAAGA CTTCTTCCCCATAGAGATCTATTTTCT XbaI
B a-Factor Leader ---GluGluGlyValSer ---GAAGAAGGGGTATCT - - -CTTCTTCCCCATAGAGATC
AdaPtor LeuAspLysArg CTAGATAAAAGG TATTTTCC XbaI
He~oloaous Protein r I cDNA or Synthetic Gene
// // // 4/
Adap~o r
MFG1 Terminator
AM OC TAGTAAG TCGACTTTGTTCCCAC-ATCATTCAGCT GAAACAAGGGTG- SalI
Fro. 2. Sequences around the junction of a-factor leader fusions. (A) DNA sequences and protein translation of the M F a l gene and the modification found in pAB126. (B) Strategy to clone a hypothetical heterologous gene, with blunt ends, into the a-factor leader vector pAB 126, using synthetic oligonucleotide adaptors.
fraction of the secreted hEGF, IFN, and p-endorphin contained an N-terminal extension corresponding to the (Glu-Ala), spacer sequence. This indicated that the STE13-encoded dipeptidylaminopeptidase is present in an amount insufficient to process the high levels of protein expressed by these synthetic genes. This had been encountered previously in strains overexpressing a-factor due to the presence of the MFa I gene on a highcopy plasmid: 5 These strains secreted forms of a-factor similar to that secreted by stel3 mutants. Two approaches have used to overcoming this problem for proteins secreted from yeast. The first method was initially described for a-factor leader fusions of hEGF 3s and IFN-a 1,4° and involved site-directed mutagenesis of the fusion genes to delete the portion of these genes encoding the spacer (Glu-Ala), dipeptides. Such modified genes were found to result in efficient secretion of the heterologous proteins at levels similar to that seen for the original, spacer-containing fusions. These results indicated that the spacer regions of prepro-a-factor were not essential for transport or processing by the KEX2 protease. Subsequent a-factor leader fusions have thus usually utilized this direct joining of the heterologous protein to the Lys-Arg processing site of the a-factor leader.
[34]
YEAST SECRETION OF HETEROLOGOUS PROTEINS
415
The second approach to circumventing the limiting amount of the STEI3 dipeptidylaminopeptidase present in yeast host strains is to increase the expression of this enzyme by including the cloned S T E I 3 gene on the same plasmid as the a-factor leader fusion gene. Although there have been no reports of the use of this approach for heterologous proteins, a plasmid containing both the M F a l and STE13 genes was reported to increase the amount of active a-factor over that produced from a plasmid containing only the M F a l gene.43 The expression of some a-factor leader fusions lacking spacer peptide sequences has resulted in the intracellular accumulation or secretion of unprocessed and partially processed forms, while the same fusions conraining (Glu-Ala) spacers are efficiently processed by the KEX2 protease. Zsebo et al.~ carded out Western blot analysis of proteins secreted from yeast strains expressing a-factor leader-IFN-a 1 fusions. Fusions lacking a spacer peptide resulted in secretion of considerable levels (> 50%) of unprocessed, heavily glycosylated fusion protein. This product is analogous to the hyperglycosylated pro-a-factor species secreted from kex2 mutants. 31 Yeast transformants expressing similar fusions including a (Glu-Ala)2 spacer efficiently secreted fully processed IFN. Thus, some fusions linked directly to the Lys-Arg processing site must be poor substrates for the KEX2 protease. However, the presence of the charged spacer peptide may convert such fusions to good substrates. The expression of the STEI3 gene may have to be increased as described above to provide complete processing of such spacer-containing fusions. Increased expression of the KEX2 gene provides an alternative solution to poor processing at the Lys-Arg site. This approach has been employed to improve the secretion of correctly processed transforming growth factor a (TGF-a) from an a-factor leader-TGF-a fusion. 45 Expression of an a-factor leader-TGF-a fusion resulted in the secretion of both properly processed TGF-a and higher molecular weight species, which were presumably variously glycosylated forms of the uncleaved fusion protein. Insertion of the KEX2 gene into the multicopy plasmid carrying the a-factor leader-TGF-a fusion gene resulted in the elimination of these unprocessed forms of the fusion protein with a corresponding increase in the secretion of properly processed TGF-a. 43 D. Barnes, L. Blair, A. Brake, M. Church, D. Julius, R. Kunisawa, J. Lotko, G. Stetler, and J. Thorner, Recent Adv. Yeast Mol. Biol. 1,295 (1982). 44 K. M. Zsebo, H.-S. Lu, J. C. Fieschko, L. Goldstein, J. Davis, K. Duker, S. V. Suggs, P.-H. Lai, and G. A. Bitter, J. Biol. Chem. 261, 5858 (1986). 45 p. j. Barr, H. L. Gibson, C. T. Lee-Ng, E. A. Sabin, M. D. Power, A. J. Brake, and J. R. Shuster, in "Industrial Yeast Genetics" (M. Korhola and H. Nevalainen, eds.), p. 139. Foundation for Biochemical and Industrial Fermentation Research, Heisinki, 1987.
416
EXPRESSION IN YEAST
[34]
As is the case when any yeast secretion system is used for the production of heterologous proteins, N-linked glycosylation of Asn residues in these proteins may result in undesirable differences between the yeast-produced and natural proteins, as discussed above. Site-directed mutagenesis of the sites for addition of N-linked oligosaccharide can be used to eliminate the production of glycosylated proteins entirely.~6.46.47However, such modified genes will still result in production of proteins which may be antigenically distinct from the naturally occurring proteins. As discussed above, one may also use host yeast strains carrying mutations which reduce the amount of outer-chain mannose a d d i t i o n . 14,15,4g,49 It is not currently possible, however, to produce giycoproteins in yeast with oligosaccharide structures identical to those found in mammalian cells. In addition to defined modifications of the a-factor secretion system, one may screen, using either an immunological or enzymatic assay, for random mutations resulting in improved secretion efficiency. Such an approach resulted in the isolation of yeast mutants showing improved secretion efficiency of bovine prochymosin produced from invertase leader fusions. 6 Two of these mutants also showed increase secretion efficiency for a-factor leader-prochymosin fusions. Finally, the transcription of a-factor leader gene fusions may be increased by substituting a stronger promoter, such as one of the promoters of the structural genes for the glycolytic enzymes, for that of the MFal, or placed under control of an easily regulated promoter such as that of the ADH2 gene encoding the repressible alcohol dehydrogenase.5° Interestingly, it has been reported that the use of a weaker promoter results in increased secretion of insulin-like growth factor I (somatomedin C). 5~ Construction of a-Factor Fusions A number of different cloning strategies have been used for construction of genes encoding fusions of the a-factor leader with heterologous proteins. Initial studies utilized a fortuitously positioned HindIII site at the ,5 V. L. MacKay, in "Biological Research on Industrial Yeasts" (G. G. Stewert, I. Russell, R. D. Klein, and R. R. Hiebsch, eds.), Voi. 2, p. 27. CRC Press, Boca Raton, Florida, 1986. 4v A. Miyajima, K. Otsu, J. Schreurs, M. W. Bond, J. S. Abrams, and K. Arai, Embo J. 5, 1193 (1986). P. K. Tsai, J. Frevert, and C. E. Ballou, J. Biol. Chem. 259, 3805 (1984). 49 p. W. Robbins, in "Biological Research on Industrial Yeasts" (G. G. Stewert, I. Russell, R. D. Klein, and R. R. Hiebsch, eds.), Vol. 2, p. 193. CRC Press, Boca Raton, Florida, 1986. 5oj. R. Shuster, in "Biological Research on Industrial Yeasts" (G. G. Stewert, I. Russell, R. D. Klein, and R. R. Hiebsch, eds.), Vol. 2, p. 20. CRC Press, Boca Raton, Florida, 1986. 51 j. F. Ernst, DATA 5, 483 (1986).
[34]
417
YEAST SECRETION OF HETEROLOGOUS PROTEINS ~8amHl
I
pAB126 Lambda
B amH I...~
MFa 1 Terminator
SalI1
..BamHI
FIG. 3. Map of the plasmid vector pAB126. The asterisk indicates that the XbaI site is methylated, and thus resistant to cleavage, in dam + strains of Escherichia coli.
junction of the a-factor leader and the mature a-factor sequence and a SalI site 20 base pairs beyond the translational termination codon of MFa 1, as shown in Fig. 2. Subsequently, various workers modified the prepro-a-factor coding region to include convenient restriction sites which allow precise fusions to be made directly to the Lys-Arg processing site using specific oligonucleotide adaptors. 38,44,52 Described here is one such modified vector, pAB126, that is commonly used in our laboratory. A map of this plasmid is shown in Fig. 3. It contains a segment of the MFa I gene encoding the leader region, which has been modified to include an XbaI restriction site as shown in Fig. 2. This gene has been fused to the GAP promoter 53 which was derived from the TDH3 gene, one of three structural genes for glyceraldehyde-3-phosphate dehydrogenase. A large (8.2 kb) XbaI-SalI fragment of bacteriophage ;t has been inserted into the MFal gene and is replaced by a gene encoding a protein of interest. 52 A. Miyajima, M. W. Bond, K. Otsu, K. Arai, and N. Arai, Gene37, 155 0985). ~3 S. Rosenberg, D. Coit, and P. Tekamp-Olsen, this volume [28].
418
EXPRESSION IN YEAST
[34]
In order to construct an a-factor leader fusion, pAB 126 is digested with XbaI and SalI and the 4.7-kb vector fragment isolated by preparative
agarose gel electrophoresis. A eDNA or synthetic gene encoding the protein one wishes to have secreted is ligated to this vector after addition of synthetic oligonucleotide adaptors as shown in Fig. 2. The 5' XbaI adaptor is designed to include the K E X 2 processing site and be compatible with a blunt end or an overhang of a convenient restriction site in the heterologous gene, thus producing an in-frame fusion. The 3' SalI adaptor should likewise ligate to an end produced by a restriction site near the 3' end of the heterologous gene, and should include a translational termination codon if one is not contained within the heterologous gene fragment. Once a plasmid containing the correct gene fusion is isolated, the expression "cassette" is excised by digestion with B a m H I and the resulting fragment inserted into a B a m H I site of any appropriate yeast plasmid vector, most of which have unique B a m H I sites. 2 We routinely use the plasmid pAB24 shown in Fig. 4. The expression plasmid may be introduced by transformation of spheroplasts 54 or lithium-treated whole cells55 of an appropriate yeast strain carrying either a ura3 or leu2 mutation. Because the leu2-d allele present in this vector is partially defective,56,57 Leu + transformants cannot be obtained by the lithium transformation method, but must be obtained by spheroplast transformation or by leucine selection of transformants obtained initially by uracil selection. Because of this defective leu2-d allele, however, leucine selection results in extremely high plasmid copy number. Host strains defective for the major proteases, encoded by the P R A 1 (PEP4), PRB1, and PRC1, are particularly useful to minimize proteolytic degradation of secreted products. Such strains can be obtained from the Berkeley Yeast Genetic Stock Center. 5s Analysis of Secretion Products Yeast transformants expressing the a-factor leader fusion are grown in the appropriate liquid selective medium. 59 Yeast cells are removed by centrifugation and the resulting culture supernatant analyzed by sodium dodecyl sulfate (SDS) gel electrophoresis. 6° Usually, the solution must be 54A. Hinnen,J. B. Hicks,and G. R. Fink,Proc. Natl. Acad. Sci. U.S.A. 75, 1929(1978). 55H. Ito, Y. Fukuda,and A. Kimara,J, Bacteriol. 153, 163 (1983). 56j. D. BeRgs,Nature (London) 275, 104 (1978) 57E. Erhart and C. Hollenberg,J. Bacteriol. 156, 625 (1983). 5sYeast GeneticStock Center, Departmentof Biophysicsand MedicalPhysics,Universityof California,Berkeley,California94720. 59F. Sherman, G. R. Fink, and J. B. Hicks, "Methods in Yeast Genetics." Cold Spring Harbor Laboratory,Cold SpringHarbor, New York, 1986. 6oU. K. Laemrnli,Nature (London) 227, 680 (1970).
[34]
YEAST SECRETION OF HETEROLOGOUS PROTEINS
419
ICa L XbaI~ IR
~~u2-d
tet "~t~
am~/t'/
ClaI/ "-#...._.~ ~ \\cl.i* / Hpal XbaI Fro. 4. Map of the yeast plasmid vector pAB24. This plasmid contains the A form of the yeast 2-/lm plasmid (this volume [22]) cloned at the ClaI site of the E. coil vector pBR322, as well as the S. cerevisiae LEU2 and URA3 genes. The asterisks indicate that two of the Clal sites are methylated in dam + strains of E. coil. concentrated to obtain sufficient concentrations to allow visualization of the secreted products. A useful general m e t h o d involves precipitation by trichloroacetic acid (TCA). T o the culture supernatant is added one-fourth volume o f a solution o f 50% TCA, 0.2% sodium deoxycholate (w/v). After 30 min at 00, the precipitate is collected by centdfugation. The resulting pellet is washed first with 10% TCA, then with acetone, and dried under vacuum. This pellet can then be dissolved in SDS gel sample buffer and a
420
EXPRESSION IN YEAST
[34]
sample representing up to 10 ml of culture electrophoresed. The resolved proteins may be visualized by staining with Coomassie blue, silver chloride, 6~ or by Western blot 62 using antibodies directed to the heterologous protein. The cultures analyzed should include a control of the host strain transformed with the vector lacking an expression cassette. Alternatively, the secreted proteins may be concentrated by ultrafiltration or by chromatography using an ion-exchange or hydrophobic interaction resin. In order to determine whether secreted products have been modified by Asn-linked carbohydrate, the concentrated secreted proteins are dissolved by boiling in a small volume of a solution of 1% (w/v) SDS, then diluted and digested with endoglycosidase H. 63 The resulting deglycosylated proteins are then analyzed as described previously. This will sometimes require concentration by one of the previously described methods to avoid undesirable salt effects during electrophoresis. To examine products which may remain cell-associated, cells from the same culture are lysed by boiling in SDS sample buffer, then analyzed by SDS electrophoresis and Western blotting. Alternatively, both secreted and cell-associated products can be analyzed by metabolically labeling yeast cells with radioactive amino acids or 35S-labeled sulfate, then specifically immunoprecipitating proteins using antibodies directed against the heterologous protein. 2a
Conclusion Expression systems based on the yeast a-factor leader have proved to be generally useful for directing the secretion of a wide variety of proteins of both commercial and research interest. Proteins originating from organisms ranging from bacteria to humans have been successfully secreted using the a-factor leader. These proteins vary in size from 14 amino acids (somatostatin~) to over 800 residues (Epstein-Barr virus envelope glycoprotein65), and include a number of proteins which have been refractory to efficient expression using other recombinant DNA systems. A number of these proteins have progressed to the stage of clinical trials, and, in fact, the first recombinant protein approved for use in food products, bovine chy6, C. R. Merril, R. C. Switzer, and M. L. Van Keuren, Anal. Biochem. 105, 361 (1980). 62 W. N. Burnette, Anal. Biochem. 112, 195 (1981). 63 R. B. Trimble and F. Maley, Anal. Biochem. 141, 515 0984). 64 y. Bourbonnais, D. Bolin, and D. Shields, J. Biol. Chem. 263, 15342. 65 L. D. Schultz, J. Tanner, K. J. Hofmann, E. A. Emini, J. H. Condra, R. E. Jones, E. Kieff, and R. W. Ellis, Gene 54, 113 0987).
[35]
SECRETION OF HETEROLOGOUS PROTEINS FROM YEAST
421
mosin, is being produced using the S. cerevisiae a-factor leader in another budding yeast, Kluyveromyces lactis. 66 Although efficient secretion using a-factor leader-based systems is commonly achieved, much more remains to be learned about the basic biology of a-factor secretion, and secretion in general, before optimization of these systems can be achieved. 66 K. Rietveld, J. G. Bakhuis, N. J. Jansen in de Wai, R. W. van Leen, A. C. M. Noordermeer, A. J. J. van Ooyen, A. Schaap, and J. A. van den Berg, Yeast 4, S163 (1988).
[35] U s e o f H e t e r o l o g o u s a n d H o m o l o g o u s S i g n a l Sequences for Secretion of Heterologous Proteins from Yeast By RONALD A. HITZEMAN, CHRISTINAY. CHEN, DONALD J. DOWBENKO, MARK E. RENZ, CnUNG LIU, ROGER PAI, NANCY J. SIMPSON,WILLIAMJ. KOHR, ARJtJN SINGH, VANESSA CHISHOLM, ROBERT HAMILTON,and CHUNG NAN CHANG Introduction The development of yeast genetic engineering has made possible the expression of heterologous genes and the secretion of their protein products from yeast. This article deals exclusively with the yeast Saccharomyces cerevisiae (bakers' yeast). The advantages of secretion (export) of heterologous gene products are clearly exemplified by human serum albumin (HSA), and are discussed in this article. This 65-kDa blood protein has no N-linked glycosylation sites but does have 35 cysteines;1 in the blood, this protein monomer has 17 disulfide linkages3 HSA is misfolded when produced intracellulady in yeast without its amino-terminal secretion peptide sequence. This conclusion is based on its insolubility, loss of greater than 90% of its antigenicity (as compared to human-derived HSA), and formation of large protein aggregates. Using its natural secretion signal to promote secretion into the media of yeast, HSA is soluble and appears to have the same disulfide linkages as the human blood-derived material. As a pharmaceutical product, which will be potentially used in gram amounts in humans, recombinant HSA will require such identity with the natural product. Other advantages of secreting a product into the growth media of yeast are proper R. M. Lawn, J. Adelman, S. C. Bock, A. E. Franke, C. M. Houck, R. C. Najarian, P. H. Seeburg, and K. L. Wion, Nucleic Acids Res. 9, 6103 ( 1981). 2 j. R. Brown, "Albumin Structure, Function, and Uses," p. 27. Pergamon, New York, 1977.
METHODS IN ENZYMOLOGY. VOL. 185
Copyright© 1990by AcademicPress,Inc. All rightsof reproductionin any formreserved.
