Neurobiology of Aging 35 (2014) 1726e1738

Contents lists available at ScienceDirect

Neurobiology of Aging journal homepage: www.elsevier.com/locate/neuaging

Aging-related dysregulation of dopamine and angiotensin receptor interaction Begoña Villar-Cheda a, b, Antonio Dominguez-Meijide a, b, Rita Valenzuela a, b, Noelia Granado b, c, Rosario Moratalla b, c, Jose L. Labandeira-Garcia a, b, * a Laboratory of Neuroanatomy and Experimental Neurology, Department of Morphological Sciences, CIMUS, University of Santiago de Compostela, Santiago de Compostela, Spain b Networking Research Centre on Neurodegenerative Diseases (CIBERNED), Spain c Instituto Cajal CSIC (Consejo Superior de Investigaciones Científicas), Madrid, Spain

a r t i c l e i n f o

a b s t r a c t

Article history: Received 30 April 2013 Received in revised form 10 January 2014 Accepted 13 January 2014 Available online 17 January 2014

It is not known whether the aging-related decrease in dopaminergic function leads to the aging-related higher vulnerability of dopaminergic neurons and risk for Parkinson’s disease. The renin-angiotensin system (RAS) plays a major role in the inflammatory response, neuronal oxidative stress, and dopaminergic vulnerability via type 1 (AT1) receptors. In the present study, we observed a counterregulatory interaction between dopamine and angiotensin receptors. We observed overexpression of AT1 receptors in the striatum and substantia nigra of young adult dopamine D1 and D2 receptor-deficient mice and young dopamine-depleted rats, together with compensatory overexpression of AT2 receptors or compensatory downregulation of angiotensinogen and/or angiotensin. In aged rats, we observed downregulation of dopamine and dopamine receptors and overexpression of AT1 receptors in aged rats, without compensatory changes observed in young animals. L-Dopa therapy inhibited RAS overactivity in young dopamine-depleted rats, but was ineffective in aged rats. The results suggest that dopamine may play an important role in modulating oxidative stress and inflammation in the substantia nigra and striatum via the RAS, which is impaired by aging. Ó 2014 Elsevier Inc. All rights reserved.

Keywords: Aging Neuroinflammation Neurodegeneration Oxidative stress Parkinson Renin-angiotensin system Striatum

1. Introduction Aging is the most prominent risk factor for Parkinson’s disease (PD) and the progressive motor impairment that occurs during normal aging has been associated with nigrostriatal dysfunction. Several studies have shown that the dopaminergic (DA) system is altered during normal aging (Collier et al., 2007; Cruz-Muros et al., 2009; Darbin, 2012). PD was once considered to be a form of accelerated aging (Fearnley and Lees, 1991; McGeer et al., 1988). However, recent studies suggest that aging does not induce a significant loss of DA neurons but rather induces changes that may increase the vulnerability of DA neurons to damage and increase the risk of developing PD (Collier et al., 2007; Kubis et al., 2000). There is no consensus about how advancing age affects PD. Several recent findings suggest that

* Corresponding author at: Department of Morphological Sciences, Faculty of Medicine, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain. Tel.: þ34 881812223; fax: þ34 881812378. E-mail address: [email protected] (J.L. Labandeira-Garcia). 0197-4580/$ e see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.neurobiolaging.2014.01.017

normal aging is associated with a proinflammatory, pro-oxidant state that favors an exaggerated response to factors that can induce DA cell death (Choi et al., 2010; Csiszar et al., 2003). However, it is not known if the aging-related decrease in dopaminergic function contributes to the proinflammatory and prooxidant state that increases the vulnerability of DA neurons. Angiotensin II (AII), which is the most important effector peptide of the renin-angiotensin system (RAS), is formed by the sequential action of 2 enzymeserenin and angiotensin converting enzyme (ACE), on the precursor glycoprotein angiotensinogen. The actions of AII are mediated by 2 main cell receptors: AII type 1 and 2 (AT1 and AT2) receptors. Hyperactivation of local or tissue RAS, via AT1 receptors and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase activation, mediates oxidative stress and several key events in inflammatory processes that play a major role in several aging-related diseases (Marchesi et al., 2008; Ungvari et al., 2004). Local RAS has been associated with decreased longevity and age-related degenerative changes in a number of tissues (Basso et al., 2005; Benigni et al., 2009, 2010, 2013). AT2 receptors exert actions that are directly opposed to those mediated by AT1 receptors (McCarthy et al., 2013; Padia and

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

Carey, 2013). In recent studies, we have demonstrated the presence of local RAS in the substantia nigra and striatum in rodents and primates (Joglar et al., 2009; Rodriguez-Pallares et al., 2008; Valenzuela et al., 2010), including humans (Garrido-Gil et al., 2013). We have also demonstrated that overactivation of local RAS, via AT1 receptors, exacerbates neuroinflammation, oxidative stress, and dopaminergic cell death, all which were inhibited by treatment with ACE inhibitors (Lopez-Real et al., 2005; Muñoz et al., 2006) or AT1 receptor antagonists (Joglar et al., 2009; Rey et al., 2007; Rodriguez-Pallares et al., 2008). We observed RAS overactivation in the nigrostriatal system of aged male rats, which was associated with enhanced levels of neuroinflammation and oxidative stress markers and increased dopaminergic cell vulnerability to neurotoxins; these effects were inhibited by treatment with the AT1 receptor antagonist candesartan (Villar-Cheda et al., 2012). However, it is not known whether the aging-related decrease in dopaminergic function induces overactivation of the RAS. Interestingly, an important interaction between dopamine and angiotensin receptors has been observed in several recent studies in peripheral cells, particularly in relation to the regulation of renal and cardiovascular function (Chugh et al., 2012, 2013; Zhang et al., 2012), which suggests that dopamine and angiotensin systems may directly counterregulate each other (Gildea 2009; Khan et al., 2008; Zeng et al., 2006). In the present study, we investigated the effects of aging-related changes in dopaminergic system on the nigral and striatal RAS of aged rats relative to young normal and dopamine depleted rats and young mice lacking or over-expressing dopamine D1 or D2 receptors. 2. Methods 2.1. Experimental design Young adult (10-week-old at the beginning of the experiments) and aged (18 to 20-month-old) male SpragueeDawley rats and young adult male mice were used in the study. The mice were dopamine D1 and D2 receptor knockout (D1 KO and D2 KO) mice generated by homologous recombination (Ares-Santos et al., 2012; Darmopil et al., 2009; Granado et al., 2011). We also used D2R-eGFP BAC transgenic mice (D2-Tg) obtained from Mutant Mouse Regional Resource Center, USA, that overexpression of dopamine D2 receptor (Kramer et al., 2011) as well as their wildtype (Wt) littermates. We used adult mice initially weighing 20e25 g whose genotype was determined by polymerase chain reaction (PCR) analysis. Mice and rats were housed in conditions of constant room temperature (21  Ce22  C) and a 12-hour light and/or dark cycle (lights on at 7 AM) and given free access to food and water. All experiments were carried out in accordance with Directive 2010/63/EU and Directive 86/609/CEE and were approved by the corresponding committee at the University of Santiago de Compostela. The animals were anesthetized with ketamine and/or xylazine before surgery. All rats and mice were divided into 4 groups. Group A comprised Wt (wildtype) mice (n ¼ 18) or mice deficient for D1 (n ¼ 6) or D2 (n ¼ 6), or overexpressing D2 (n ¼ 6) dopamine receptors, which were used to study direct effects of changes in dopamine receptors on nigral and striatal RAS (AT1 and AT2 receptors, ACE activity and levels of angiotensinogen and/or angiotensin) in young adult rodents. Group B comprised young (n ¼ 21) and aged rats (n ¼ 15), which were used to study the effects of aging on the nigrostriatal dopaminergic system (D1 and D2 receptor expression, tyrosine hydroxylase and dopamine levels) and the striatal and nigral RAS of the same animals. Group C comprised young (n ¼ 10) and aged (n ¼ 6) male rats, which were subjected to unilateral dopamine depletion by 6-hydroxydopamine lesion (i.e., total lack of

1727

dopamine activity on D1 and D2 receptors) and used to compare the effects of dopamine depletion on nigral and striatal RAS in young and aged rats. Group D comprised young dopaminedenervated (6-OHDA lesioned; n ¼ 12) and aged (n ¼ 8) male rats, which were subjected to treatment with 6 mg/kg of L-Dopa (L-3, 4-dihydroxyphenylalanine methyl ester hydrochloride; plus 10 mg/kg benserazide; in a single intraperitoneal injection/day) or vehicle for 2 weeks. A dose of 6 mg/kg of L-Dopa is commonly used in rats as equivalent to a low-moderate dose of L-Dopa in humans. The L-Dopa-treated rats were used to compare the effects of dopamine replenishment on nigral and striatal RAS in young dopamine-depleted rats and aged rats. Mice and rats were killed by decapitation and the brains were rapidly removed. The area of the substantia nigra in the ventral mesencephalon and the striatum were dissected on an ice-cold plate, frozen on dry ice and stored at 80  C until analysis. Some rats from groups B were perfused and processed for immunohistochemistry (see the following). 2.2. RNA extraction and real-time quantitative PCR Total RNA from the striatum and nigral region was extracted with Trizol (Invitrogen, Paisley, Scotland, UK) according to the manufacturer’s instructions. RNA concentration was estimated using a NanoQuant plate and an Infinite M200 multiwell plate reader (TECAN, Salzburg, Austria). Total RNA (2 mg) was reversetranscribed to complementary DNA with deoxynucleotide triphosphate, random primers, and Moloney murine leukemia virus reverse transcriptase (200 U; Invitrogen). The relative levels of D1, D2, AT1, and AT2 receptor messenger RNA (mRNA) were determined by real-time PCR. Experiments were performed with a real-time iCycler PCR platform (Bio-Rad, Hercules, CA, USA). bactin was used as housekeeping gene and was amplified in parallel with the genes of interest. The data were evaluated by the deltadelta Ct method (2-DDCt), where Ct is the cycle threshold. Expression of each gene was obtained as relative to the housekeeping transcripts. Forward (F) and reverse (R) primers were designed for each gene by using Beacon Designer software (Premier Biosoft, Palo Alto, CA, USA). Primers sequences were as follows: For b-actin, F 50 -TCGTGCGTGACATTAAAGAG-3, R 50 TGCCACAGGATTCCATACC-3; for mouse AT1a receptor, F 50 GCTAACCTGGAGTCATCAAG-3 R 50 -ACTAACTGGCATTGTTTGGG-3, for mouse AT2, F 50 -TGTAATCAGCCTAGCCATTG-3, R 50 -CTACTTGACTTCCTGTTCTCG-3; for rat AT1a receptor, F 50 -TTCAACCTCTACGCCAGTGTG-30 , R 50 -GCCAAGCCAGCCATCAGC-30 ; for rat AT2, F 50 -AACATCTGCTGAAGACCAATAG -30 , R 50 -AGAAGGTCAGAACATGGAAGG-30 ; for rat D1 receptor, F 50 CGGGCTGCCAGCGGAGAG 3, R 50 -TGCCCAGGAGAGTGGACAGG; and for rat D2 receptor, F 50 AGACGATGAGCCGCAGAAAG, R 50 - GCAGCCAGCAGATGATGAAC. 2.3. Western blot analysis Tissue was homogenized in radio immunoprecipitation assay buffer containing protease inhibitor cocktail (Sigma, St. Louis, MO, USA) and phenylmethanesulfonyl fluoride (Sigma). Homogenates were centrifuged and protein concentrations were determined with the Pierce BCA Protein Assay Kit (Thermo Scientific, Fremont, CA, USA). Equal amounts of protein were separated by 5%e10% Bis-Tris polyacrylamide gel and transferred to nitrocellulose membrane. The membranes were incubated overnight with primary antibodies (1: 200; all from Santa Cruz Biotechnology, Dallas, TX, USA) against AT1 (SC31181), AT2 (SC9040), D2 (SC9113), and D1 (SC31479) receptors and angiotensinogen and/or angiotensin (the antibody detects the inactive precursor proteins angiotensinogen and angiotensin I, as well as

1728

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

AII and its weaker derivative peptide AIII, which act on AT1 and AT2 receptors). The following horseradish peroxidase-conjugated secondary antibodies were used: protein A (GE Healthcare, Madrid, Spain), Protein G (Upstate-Millipore, Millipore Corp., Billerica, MA, USA), goat anti-rabbit (Thermo Scientific) and donkey anti-goat (Santa Cruz Biotechnology). Immunoreactivity was detected with the luminata crescendo western horseradish peroxidase substrate (Millipore) and imaged with a chemiluminescence detection system (Molecular Imager ChemiDoc XRS System, Bio-Rad). Blots were stripped and reprobed for antiGAPDH (glyceraldehyde 3-phosphate dehydrogenase) (1:25,000; Sigma) as loading control. In each animal, protein expression was measured by densitometry of the corresponding band and expressed relative to the glyceraldehyde 3-phosphate dehydrogenase band value. The data were then normalized to the values of the control group of the same batch (100%) to counteract possible variability among batches. Finally, the results were expressed as mean  standard error of the mean (SEM). 2.4. ACE activity ACE activity was assayed with hippuryl-L-histidyl-L-leucine (Hip-His-Leu; Sigma) as substrate, as described by Hemming et al. (2007). Fluorescence was assayed in a 96-well plate format in an Infinite M200 multiwell plate reader (TECAN; excitation, 355; emission, 535). The data were then normalized to the values of the control group of the same batch (100%) to counteract possible variability among batches. Finally, the results were expressed as means  SEM. 2.5. 6-Hydroxydopamine lesion All experimental animals were anesthetized with ketamine and/or xylazine before surgery. Unilateral lesions of the DA system were performed by injection into the right medial forebrain bundle of 12 mg of 6-OHDA HBr (Sigma) in 4 mL of sterile saline containing 0.2% ascorbic acid. The stereotaxic coordinates were 3.7 mm posterior to bregma, 1.6 mm lateral to midline, 8.8 mm ventral to the skull at the midline, in the flat skull position (Paxinos and Watson, 1986). The solution was injected with a 5mL Hamilton syringe coupled to a motorized injector (Stoelting, Wood Dale, Il, USA) at 1 mL/min, and the canula was left in situ for 2 minutes after injection. Thirty minutes before the surgery, rats were administered with desipramine (Sigma, 25 mg/kg intraperitoneally) to prevent uptake of 6-OHDA by noradrenergic terminals. The efficacy of the lesion was evaluated in a rotometer (see the following): rats displaying more than 200 net contraversive turns per hour after injection of 0.05 mg/kg of apomorphine (i.e., maximally lesioned rats; see Hudson et al., 1993) were used (total or almost total DA depletion, >90). 2.6. Rotational behavior Drug-induced rotation was tested in a bank of 8 automated rotometer bowls (Rota-count 8, Columbus Instruments, Columbus, OH, USA) that monitor full (360 ) body turns in either direction. For each rat, the net rotation asymmetry score was calculated by subtracting the total number of full turns to the left (i.e., contralateral to the lesion) from the total number of full turns to the right (i.e., ipsilateral to the lesion) over the test period. The rats were acclimatized to the rotometer for at least 15 minutes before drug treatment, and turning behavior was monitored for 90 minutes after injection for 60 minutes after the injection of apomorphine.

2.7. Analysis of dopamine and metabolites by high performance liquid chromatography The striata were dissected on an ice-cold plate, and the striatal tissue frozen on dry ice and stored at 80  C until analysis. The striatal tissue was homogenized and then centrifuged at 14000g for 20 minutes at 4  C. The supernatant fractions were decanted, filtered (0.22 mm) and injected (20 mL/injection) into the high performance liquid chromatography (HPLC) system (Shimadzu LC prominence, Tokyo, Japan). Dopamine and its metabolite 3,4dihydroxyphenylacetic acid (DOPAC) were separated on a reverse phase analytical column (Waters Symmetry300 C18; 150  3.9 mm, 5 mm particle size; Waters, Milford, MA, USA). The mobile phase (70 mM KH2PO4, 1 mM octanesulfonic acid, 1 mM ethylenediaminetetraacetic acid, 10% MeOH, pH 4) was delivered at a rate of 1 mL/min. Detection was performed with a coulometric electrochemical detector (Coulochem III, ESA Inc. Chelmsford, MA, USA). The first and second electrodes of the analytical cell were set at þ50 mV and þ350 mV, respectively; the guard cell was set at 100 mV. Data were acquired and processed with Shimadzu LC solution software. Results were expressed in nanogram per milligram of tissue (wet weight) and presented as means  SEM. 2.8. Analysis of AII levels by HPLC, mass spectrometry, and enzyme immunoassay Frozen tissue samples were thawed at 4  C, cleaned and homogenized using a Polytron in 1 mL of ice-cooled 0.18 M HCl:ethanol (1:3 vol/vol). The homogenate was centrifuged at 15000g for 15 minutes at 4  C and the supernatants were collected. Solid-phase extraction of the supernatants was performed immediately on Sep Pak C18 columns (Waters). The columns were conditioned with 1 mL each of methanol and deionized water. The supernatants were applied to a pre-conditioned Sep Pak. The loaded Sep Pak column was washed with 1 mL of 5% methanol in deionized water. ANG II and its fragments were eluted with 1 mL of methanol and the eluant dried in a vacuum concentrator (Savant ISS110, Thermo Scientific). Dried samples were resuspended in 60 mL of a solution of 17% acetonitrile in 4 mM triethylammonium formate (TEAF) with 30 mM formic acid and injected (20 mL/injection) into the HPLC system. Peptides were separated using an acetonitrile gradient at 35  C and a flow rate of 1.0 mL/min on a reverse phase column (Waters Symmetry300 C18; Waters). For the acetonitrile gradient, solution A was made with 30 mM formic acid in 4 mM TEAF. Solution B consisted of 90% acetonitrile in 4 mM TEAF with 30 mM formic acid. The linear gradient used was from 11% to 50% B in 20 minutes. The eluate from the column was monitored at a wavelength of 220 nm in an UV-Vis detector (Shimadzu SPD-20 AV). ANG II, ANG III, ANG IV, and ANG V fractions were collected in a fraction collector (Shimadzu FRC-10A) and dried in a vacuum concentrator. The correct separation of different angiotensins was confirmed by mass/mass spectrometry using a Quattro Micro TM API ESCI triple-quadrupole mass spectrometer fitted with Z-spray (Waters; Cui et al., 2007). Finally, the levels of angiotensin were determined by enzyme immunoassay (SPIbio, Bertin Pharma, Montigny le Bretonneux, France) according to the manufacturer’s instructions. Data were expressed as percentages relative the control group. 2.9. Immunohistochemistry Some young (n ¼ 8) and aged rats (n ¼ 6) from group B were used for immunohistochemistry and perfused, first with 0.9% saline and then with cold 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4. The brains were removed, washed, and cryoprotected in the

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

1729

Fig. 1. Real-time quantitative PCR (A, B) and Western blot (WB; DeF) analysis of changes in the expression of AT1 receptors (A, D), AT2 receptors (B, E) and angiotensinogen and/or angiotensin (ANG; F), and activity of the angiotensin converting enzyme (ACE; C) in the striatum and nigral region in D1 receptor-deficient mice (D1-ko; n ¼ 6) relative to wild-type (Wt; n ¼ 6) controls. Protein expression was measured relative to the GAPDH band value and the expression of each gene was measured relative to that of the housekeeping transcripts (b-Actin). The results were normalized to the values for wild-type controls (100%). Data are means  SEM. * p < 0.05 relative to Wt controls (Student t test). Abbreviation: SEM, standard error of the mean.

same buffer containing 20% sucrose, and finally cut on a freezing microtome (30 mm thick). Sections were processed for tyrosine hydroxylase (TH) immunohistochemistry, as follows. The sections were incubated for 1 hour in 10% normal swine serum with 0.25% Triton X-100 in 20 mM potassium phosphate-buffered saline containing 1% bovine serum albumin (KPBS-BSA) and then incubated overnight at 4  C with a mouse monoclonal antiserum to TH (1:10,000; Sigma). The sections were subsequently incubated, first with the corresponding biotinylated secondary antibody (horse anti-mouse, 1:200), and then with avidin-biotin-peroxidase complex (ABC, 1:100, Vector, Burlingame, CA, USA). Finally, the labeling was revealed by treatment with 0.04% hydrogen peroxide and 0.05% 3-3’diaminobenzidine (DAB, Sigma). The density of striatal dopaminergic terminals and TH expression substantia nigra compacta was estimated as the optical density of the striatal THimmunoreactivity with the aid of NIH-Image 1.55 image analysis software (Wayne Rasband, NIMH), a personal computer coupled to a videocamera (CCD-72, MTI) and a constant illumination light table (Northern Light, St. Catharines, Canada). Sections from young and aged rats were processed simultaneously. At least 4 sections through the central striatum and substantia nigra compacta of each animal were measured, and for each section, the optical densities were corrected by subtraction of the background value. 2.10. Statistical analysis Two groups comparisons were analyzed by the Student test and multiple comparisons were analyzed by one-way analysis of

variance followed by the Bonferroni post hoc test. Normality of populations and homogeneity of variances were tested before each analysis of variance. All data were obtained from at least 3 independent experiments and were expressed as means  SEM. Differences were considered as statistically significant at p < 0.05. Statistical analyses were carried out with SigmaStat 3.0 (Jandel Scientific, San Rafael, CA, USA).

3. Results 3.1. Effect of dopamine D1 and D2 receptor deletion on striatal and nigral RAS In the dopamine D1 receptor deficient mice, expression of AT1 receptor mRNA and protein in both the striatum and nigral region was significantly higher than in the Wt controls. There were no significant differences in the expression of AT2 mRNA or protein expression between the 2 groups. However, ACE activity and levels of angiotensinogen and/or angiotensin in the nigral and striatal tissue were significantly lower in the D1 receptor-deficient mice than in the controls (Fig. 1AeF). In the dopamine D2 receptor-deficient mice, expression of AT1 receptor mRNA and protein both in the striatum and nigral region was significantly higher than in the Wt controls. Expression of AT2 mRNA and protein was also significantly higher in the former than in the latter group. However, the ACE activity and angiotensinogen and/or angiotensin levels in the nigral and striatal

1730

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

Fig. 2. Real-time quantitative PCR (A, B) and Western blot (WB; DeF) analysis of changes in the expression of AT1 receptors (A, D), AT2 receptors (B, E), and angiotensinogen and/or angiotensin (ANG; F), and activity of the angiotensin converting enzyme (ACE; C) in the striatum and nigral region in D2 receptor-deficient mice (D2-ko; n ¼ 6) relative to wild-type (Wt; n ¼ 6) controls. Protein expression was measured relative to the GAPDH band value and the expression of each gene was measured relative to that of the housekeeping transcripts (b-Actin). The results were normalized to the values for wild-type controls (100%). Data are means  SEM. * p < 0.05 relative to Wt controls (Student t test). Abbreviation: SEM, standard error of the mean.

tissue were not significantly different in D2 receptor-deficient mice and the controls (Fig. 2AeF). 3.2. Effect of dopamine D2 receptor overexpression on striatal and nigral RAS In mice overexpressing the dopamine D2 receptor, expression of AT1 receptor mRNA and protein in both the striatum and nigral region was significantly lower than in the Wt controls. Expression of AT2 mRNA and protein was also significantly lower in the former than in the latter group. Furthermore, in mice overexpressing D2 receptors ACE activity and angiotensinogen and/or angiotensin levels in the nigral and striatal tissue were higher than in control mice (Fig. 3AeF). 3.3. The nigrostriatal dopaminergic and renin-angiotensin systems in aged rats relative to young adult rats The levels of D1 and D2 receptor mRNA and protein in the striatum and nigral region were significantly lower in aged rats than in young rats (Fig. 4). However, no significant change in the ratio D1 to D2 was observed in aged rats (Fig. 4E). Furthermore, levels of TH in the striatum and substantia nigra were significantly lower in aged rats than in young rats, as estimated by immunohistochemistry and optical density (Fig. 5AeE). Finally, differences in nigrostriatal dopaminergic function between aged

rats and young rats were studied by HPLC analysis of the striatal levels of dopamine and its metabolites. Levels (nanogram per milligram wet weight of tissue) of dopamine and DOPAC in young adult rats were significantly higher than in aged rats. However, the DOPAC to dopamine ratio values were not significantly different in young rats and aged rats. This implies that the dopamine turnover is not increased in aged rats, despite the decrease in levels of DA (Fig. 5F). Nigral and striatal RAS were significantly different in aged and young rats. As in D1- and D2 receptor-deficient mice, expression of AT1 receptor mRNA, and protein in the nigra and striatum was significantly higher in aged rats than in young rats. Unlike in young mice deficient in dopamine receptors, AT2 receptor expression was significantly lower in aged rats than in young rats. Furthermore, no significant differences in ACE activity or angiotensinogen and/or angiotensin levels were detected (Figs. 6, 7). 3.4. Effect of dopamine depletion on nigral and striatal RAS in aged rats relative to young adult rats Dopamine depletion by unilateral 6-OHDA lesion induced a significant increase in AT1 receptor mRNA and protein levels in the striatal and nigral regions of young rats. Dopamine depletion induced a marked increase in AT1 receptor expression in aged rats (Fig. 7A and B). The lack of dopamine induced a significant increase in the expression of AT2 receptors in the nigra and

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

1731

Fig. 3. Real-time quantitative PCR (A, B) and Western blot (WB; DeF) analysis of changes in the expression of AT1 receptors (A, D), AT2 receptors (B, E), and angiotensinogen and/or angiotensin (ANG; F), and activity of the angiotensin converting enzyme (ACE; C) in the striatum and nigral region in mice overexpressing dopamine D2 receptors (D2-tg; n ¼ 6) relative to wild-type controls (Wt; n ¼ 6). Protein expression was measured relative to the GAPDH band value and the expression of each gene was measured relative to that of the housekeeping transcripts (b-Actin). The results were normalized to the values for wild-type controls (100%). Data are means  SEM. * p < 0.05 relative to Wt controls (Student t test). Abbreviation: SEM, standard error of the mean.

striatum of young rats. In contrast, dopamine depletion did not induce upregulation of AT2 receptors in aged rats, in which the levels of AT2 receptor expression were much lower than in young rats with normal dopaminergic innervation (Fig. 7C and D). Comparison of AT1 to AT2 receptor ratio between young and aged rats clearly showed that the ratio did not change after dopamine depletion in young rats and markedly increased in aged rats, and particularly in aged rats subjected to additional dopamine depletion by 6-OHDA treatment (Fig. 7E). Furthermore, downregulation of ACE activity or angiotensinogen and/or angiotensin was not observed in aged rats treated with 6-OHDA (Fig. 7F and G). As stated previously (Methods, section 2.3), the angiotensinogen and/or angiotensin protein level obtained by Western blot is a quantitative indicator of the levels of AII that stimulate AT1 and AT2 receptors. The absence of significant differences in AII levels between young and aged rats was confirmed by isolation of AII using HPLC, mass spectrometry, and quantification of AII by enzyme immunoassay (Fig. 7H).

3.5. Effect of treatment with L-Dopa on nigral and striatal RAS in aged rats relative to young adult rats Treatment with L-Dopa (6 mg/kg) induced a significant decrease in AT1 and AT2 receptor mRNA and protein levels in the striatal and nigral regions of young rats subjected to dopamine depletion by 6OHDA lesion (Fig. 8AeD). In contrast, L-Dopa treatment did not

induce significant changes in AT1 or AT2 receptor expression in aged rats (Fig. 8AeD).

4. Discussion The present results reveal for the first time a counterregulatory interaction between dopamine and angiotensin receptors in the nervous system. Both D1 and D2 receptor-deficient mice overexpressed AT1 receptors. Local AII, via AT1 receptors, is known to contribute to oxidative stress damage as a major activator of the NADPH-oxidase complex in several types of cells and tissues (Garrido and Griendling, 2009). The NADPH oxidase complex is the most important intracellular source of reactive oxygen species (ROS) other than mitochondria (Babior, 2004). Moreover, NADPH oxidase-generated ROS promotes further production of ROS, via mitochondria and other intracellular sources, which may lead to a vicious circle that amplifies and sustains ROS and contributes to cell death (Rodriguez-Pallares et al., 2012; Sheh et al., 2007; Zawada et al., 2011; Zhang et al., 2007). Upregulation of NADPH-dependent oxidases have been shown to be involved in major aging-related diseases such as hypertension, diabetes, atherosclerosis (Griendling et al., 2000), and PD (Rodriguez-Pallares et al., 2007; Wu et al., 2003). It has also been shown that the RAS, via AT1 receptors and NADPH oxidase, plays a key role in the initiation and perpetuation of inflammation. In peripheral tissues such as the blood vessel wall, the upregulated RAS, via AT1 receptors, acts on resident cells (e.g., endothelial

1732

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

Fig. 4. Real-time quantitative PCR (A, B) and Western blot (WB; CeE) analysis of changes in the expression of dopamine D1 (A, C) and D2 (B, D) receptors, and D1 to D2 protein ratio (E) in the striatum and nigral region in aged rats (n ¼ 3) relative to young adult rats (n ¼ 6). Protein expression was measured relative to the GAPDH band value and the expression of each gene was obtained relative to that of the housekeeping transcripts (b-Actin). The results were normalized to the values for young controls (100%). Data are means  SEM. * p < 0.05 relative to young controls (Student t test). Abbreviation: SEM, standard error of the mean.

cells, smooth muscle cells) leading to oxidative stress, and subsequent production of chemokines, cytokines, and adhesion molecules, which contribute to the migration of inflammatory cells into the lesioned tissue (Ruiz-Ortega et al., 2001; Suzuki et al., 2003). Furthermore, AII, via AT1 receptors, acts on inflammatory cells to induce inflammatory responses and to release high levels of ROS by activation of the NADPH-oxidase complex (Okamura et al., 1999; Yanagitani et al., 1999). In the brain (Lou et al., 2004; Stegbauer et al., 2009), and particularly in the nigrostriatal system (Grammatopoulos et al., 2007; Joglar et al., 2009; Rodriguez-Pallares et al., 2008), AII, via AT1 receptors, has been shown to enhance activation of microglial (i.e., inflammatory) cells and oxidative stress in neurons (i.e., resident cells), thus leading to progression of neurodegeneration. The mechanisms involved in AT2 neuroprotective and/or

compensatory effects have not been totally clarified. The compensatory and/or neuroprotective effect may not focus on or be limited to inhibition of AT1 and/or NADPH-oxidase activity (Sohn et al., 2000); inhibition of MAK kinases, activation of bradykinin receptors and other mechanisms have been suggested (for review see McCarthy et al., 2013; Padia and Carey, 2013). In any case, the results of the present and previous studies (Rodriguez-Perez et al., 2012; Villar-Cheda et al., 2012) indicate that an increase in AT1 to AT2 ratio enhances the pro-oxidative and proinflammatory state as well as dopaminergic vulnerability. AT2 receptor expression was significantly enhanced in D2 receptor-deficient mice, which suggests a compensatory effect to counteract AT1 receptor overexpression. D1 receptor-deficient mice overexpressed AT1 receptors, but with no significant change in AT2 receptor expression. However, angiotensinogen

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

1733

1734

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

Fig. 6. Real-time quantitative PCR (A, B) and Western blot (WB; CeD) analysis of changes in the expression of angiotensin AT1 (A, C) and AT2 (B, D) receptors in the striatum and nigral region in aged rats (n ¼ 6) relative to young adult rats (n ¼ 6). Protein expression was measured relative to the GAPDH band value and the expression of each gene was measured relative to that of the housekeeping transcripts (b-Actin). The results were normalized to the values for young controls (100%). Data are means  SEM. * p < 0.05 relative to young controls (Student t test). Abbreviation: SEM, standard error of the mean.

and/or angiotensin levels and ACE activity were downregulated, which suggests an alternative compensatory mechanism in D1 receptor-deficient mice. The mechanism responsible for the different compensatory responses that counteract AT1 receptor overexpression in D1 and D2 receptor-deficient mice remains to be clarified. In mice overexpressing D2 receptors, AT1 and AT2 receptor expression was downregulated with a compensatory increase in angiotensinogen and/or angiotensin levels and ACE activity, which is consistent with findings in knockout mice. Normal young rats with 6-OHDA-induced dopamine depletion showed increased expression of AT1 and AT2 receptors with no significant (except for nigral ACE) decrease in levels of angiotensinogen and/or angiotensin or ACE activity. This is consistent with the simultaneous loss of D1 and D2 receptor activation. Overall, the present results reveal that dopamine and angiotensin receptors counterregulate each other in the nigrostriatal system and that, in addition to its role as an essential neurotransmitter, dopamine may play an important role in modulating the microglial inflammatory response and neuronal oxidative stress via brain RAS. Interestingly, a very recent study has shown that dopamine may also inhibit neuroinflammation via astrocytic

D2 receptor stimulation through aB-crystallin dependent mechanisms (Shao et al., 2013). In the present study, we suggest that activation of dopamine receptors modulates neuroinflammation via interaction with RAS and that this interaction is altered in aged animals, leading to a pro-oxidative and pro-inflammatory state. An important interaction between dopamine and angiotensin receptors in peripheral tissues has been demonstrated in several recent studies, particularly in relation to the regulation of renal sodium excretion and cardiovascular function (Gildea 2009; Khan et al., 2008; Zeng et al., 2006). It has been shown that both D1-like and D2-like receptor agonists decrease AT1 receptor expression (Hussain et al., 1998; Zeng et al., 2003), and that D1-like receptors mediate inhibition of NADPH activity (Li et al., 2009; Yang et al., 2006). In the kidney, AT1 and D1 or D2 receptors have been suggested to counterregulate each other by forming heterodimers (Khan et al., 2008; Zeng et al., 2006). It is now generally accepted that abnormal counterregulatory interactions between dopamine and angiotensin play a major role in kidney degenerative changes, hypertension, and longevity (Chugh et al., 2013, 2012; Yang et al., 2012). In the basal ganglia of rodents and primates, dopaminergic neurons, astrocytes, and

Fig. 5. Striatal and nigral tyrosine hydroxylase-immunoreactivity (TH-ir; AeE) and levels of dopamine and its metabolite DOPAC (F) in young controls and aged rats. TH-ir was higher in young rats (n ¼ 8) than in aged rats (n ¼ 6; A). Representative photomicrographs of the striatum and substantia nigra of young and aged rats are shown in BeE. The density of striatal dopaminergic terminals and TH-ir in the substantia nigra was estimated as optical density and expressed as a percentage of the value for the control young rats. Striatal levels of dopamine and DOPAC were much lower in aged rats (n ¼ 3) than in young rats (n ¼ 5; F). However there was no compensatory increase in dopamine turnover (DOPAC to dopamine ratio). Data are means  SEM. * p < 0.05 relative to the control group (young adult rats) (Student t test). Scale bar: 500 mm. Abbreviations: DOPAC, 3,4dihydroxyphenylacetic acid; SEM, standard error of the mean.

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

1735

Fig. 7. Real-time quantitative PCR (A, C), Western blot (WB; B, D, E, G) and HPLC þ EIA (H) analysis of changes in the expression of AT1 receptors (A, B), AT2 receptors (C, D), AT1 to AT2 protein ratio (E), activity of the angiotensin converting enzyme (ACE; F) and levels of angiotensinogen and/or angiotensin (ANG; G) and AII (H) in the striatum and nigral region in young (n ¼ 12) and aged (n ¼ 15) rats treated (n ¼ 18) and not treated (n ¼ 16) with 6-hydroxydopamine (6-OHDA; i.e., subjected to maximal dopamine depletion). Protein expression was measured relative to the GAPDH band value and the expression of each gene was measured relative to that of the housekeeping transcripts (b-Actin). The results were normalized to the values for young control rats (100%). Data are means  SEM. * p < 0.05 relative to young controls, # p < 0.05 relative to aged rats, & p < 0.05 relative to young þ 6OHDA. One-way analysis of variance (ANOVA) and Bonferroni post hoc test. Abbreviations: AII, angiotensin II; EIA, enzyme immunoassay; HPLC, high performance liquid chromatography; SEM, standard error of the mean.

microglia have dopamine receptors (Färber et al., 2005; Miyazaki et al., 2004) and also NADPH-oxidase complex and AT1 and AT2 receptors (Garrido-Gil et al., 2013; Joglar et al., 2009; RodriguezPallares, 2008). A decrease in the dopaminergic function (e.g.,

aging-related decrease) may induce upregulation (i.e., increased AT1 and AT1 to AT2 ratio) of the local RAS function both in dopaminergic neurons and glial cells. The resulting overactivation of the RAS may exacerbate the microglial inflammatory

1736

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

Fig. 8. Real-time quantitative PCR (A, B) and Western blot (WB; C, D) analysis of changes in the expression of AT1 receptors (A, C), AT2 receptors (B, D), in the striatum and nigral region in young (n ¼ 12) and aged (n ¼ 8) rats treated (n ¼ 10) and not treated (n ¼ 10) with L-Dopa. Protein expression was measured relative to the GAPDH band value and the expression of each gene was measured relative to that of the housekeeping transcripts (b-Actin). The results were normalized to the values for rats that did not receive L-Dopa treatment (100%). Data are means  SEM. * p < 0.05 relative to the corresponding untreated rats (Student t test). Abbreviations: SEM, standard error of the mean.

response and oxidative stress and increase dopaminergic cell vulnerability to neurotoxins or other pathogenic factors. We have recently confirmed this in aged rats, which showed increased RAS activation together with an increase in markers of inflammation and oxidative stress in the nigrostriatal system and enhanced dopaminergic vulnerability to 6-OHDA (Villar-Cheda et al., 2012). Furthermore, RAS hyperactivity has been demonstrated to play a major role because all the above markers (oxidative stress, neuroinflammation, and dopaminergic vulnerability) decreased significantly after treatment of aged rats with the AT1 receptor antagonist candesartan (Villar-Cheda et al., 2012). This is consistent with our previous findings in young animals showing that the neurotoxic effect induced by low doses of dopaminergic neurotoxins (Sanchez-Iglesias et al., 2007) is increased by AII and inhibited by treatment with ACE inhibitors (Lopez-Real et al., 2005; Muñoz et al., 2006) or AT1 receptor antagonists (Joglar et al., 2009; Rey et al., 2007; Rodriguez-Pallares et al., 2008), which lead to significant reduction in the loss of dopaminergic neurons, nigral levels of protein oxidation and lipid peroxidation, and microglial activation. In the present study, the marked decrease in D1 and D2 receptor expression, and the significant decrease in TH expression and striatal dopamine levels in aged rats relative to young rats, are consistent with several previous findings in rodents and humans (Colebrooke et al., 2006; Suzuki et al., 2001; Wang et al., 1998; Yurek et al., 1998). As observed, in young mice lacking D1 or D2 receptors and young rats with 6-OHDA dopamine depletion, we

observed a marked increase in AT1 receptors in aged rats, which may be responsible for the pro-oxidative, pro-inflammatory state, and increased vulnerability of dopaminergic neurons observed in previous studies (Villar-Cheda et al., 2012). In contrast with findings in young mice and young rats, this was not attenuated by an increase in AT2 receptors or a decrease in angiotensinogen and/or angiotensin levels in aged rats. Moreover, AT2 receptor expression was significantly lower than in young normal rats. To confirm the lack of compensatory upregulation of AT2 receptors in aged rats, young and aged rats were subjected to 6-OHDA dopamine depletion. In young rats, dopamine depletion induced a significant increase in AT1 and AT2 receptor expression, which led to no significant change in the AT1 to AT2 receptor ratio. In aged rats, in which AT2 receptor levels were significantly lower than in young control rats, dopamine depletion induced an additional increase in AT1 receptor expression and no significant increase in AT2 receptor expression, and led to additional increase in the AT1 to AT2 receptor ratio. Furthermore, there was no compensatory decrease in levels of angiotensinogen and/or angiotensin or ACE activity in dopaminedepleted aged rats. The absence of a counterregulatory increase in AT2 receptor expression in aged rats, despite the marked increase in AT1 receptor expression, may contribute to further enhancement of a pro-oxidant and proinflammatory state and increased dopamine neuron vulnerability. The decreased capacity of aged rats to develop compensatory mechanisms has been observed in several previous studies. It is well known that, in young animals, a lack of dopamine receptor activation (i.e., dopamine depletion) induces

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

compensatory over-expression of D2 receptors, and that dopamine turnover increases in partial dopaminergic lesions (Fornaretto et al., 1993; Todd et al., 1996). In contrast, aged rats show decreased levels of dopamine and also decreased levels of dopamine receptors and no change (even a nonsignificant decrease) in dopamine turnover. In a recent study we also observed that estrogen replacement normalized AT2 expression in young rats subjected to surgical menopause, but that AT2 expression was not normalized in natural (aged) menopausal rats treated with estrogen (Rodriguez-Perez et al., 2012). Aged rats showed decreased dopaminergic activity and increased RAS activity (i.e., increased AT1 to AT2 ratio). However, it is interesting to note that the 6-OHDA-induced depletion of this low level of dopaminergic activity leads to much higher increase in RAS activity (AT1 receptor expression and AT1 to AT2 ratio) than 6-OHDA-induced depletion of higher levels of dopamine in young animals. We think that, in addition to the decreased dopaminergic activity, there are additional factors acting on the RAS activity in aged rats. These additional aging-related factors contribute to the increased RAS activity, and are not counteracted after the 6OHDA-induced dopamine depletion in aged rats, leading to higher increase in AT1 expression as compared with young rats. Furthermore, we investigated the effect of L-Dopa treatment on AT1 to AT2 ratio in young and aged rats. AT1 and AT2 receptor expression was reduced by L-Dopa treatment in young rats. However, no significant changes were observed in aged rats treated with L-Dopa. This may be expected as it is known that the response of age-associated parkinsonism to L-Dopa is poor or ineffective (Darbin, 2012; Hurley et al., 2011; Newman et al., 1985). The reduced levels of dopamine receptors, decreased activity of LDopa-decarboxylase (de la FuenteeFernandez et al., 2011) and other aging-related changes may lead to a poor increase in dopaminergic activity, which is probably insufficient to decrease RAS activity, and particularly to counteract the previously mentioned additional factors that may increase RAS activity in aged rats and are absent in young rats. In conclusion, the results of the present study show that, in addition to its role as an essential neurotransmitter, dopamine plays an important role in modulating the brain RAS in the substantia nigra and striatum, which has been previously shown to play a major role in the microglial inflammatory response, neuronal oxidative stress, and dopaminergic vulnerability. The aging-related downregulation of dopamine receptors and dopaminergic function leads to upregulation of the pro-oxidant and proinflammatory AT1 receptor pathway. The results also show that aged rats are not able to increase the expression of AT2 receptors in response to dopamine depletion and downregulation of dopamine receptors, which enhances the deleterious effect of the aged-related increase in AT1 receptors. RAS overactivity was not significantly inhibited by L-Dopa therapy in aged rats. Interestingly, we have previously observed that the increase in neuroinflammation, oxidative stress indicators, and dopaminergic vulnerability related to AT1 overactivity are inhibited in aged rats by treatment with AT1 receptor antagonists, which are currently used to treat vascular diseases in clinical practice. Disclosure statement The authors have no actual or potential conflicts of interest to declare. Acknowledgements The authors thank Pilar Aldrey, Iria Novoa, and Jose A. Trillo for their excellent technical assistance. This work was supported by

1737

Spanish Ministry of Economy and Competitiveness, Spanish Ministry of Health (RD06/0010/0013 and CIBERNED), Galician Government (XUGA), and European Regional Development Fund (FEDER).

References Ares-Santos, S., Granado, N., Oliva, I., O’Shea, E., Martin, E.D., Colado, M.I., Moratalla, R., 2012. Dopamine D(1) receptor deletion strongly reduces neurotoxic effects of methamphetamine. Neurobiol. Dis. 45, 810e820. Babior, B.M., 2004. NADPH oxidase. Curr. Opin. Immunol. 16, 42e47. Basso, N., Paglia, N., Stella, I., de Cavanagh, E.M., Ferder, L., del Rosario Lores Arnaiz, M., Inserra, F., 2005. Protective effect of the inhibition of the reninangiotensin system on aging. Regul. Pept. 128, 247e252. Benigni, A., Cassis, P., Remuzzi, G., 2010. Angiotensin II revisited: new roles in inflammation, immunology and aging. EMBO Mol. Med. 2, 247e257. Benigni, A., Corna, D., Zoja, C., Sonzogni, A., Latini, R., Salio, M., Conti, S., Rottoli, D., Longaretti, L., Cassis, P., Morigi, M., Coffman, T.M., Remuzzi, G., 2009. Disruption of the Ang II type 1 receptor promotes longevity in mice. J. Clin. Invest. 119, 524e530. Benigni, A., Orisio, S., Noris, M., Iatropoulos, P., Castaldi, D., Kamide, K., Rakugi, H., Arai, Y., Todeschini, M., Ogliari, G., Imai, E., Gondo, Y., Hirose, N., Mari, D., Remuzzi, 2013. Variations of the angiotensin II type 1 receptor gene are associated with extreme human longevity. Age (Dordr) 35, 993e1005. http:// dx.doi.org/10.1007/s11357-012-9408-8. Choi, D.Y., Zhang, J., Bing, G., 2010. Aging enhances the neuroinflammatory response and alpha-synuclein nitration in rats. Neurobiol. Aging 31, 1649e1653. Chugh, G., Lokhandwala, M.F., Asghar, M., 2012. Altered functioning of both renal dopamine D1 and angiotensin II type 1 receptors causes hypertension in old rats. Hypertension 59, 1029e1036. Chugh, G., Pokkunuri, I., Asghar, M., 2013. Renal dopamine and angiotensin II receptor signaling in age-related hypertension. Am. J. Physiol. Ren. Physiol. 304, F1eF7. Colebrooke, R.E., Humby, T., Lynch, P.J., McGowan, D.P., Xia, J., Emson, P.C., 2006. Age-related decline in striatal dopamine content and motor performance occurs in the absence of nigral cell loss in a genetic mouse model of Parkinson’s disease. Eur. J. Neurosci. 24, 2622e2630. Collier, T.J., Lipton, J., Daley, B.F., Palfi, S., Chu, Y., Sortwell, C., Bakay, R.A., Sladek Jr., J.R., Kordower, J.H., 2007. Aging-related changes in the nigrostriatal dopamine system and the response to MPTP in nonhuman primates: diminished compensatory mechanisms as a prelude to parkinsonism. Neurobiol. Dis. 26, 56e65. Cruz-Muros, I., Afonso-Oramas, D., Abreu, P., Pérez-Delgado, M.M., Rodríguez, M., González-Hernández, T., 2009. Aging effects on the dopamine transporter expression and compensatory mechanisms. Neurobiol. Aging 30, 973e986. Csiszar, A., Ungvari, Z., Koller, A., Edwards, J.G., Kaley, G., 2003. Aging-induced proinflammatory shift in cytokine expression profile in coronary arteries. FASEB J. 17, 1183e1185. Cui, L., Nithipatikom, K., Campbell, W.B., 2007. Simultaneous analysis of angiotensin peptides by LC-MS and LC-MS/MS: metabolism by bovine adrenal endothelial cells. Anal. Biochem. 369, 27e33. Darbin, O., 2012. The aging striatal dopamine function. Parkinsonism Relat. Disord. 18, 426e432. Darmopil, S., Martín, A.B., De Diego, I.R., Ares, S., Moratalla, R., 2009. Genetic inactivation of dopamine D1 but not D2 receptors inhibits L-DOPA-induced dyskinesia and histone activation. Biol. Psychiatry 66, 603e613. de la Fuente-Fernández, R., Schulzer, M., Kuramoto, L., Cragg, J., Ramachandiran, N., Au, W.L., Mak, E., McKenzie, J., McCormick, S., Sossi, V., Ruth, T.J., Lee, C.S., Calne, D.B., Stoessl, A.J., 2011. Age-specific progression of nigrostriatal dysfunction in Parkinson’s disease. Ann. Neurol. 69, 803e810. Färber, K., Pannasch, U., Kettenmann, H., 2005. Dopamine and noradrenaline control distinct functions in rodent microglial cells. Mol. Cell Neurosci. 29, 128e138. Fearnley, J.M., Lees, A.J., 1991. Ageing and Parkinson’s disease: substantia nigra regional selectivity. Brain 114, 2283e2301. Fornaretto, M.G., Caccia, C., Caron, M.G., Fariello, R.G., 1993. Dopamine receptors status after unilateral nigral 6-OHDA lesion. Autoradiographic and in situ hybridization study in the rat brain. Mol. Chem. Neuropathol. 19, 147e162. Garrido, A.M., Griendling, K.K., 2009. NADPH oxidases and angiotensin II receptor signaling. Mol. Cell Endocrinol. 302, 148e158. Garrido-Gil, P., Valenzuela, R., Villar-Cheda, B., Lanciego, J.L., Labandeira-Garcia, J.L., 2013. Expression of angiotensinogen and receptors for angiotensin and prorenin in the monkey and human substantia nigra: an intracellular renin-angiotensin system in the nigra. Brain Struct. Funct. 218, 373e388. Gildea, J.J., 2009. Dopamine and angiotensin as renal counterregulatory systems controlling sodium balance. Curr. Opin. Nephrol. Hypertens. 18, 28e32. Grammatopoulos, T.N., Jones, S.M., Ahmadi, F.A., Hoover, B.R., Snell, L.D., Skoch, J., Jhaveri, V.V., Poczobutt, A.M., Weyhenmeyer, J.A., Zawada, W.M., 2007. Angiotensin type 1 receptor antagonist losartan, reduces MPTP-induced degeneration of dopaminergic neurons in substantia nigra. Mol. Neurodegener. 2, 1. Granado, N., Ares-Santos, S., Oliva, I., O’Shea, E., Martin, E.D., Colado, M.I., Moratalla, R., 2011. Dopamine D2-receptor knockout mice are protected against dopaminergic neurotoxicity induced by methamphetamine or MDMA. Neurobiol. Dis. 42, 391e403.

1738

B. Villar-Cheda et al. / Neurobiology of Aging 35 (2014) 1726e1738

Griendling, K.K., Sorescu, D., Ushio-Fukai, M., 2000. NADPH oxidase. Role in cardiovascular biology and disease. Circ. Res. 86, 494e501. Hemming, M.L., Selkoe, D.J., Farris, W., 2007. Effects of prolonged angiotensinconverting enzyme inhibitor treatment on amyloid b-protein metabolism in mouse models of Alzheimer disease. Neurobiol. Dis. 26, 273e281. Hudson, J.L., Van Horne, C.G., Stromberg, I., Brock, S., Clayton, J., Masserano, J., Hoffer, B.J., Gerhardt, G.A., 1993. Correlation of apomorphine and amphetamineeinduced turning with nigrostriatal dopamine content in unilateral 6hydroxydopamine lesioned rats. Brain Res. 626, 167e174. Hurley, P.J., Elsworth, J.D., Whittaker, M.C., Roth, R.H., Redmond Jr., D.E., 2011. Aged monkeys as a partial model for Parkinson’s disease. Pharmacol. Biochem. Behav. 99, 324e332. Hussain, T., Abdul-Wahab, R., Kotak, D.K., Lokhandwala, M.F., 1998. Bromocriptine regulates angiotensin II response on sodium pump in proximal tubules. Hypertension 32, 1054e1059. Joglar, B., Rodriguez-Pallares, J., Rodríguez-Perez, A.I., Rey, P., Guerra, M.J., Labandeira-Garcia, J.L., 2009. The inflammatory response in the MPTP model of Parkinson’s disease is mediated by brain angiotensin: relevance to progression of the disease. J. Neurochem. 109, 656e669. Khan, F., Spicarová, Z., Zelenin, S., Holtbäck, U., Scott, L., Aperia, A., 2008. Negative reciprocity between angiotensin II type 1 and dopamine D1 receptors in rat renal proximal tubule cells. Am. J. Physiol. Ren. Physiol. 295, F1110eF1116. Kramer, P.F., Christensen, C.H., Hazelwood, L.A., Dobi, A., Bock, R., Sibley, D.R., Mateo, Y., Alvarez, V.A., 2011. Dopamine D2 receptor overexpression alters behavior and physiology in Drd2-EGFP mice. J. Neurosci. 31, 126e132. Kubis, N., Faucheux, B.A., Ransmayr, G., Damier, P., Duyckaerts, C., Henin, D., Forette, B., Le Charpentier, Y., Hauw, J.J., Agid, Y., Hirsch, E.C., 2000. Preservation of midbrain catecholaminergic neurons in very old human subjects. Brain 123, 366e373. Li, H., Han, W., Villar, V.A., Keever, L.B., Lu, Q., Hopfer, U., Quinn, M.T., Felder, R.A., Jose, P.A., Yu, P., 2009. D1-like receptors regulate NADPH oxidase activity and subunit expression in lipid raft microdomains of renal proximal tubule cells. Hypertension 53, 1054e1061. Lopez-Real, A., Rey, P., Soto-Otero, R., Mendez-Alvarez, E., Labandeira-Garcia, J.L., 2005. Angiotensin-converting enzyme inhibition reduces oxidative stress and protect dopaminergic neurons in a 6-hydroxydopamine rat model of Parkinsonism. J. Neurosci. Res. 81, 865e873. Lou, M., Blume, A., Zhao, Y., Gohlke, P., Deuschl, G., Herdegen, T., Culman, J., 2004. Sustained blockade of brain AT1 receptors before and after focal cerebral ischemia alleviates neurologic deficits and reduces neuronal injury, apoptosis, and inflammatory responses in the rat. J. Cereb. Blood Flow Metab. 24, 536e547. Marchesi, C., Paradis, P., Schiffrin, E.L., 2008. Role of the renin-angiotensin system in vascular inflammation. Trends Pharmacol. Sci. 29, 367e374. McCarthy, C.A., Widdop, R.E., Denton, K.M., Jones, E.S., 2013. Update on the angiotensin AT(2) receptor. Curr. Hypertens. Rep. 15, 25e30. McGeer, P.L., Itagaki, S., Akiyama, H., McGeer, E.G., 1988. Rate of cell death in parkinsonism indicates active neuropathological process. Ann. Neurol. 24, 574e576. Miyazaki, I., Asanuma, M., Diaz-Corrales, F.J., Miyoshi, K., Ogawa, N., 2004. Direct evidence for expression of dopamine receptors in astrocytes from basal ganglia. Brain Res. 1029, 120e123. Muñoz, A., Rey, P., Guerra, M.J., Mendez-Alvarez, E., Soto-Otero, R., LabandeiraGarcia, J.L., 2006. Reduction of dopaminergic degeneration and oxidative stress by inhibition of angiotensin converting enzyme in a MPTP model of parkinsonism. Neuropharmacology 51, 112e120. Newman, R.P., LeWitt, P.A., Jaffe, M., Calne, D.B., Larsen, T.A., 1985. Motor function in the normal aging population: treatment with levodopa. Neurology 35, 571e573. Okamura, A., Rakugi, H., Ohishi, M., Yanagitani, Y., Takiuchi, S., Moriguchi, K., Fennessy, P.A., Higaki, J., Ogihara, T., 1999. Upregulation of renin-angiotensin system during differentiation of monocytes to macrophages. J. Hypertens. 17, 537e545. Padia, S.H., Carey, R.M., 2013. AT2 receptors: beneficial counter-regulatory role in cardiovascular and renal function. Pflugers Arch. 465, 99e110. Paxinos, G., Watson, C., 1986. The Rat Brain in Stereotaxic Coordinates. Academic Press, New York. Rey, P., Lopez-Real, A., Sanchez-Iglesias, S., Muñoz, A., Soto-Otero, R., LabandeiraGarcia, J.L., 2007. Angiotensin type-1-receptor antagonists reduce 6hydroxydopamine toxicity for dopaminergic neurons. Neurobiol. Aging 28, 555e567. Rodriguez-Pallares, J., Parga, J.A., Joglar, B., Guerra, M.J., Labandeira-Garcia, J.L., 2012. Mitochondrial ATP-sensitive potassium channels enhance angiotensin-induced oxidative damage and dopaminergic neuron degeneration. Relevance for agingassociated susceptibility to Parkinson’s disease. Age (Dordr) 34, 863e880. Rodriguez-Pallares, J., Parga, J.A., Muñoz, A., Rey, P., Guerra, M.J., LabandeiraGarcia, J.L., 2007. Mechanism of 6-hydroxydopamine neurotoxicity: the role of NADPH oxidase and microglial activation in 6-hydroxydopamine-induced degeneration of dopaminergic neurons. J. Neurochem. 103, 145e156. Rodriguez-Pallares, J., Rey, P., Parga, J.A., Muñoz, A., Guerra, M.J., LabandeiraGarcia, J.L., 2008. Brain angiotensin enhances dopaminergic cell death via microglial activation and NADPH-derived ROS. Neurobiol. Dis. 31, 58e73. Rodriguez-Perez, A.I., Valenzuela, R., Villar-Cheda, B., Guerra, M.J., LabandeiraGarcia, J.L., 2012. Different dopaminergic neuroprotection of hormonal

replacement therapy in young and aged menopausal rats: role of the brain angiotensin system. Brain 135, 124e138. Ruiz-Ortega, M., Lorenzo, O., Ruperez, M., Suzuki, Y., Egido, J., 2001. Proinflammatory actions of angiotensin II. Curr. Opin. Nephrol. Hypertens. 10, 321e329. Sanchez-Iglesias, S., Rey, P., Mendez-Alvarez, E., Labandeira-Garcia, J.L., SotoOtero, R., 2007. Time-course of brain oxidative damage caused by intrastriatal administration of 6-hydroxydopamine in a rat model of Parkinson’s disease. Neurochem. Res. 32, 99e105. Shao, W., Zhang, S.Z., Tang, M., Zhang, X.H., Zhou, Z., Yin, Y.Q., Zhou, Q.B., Huang, Y.Y., Liu, Y.J., Wawrousek, E., Chen, T., Li, S.B., Xu, M., Zhou, J.N., Hu, G., Zhou, J.W., 2013. Suppression of neuroinflammation by astrocytic dopamine D2 receptors via aB-crystallin. Nature 494, 90e94. Sheh, Y.L., Hsu, C., Chan, S.H., Chan, J.Y., 2007. NADPH oxidase- and mitochondrionderived superoxide at rostral ventrolateral medulla in endotoxin-induced cardiovascular depression. Free Radic. Biol. Med. 42, 1610e1623. Sohn, H.Y., Raff, U., Hoffmann, A., Gloe, T., Heermeier, T.K., Galle, J., Pohl, U., 2000. Differential role of angiotensin II receptor subtypes on endothelial superoxide formation. Br. J. Pharmacol. 131, 667e672. Stegbauer, J., Lee, D.H., Seubert, S., Ellrichmann, G., Manzel, A., Kvakan, H., Muller, D.N., Gaupp, S., Rump, L.C., Gold, R., Linker, R.A., 2009. Role of the reninangiotensin system in autoimmune inflammation of the central nervous system. Proc. Natl. Acad. Sci. U.S.A 106, 14942e14947. Suzuki, M., Hatano, K., Sakiyama, Y., Kawasumi, Y., Kato, T., Ito, K., 2001. Age-related changes of dopamine D1-like and D2-like receptor binding in the F344/N rat striatum revealed by positron emission tomography and in vitro receptor autoradiography. Synapse 41, 285e293. Suzuki, Y., Ruiz-Ortega, M., Lorenzo, O., Ruperez, M., Esteban, V., Egido, J., 2003. Inflammation and angiotensin II. Int. J. Biochem. Cell. Biol. 35, 881e900. Todd, R.D., Carl, J., Harmon, S., O’Malley, K.L., Perlmutter, J.S., 1996. Dynamic changes in striatal dopamine D2 and D3 receptor protein and mRNA in response to 1methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) denervation in baboons. J. Neurosci. 16, 7776e7782. Ungvari, Z., Csiszar, A., Kaley, G., 2004. Vascular inflammation in aging. Herz 29, 733e740. Valenzuela, R., Barroso-Chinea, P., Villar-Cheda, B., Joglar, B., Muñoz, A., Lanciego, J.L., Labandeira-Garcia, J.L., 2010. Location of prorenin receptors in primate substantia nigra: effects on dopaminergic cell death. J. Neuropathol. Exp. Neurol. 69, 1130e1142. Villar-Cheda, B., Valenzuela, R., Rodriguez-Perez, A.I., Guerra, M.J., LabandeiraGarcia, J.L., 2012. Aging-related changes in the nigral angiotensin system enhances proinflammatory and pro-oxidative markers and 6-OHDA-induced dopaminergic degeneration. Neurobiol. Aging 33, 204.e1e204.e11. Wang, Y., Chan, G.L., Holden, J.E., Dobko, T., Mak, E., Schulzer, M., Huser, J.M., Snow, B.J., Ruth, T.J., Calne, D.B., Stoessl, A.J., 1998. Age-dependent decline of dopamine D1 receptors in human brain: a PET study. Synapse 30, 56e61. Wu, D., Teisman, P., Tieu, K., Vila, M., Jackson-Lewis, V., Ischiropoulos, H., Przedborski, S., 2003. NADPH oxidase mediates oxidative stress in the 1methyl-4-phenyl-1,2,3,6-tetrahydropyridine model of Parkinson’s disease. Proc. Natl. Acad. Sci. U.S.A 100, 6145e6150. Yanagitani, Y., Rakugi, H., Okamura, A., Moriguchi, K., Takiuchi, S., Ohishi, M., Suzuki, K., Higaki, J., Ogihara, T., 1999. Angiotensin II type 1 receptor-mediated peroxide production in human macrophages. Hypertension 33, 335e339. Yang, S., Yao, B., Zhou, Y., Yin, H., Zhang, M.Z., Harris, R.C., 2012. Intrarenal dopamine modulates progressive angiotensin II-mediated renal injury. Am. J. Physiol. Ren. Physiol. 302, F742eF749. Yang, Z., Asico, L.D., Yu, P., Wang, Z., Jones, J.E., Escano, C.S., Wang, X., Quinn, M.T., Sibley, D.R., Romero, G.G., Felder, R.A., Jose, P.A., 2006. D5 dopamine receptor regulation of reactive oxygen species production, NADPH oxidase, and blood pressure. Am. J. Physiol. Regul. Integr. Comp. Physiol. 290, R96eR104. Yurek, D.M., Hipkens, S.B., Hebert, M.A., Gash, D.M., Gerhardt, G.A., 1998. Agerelated decline in striatal dopamine release and motoric function in brown Norway/Fischer 344 hybrid rats. Brain Res. 791, 246e256. Zawada, W.M., Banninger, G.P., Thornton, J., Marriott, B., Cantu, D., Rachubinski, A.L., Das, M., Griffin, W.S., Jones, S.M., 2011. Generation of reactive oxygen species in 1-methyl-4-phenylpyridinium (MPPþ) treated dopaminergic neurons occurs as an NADPH oxidase-dependent two-wave cascade. J. Neuroinflammation 8, 129. Zeng, C., Liu, Y., Wang, Z., He, D., Huang, L., Yu, P., Zheng, S., Jones, J.E., Asico, L.D., Hopfer, U., Eisner, G.M., Felder, R.A., Jose, P.A., 2006. Activation of D3 dopamine receptor decreases angiotensin II type 1 receptor expression in rat renal proximal tubule cells. Circ. Res. 99, 494e500. Zeng, C., Luo, Y., Asico, L.D., Hopfer, U., Eisner, G.M., Felder, R.A., Jose, P.A., 2003. Perturbation of D1 dopamine and AT1 receptor interaction in spontaneously hypertensive rats. Hypertension 42, 787e792. Zhang, G.X., Lu, X.M., Kimura, S., Nishiyama, A., 2007. Role of mitochondria in angiotensin II-induced reactive oxygen species and mitogen-activated protein kinase activation. Cardiovasc. Res. 76, 204e212. Zhang, M.Z., Yao, B., Yang, S., Wang, S., Fan, X., Yin, H., Fogo, A.B., Moeckel, G.W., Harris, R.C., 2012. Intrarenal dopamine inhibits progression of diabetic nephropathy. Diabetes 61, 2575e2584.