Advanced Glycation End Products in Degenerative Nucleus Pulposus with Diabetes Tsung-Ting Tsai,1,2 Natalie Yi-Ju Ho,2 Ying-Ting Lin,2 Po-Liang Lai,2 Tsai-Sheng Fu,2 Chi-Chien Niu,2 Lih-Huei Chen,2 Wen-Jer Chen,2 Jong-Hwei S. Pang1 1
Graduate Institute of Clinical Medical Sciences, Chang Gung University, 259 Wenhwa 1st Road, Taoyuan, Taiwan, R.O.C., 2Department of Orthopaedic Surgery, Spine Section, Chang Gung Memorial Hospital, Taoyuan, Taiwan, R.O.C. Received 4 June 2013; accepted 25 September 2013 Published online 22 October 2013 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/jor.22508
ABSTRACT: Diabetes mellitus (DM) has been clinically proved as a risk factor of disc degeneration, and the accumulation of advanced glycation end products (AGEs) is known to be potentially involved in diabetes. The purpose of this study is to investigate the effect of AGEs in the degeneration process of diabetic nucleus pulposus (NP) in rats and humans. Diabetic NP cells from rat coccygeal discs were treated with different concentrations of AGEs (0, 50, and 100 mg/ml) for 3 days, and mRNA expressions of MMP-2 and RAGE were measured by real-time RT-PCR. In addition, conditioned medium from NP cells was used to analyze protein expression of MMP-2 activity and ERK by gelatin zymography and Western blot. These experiments were repeated using human intervertebral disc samples. The immunohistochemical expression of AGEs was significantly increased in diabetic discs. In response to AGEs, an increase of MMP-2, RAGE, and ERK at both mRNA and protein expression levels was observed in diabetic NP cells. The findings suggest that AGEs and DM are associated with disc degeneration in both species. Hyperglycemia in diabetes enhances the accumulation of AGEs in the NP and triggers disc degeneration. ß 2013 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 32:238–244, 2014. Keywords: advanced glycation end products; disc degeneration; diabetes mellitus; glucose
Disc degenerative disease (DDD) has become a medical, social, and economic problem affecting global human population, because it can cause severe chronic low back pain and greatly affect one’s quality of life.1 Degeneration of intervertebral disc is characterized by increased proteolytic degradation of extracellular matrix and ingrowth of bloods and nerves.2 Among the proteolytic enzymes, an increased production and activation of matrix metalloproteinase-2 (MMP-2) has been shown to correlate with age and degeneration change in the nucleus pulposus (NP).3 Diabetes mellitus (DM) is a chronic condition associated with high blood glucose level resulting from insulin secretory defects and insulin resistance, which becomes a multiorgan disorder affecting many types of tissues.4 Insulin is a hormone producing by pancreatic beta cells, and functions as the key regulator of glucose metabolism. Elevated glucose concentration has been associated with an increased risk of disc degeneration by its direct influence on disc cell proliferation and survival.5 Diabetes has been clinically proved as a risk factor of DDD6,7; however, the pathophysiology has not yet been studied at the cellular and molecular level. Advanced glycation end products (AGEs) are a heterogeneous group of molecules formed from nonenzymatic reaction of reducing sugars with free amino groups of proteins, lipids, and nucleic acids.8 In the initial glycation reaction, high glucose concentration
Grant sponsor: National Science Council of Taiwan; Grant number: NSC100-2314-B-182-059; Grant sponsor: Chang Gung Memorial Hospital, Linkou; Grant number: CMRPG3C0821. Correspondence to: Jong-Hwei S. Pang (T: 886-3-2118800 ext. 3482; F: 886-3-328017; E-mail: [email protected]) # 2013 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
238
JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
encourages the sugars to attach to the amino groups, which lead to the formation of AGEs. The glucose level has been associated with an increased risk of disc degeneration, and the accumulation of AGEs is known to be potentially involved in the progression of diabetes and other age-related disease.9 We assumed that hyperglycemia enhances the formation of AGEs and the accumulation of AGEs in NP leads to the progression of disc degeneration. The purpose of this study is to examine the presence and effect of AGEs in the degeneration process of NP cells in human intervertebral discs and rat coccygeal discs.
METHODS Diabetic Rat Model and Coccygeal Disc Harvest Nine 8-week-old male Sprague-Dawley rats were divided into non-diabetic (n ¼ 4) and diabetic groups (n ¼ 5). Experimental diabetes was induced by a single 65 mg/kg intravenous injection of streptozotocin (STZ; Sigma, St. Louis, MO) that was freshly dissolved in 0.1 M citrate buffer (pH 4.5), and vehicle solution was administrated for non-diabetic group. After an overnight fast, blood glucose concentration was measured before, and 1 month after induction. Rats were considered as diabetic if fasting blood glucose level was greater than 270 mg/dl. All rats were sacrificed with CO2. Under aseptic condition, NP tissues were harvested from coccygeal discs of rat tails for cell culture and histological study. All animal studies were approved by the Institutional Animal Care and Use Committees of our institution. Human Nucleus Pulposus Tissues Harvest Informed consent was obtained from subjects under the approval of the Institutional Review Board of Chang Gung Memorial Hospital. NP tissues at the center of an intervertebral disc were harvested from elderly patients with degenerative disc disease during spinal surgeries. Harvested tissue samples were categorized into non-diabetic and diabetic
AGEs IN DIABETIC DEGENERATIVE NP
239
groups (n ¼ 3 per group), which diabetic samples were from patients with degenerative disc disease and type 2 DM.
with statistically significant at p < 0.05, indicating by an asterisk in the figures.
Histological Analysis Disc specimens were fixed in 10% formaldehyde, decalcified, embedded in paraffin, deparaffinized in xylene, and rehydrated through graded ethanol washes. The sections were incubated with anti-AGE antibody (Abcam, Cambridge, MA) in 1% BSA/PBS at a 1:100 dilution for 2 h at RT. After thoroughly washing the sections, the bound primary antibody was incubated with the secondary antibody for 20 min at RT, then incubated with 3,30 -diaminobenzidine (DakoCytomation, Copenhagen, Denmark) for 10 min, and counterstained with hematoxylin.
RESULTS
Nucleus Pulposus Cell Isolation and Culture Rat and human NP tissues were subjected to overnight digestion with type II collagenase (Worthington, Lakewood, NJ) in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA) and antibiotics at 37˚C in a 5% CO2 humidified incubator. All fibrous collagens were degraded which allowed the release of NP cells from tissues. A monolayer of NP cells was seeded into a 10-cm dish at a density of 5 105 cells per dish. Three days after seeding, cells reached 80% confluence and they were treated with different concentrations of AGEs for 3 days, and then used for mRNA and protein analysis. Real-Time RT-PCR and Western Blot Analysis Real-time RT-PCR and Western blotting were performed as previously described.10 The primers used were human MMP-2 (forward: GGATGATGCCTTTGCTCG; reverse: GGAGTCCGTCCTTACCGT), rat MMP-2 (forward: GTAAGAACAAGAAGACATACAT; reverse: TTATCAGGGATGGCATTC), human RAGE (forward: GGCTGGTGTTCCCAATAA; reverse: TCACAGATACTCCCTTCTCATT), rat RAGE (forward: AATGGTTCACTCCTCCTT; reverse: TCGGTAGTTGGACTTGAC). Gelatin Zymography Conditioned medium (20 ml) from NP cultures were mixed with Laemmli’s sample buffer in the absence of b-mercaptoethanol, and then separated on a 10% SDS–PAGE gel containing 0.1% gelatin. After electrophoresis, the gel was washed in a solution containing 2.5% Triton X-100 to remove SDS, and subsequently incubated in 1 M Tris–HCl buffer containing 1 M CaCl2, 30% Brij and 5 M NaCl for 18 h at 37˚C with shaking. The gel was stained with Coomassie brilliant blue R-250, and the gelatinolytic activity was detected as clear bands against the blue background. The band intensity was analyzed by UVP BioSpectrum Imaging System (Upload, CA). Statistical and Image Analysis All analyses were repeated at least in duplicate. Digital images of three disc sections in each group were collected. Three sub-areas of each section were selected, and the relative density of AGEs was analyzed using Image-Pro Plus software (Media Cybernetics, Bethesda, MD). For each disc sections, an average of three sub-areas was calculated and presented as mean standard deviation by bar graph. The difference between non-diabetic and diabetic discs was revealed in fold change of positive staining. Student’s t-test was used to compare the difference between different concentrations by SigmaPlot (Systat Software, Inc., San Jose, CA)
More AGEs Are Detected in Diabetic Discs from Rat and Human The blood glucose level of diabetic rats at 1 month after STZ induction was 469.67 28.31 mg/dl (n ¼ 5), compared to 84.75 8.20 mg/dl (n ¼ 4) for the control normal rats. The presence of AGEs was examined on the three non-diabetic and three diabetic disc specimens using immunohistochemical analysis. Immunopositive staining for AGEs was observed in both nondiabetic and diabetic discs including annulus fibrosus and NP; however, the expression of AGEs was significantly higher in rat diabetic discs with a 2.44fold increase (Fig. 1), and a 3.35-fold increase in human diabetic discs (Fig. 2), compared to nondiabetic discs. AGEs Induced MMP-2 Expression in Disc Cells Isolated from Diabetic Rat We treated the disc cells with AGEs and measured the change of MMP-2 level, since MMP-2 is known to be highly expressed in degenerative discs. As analyzed by real-time RT-PCR, the MMP-2 mRNA expression in disc cells cultured from diabetic rat coccygeal discs was found to be significantly induced by 50–100 mg/ml AGEs (Fig. 3A). The MMP-2 protein level secreted by rat disc cells was determined by Western blot analysis and the result demonstrated a positive correlation between the protein level of MMP-2 and the concentration of AGEs (Fig. 3B). The gelatinolytic activity of MMP-2 in conditioned medium of disc cells cultured from diabetic rat coccygeal discs was examined by gelatin zymography. Both the latent and active forms of MMP-2 were detected; however, the major proportion of MMP-2 produced in response to AGEs treatment was in its active-form. MMP-2 activity was significantly increased with increasing concentration of AGEs in dose-dependent manner (Fig. 3C). Interestingly, the modulation of MMP-2 gene expression by AGEs in disc cells cultured from diabetic rat, however, was not significantly detected in disc cells cultured from normal rat (data not shown). AGEs Increased the RAGE Expression and Activated ERK in Disc Cells Isolated from Diabetic Rat RAGE is a 35 kD transmembrane receptor of the immunoglobulin superfamily that can be bound by AGEs, and triggers the downstream signal pathway such as ERK pathway. Real-time RT-PCR result showed that rat disc cells expressed readily detectable level of RAGE. RAGE expression was dose-dependently up-regulated by AGEs in disc cells from diabetic rat (Fig. 4). Similarly to the AGEs-induced RAGE expression, Western blot analysis revealed that AGEs could also dose-dependently activate phosphorylaion of ERK in disc cells from diabetic rat (Fig. 5). JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
240
TSAI ET AL.
Figure 1. Increased AGEs expression in rodent diabetic coccygeal discs. Comparative immunohistochemical images and qualification of AGEs expression between non-diabetic and diabetic samples. p < 0.05 when compared to non-diabetic samples.
Effect of AGEs on MMP-2, RAGE, and ERK Expressions in Human Disc Cells Cultured from Diabetic Nucleus Pulposus To study whether the similar effect of AGEs also occurs in disc tissue isolated from diabetic patients combined with the problem of disc degeneration, the expression of MMP-2 under the effect of AGEs was further investigated in human disc cells cultured from diabetic NP by real-time RT-PCR and Western blot analysis, respectively. Similar to the findings in the diabetic rat study, disc cells treated with AGEs showed an increase in MMP-2 expression at both the mRNA and the protein levels (Fig. 6A and B); in addition, the up-regulated expressions of RAGE at the mRNA level and the activation of ERK were correlated with the increased concentration of AGEs (Fig. 6C and D).
DISCUSSION The incidence of DDD is increasing in world population and becoming the reason for receiving spinal surgeries. It will be helpful if we can identify the JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
factors involved in the pathogenesis of disc degeneration; therefore, in current study, we would like to focus on investigating the relationship of AGEs and disc degeneration at the cellular and molecular basis, especially in diabetic status. DM is a metabolic disease characterized by persistent hyperglycemia and is associated with many complications including cardiovascular disease, nephropathy, neuropathy, and retinopathy11; however, previous studies have reported conflicting results on the association of disc degeneration and diabetes. In a cross-sectional study by Vogt et al.,12 the results showed no relation between the diabetes and the degeneration changes in the spine. On the contrary, Robinson et al.13 related the degenerative changes in intervertebral disc to diabetes by observing the presence of proteoglycans with lower buoyant density and substantially undersulfated glycosaminoglycan in operated discs of diabetic patients. In Ziv et al.14, similar to human change, the aged and diabetic discs in sand rats demonstrate reduced hydration, and fixed charge density.
AGEs IN DIABETIC DEGENERATIVE NP
241
Figure 2. Increased AGEs expression in human diabetic intervertebral discs. Comparative immunohistochemical images and qualification of AGEs expression between non-diabetic and diabetic samples. p < 0.01 when compared to non-diabetic samples.
Consequently, many later studies have focused on finding the features in diabetes that may be causing disc degeneration. Won et al.15 used spontaneously diabetic rats with mild obesity and late-onset of hyperglycemia to investigate the relationship between high glucose and early disc degeneration. The premature, excessive apoptosis of NP notochordal cells significantly increased the MMPs expression in the NP of diabetic rats, which lead to rapid disc degeneration and fibrosis. Jiang et al.16 demonstrated a direct cause effect relationship between type 1 diabetes and intervertebral disc degeneration. Diabetes decreased the expressions of proteoglycan, aggrecan, and collagen II in NP cells of STZ-induced diabetic rats, while cellular apoptosis and senescence were increased. However, the findings of both studies did not indicate that the exact cause of these premature changes is due to hyperglycemia or other diabetes-related factors.
In addition, the effect of diabetes-related AGE formation on disc degeneration has also been evaluated. Tsuru et al.17 immunologically confirmed the presence of AGE-producing cells in human degenerated intervertebral discs obtained during operation, and concluded that tissue homeostasis and repair may be disturbed by excessive accumulation of AGEs, which could lead to tissue injury. The author suggested that sugar is the cause, and aging is the result. Yokosuka et al.18 showed that AGEs and RAGE were presented in the NP of intervertebral discs, and also demonstrated the suppression of aggrecan expression by treating with AGEs. In the current study, we confirmed that AGEs and RAGE were presented in human and rat discs, with increased expression in diabetic discs, and further proved that AGEs significantly enhanced MMP-2 expression at both the mRNA and protein levels. JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
242
TSAI ET AL.
Figure 3. AGEs increased MMP-2 expression at the mRNA and protein levels. Diabetic NP cells from rats were treated with different concentrations of AGEs and analyzed by (A) real-time PCR, (B) Western blot, and (C) gelatin zymography. p < 0.05, p < 0.01.
AGEs are a complex and heterogeneous group of compounds that have been implicated in diabetesrelated complications. The formation of AGEs is through the reaction of amino groups in protein, lipids, and nucleic acids with the reduced sugars such as
Figure 4. AGEs increased RAGE expression at the mRNA level. Diabetic NP cells from rats were treated with different concentrations of AGEs and analyzed by real-time PCR. JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
Figure 5. AGEs increased ERK expression at the protein level. Diabetic NP cells from rats were treated with different concentrations of AGEs and analyzed by Western blot. p < 0.05, p < 0.01.
AGEs IN DIABETIC DEGENERATIVE NP
243
Figure 6. AGEs increased MMP-2, RAGE, and ERK expressions in human diabetic intervertebral discs. The MMP-2 expression at the mRNA level was measured by (A) real-time PCR and (B) Western blot at the protein level. (C) The RAGE expression was analyzed using real-time PCR and (D) the ERK expression was by Western blot. p < 0.05.
glucose non-enzymatically by Maillard reaction. Advanced glycation occurs over a period of weeks, thereby proteins affected by covalent cross-link formation are stable and long lived, such as collagen.19 Under diabetic conditions, AGEs accumulates abnormally in various tissues and organs, which can contribute to a gradual decline in tissue function and lead to the pathogenesis of diabetic complications. It can lead to structural alterations and functional interference of plasma and extracellular matrix proteins by forming covalent crosslink, which reduces the flexibility and elasticity of proteins.20 AGEs have been shown to increase the mechanical stiffness in many tissues including annulus fibrosus; the concentration of AGEs was positively correlated with collagen crosslinking.21 AGEs can also initiate cellular degradation and harmful inflammatory and autoimmune responses by interacting with a variety of cell-surface AGEbinding receptors. The interaction with AGES and RAGE activates its downstream signaling pathways and cause the overproduction of pro-inflammatory cytokines and oxygen radicals.22 The formation of AGEs is accelerated in diabetes due to the increased concentration of glucose. It has
been suggested that high glucose may play an important role in the pathophysiology of intervertebral disc degeneration by inducing MMP expression and activities.23 MMP-2 (gelatinase A) is an enzyme involved in the breakdown of extracellular matrix components in the NP. It is capable of digesting all denatured collagens and degrading native type I, IV, and V collagens.24 Elevated level of MMP-2 indicates tissue turnover, resulting in increased matrix degradation. The loss of matrix compromises the mechanical function of discs and leads to fibrotic response, which eventually develops disc degeneration.3 There are several limitations in this study. First, genetic and phenotypic heterogeneous in patients may influence our outcomes, and it is difficult to eliminate the inter-individual variation in human disc samples. Secondly, STZ-induced diabetic rat is an experimental animal model of type 1 diabetes, which hyperglycemia is developed primarily by direct cytotoxic action on the beta cells rather than the consequence of insulin resistance like type 2 diabetic patients with disc degeneration. Finally, this study only focused on analyzing the expression of MMP-2 and used it to relate AGEs to disc degeneration; however, there are JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
244
TSAI ET AL.
many other factors have been demonstrated to be involved in disc degeneration such as other matrix metalloproteinases, cell apoptosis, inflammatory cytokines and degradative enzymes, etc. Further studies could be conducted to investigate the role of other contributing factors in diabetic disc degeneration. In conclusion, hyperglycemia is attributable to the formation of AGEs. The accumulation of AGEs is accelerated in DM due to the increased concentration of glucose, which leads to highly expressed MMP-2 of disc cells, matrix degradation and substantially promotes disc degeneration development.
REFERENCES 1. Maniadakis N, Gray A. 2000. The economic burden of back pain in the UK. Pain 84:95–103. 2. Le Maitre CL, Freemont AJ, Hoyland JA. 2004. Localization of degradative enzymes and their inhibitors in the degenerate human intervertebral disc. J Pathol 204:47–54. 3. Crean JK, Roberts S, Jaffray DC, et al. 1997. Matrix metalloproteinases in the human intervertebral disc: role in disc degeneration and scoliosis. Spine (Phila Pa 1976) 22: 2877–2884. 4. Silberberg R. 1986. The skeleton in diabetes mellitus: a review of the literature. Diabetes Res 3:329–338. 5. Johnson WE, Stephan S, Roberts S. 2008. The influence of serum, glucose and oxygen on intervertebral disc cell growth in vitro: implications for degenerative disc disease. Arthritis Res Ther 10:R46. 6. Sakellaridis N. 2006. The influence of diabetes mellitus on lumbar intervertebral disk herniation. Surg Neurol 66: 152–154. 7. Anekstein Y, Smorgick Y, Lotan R, et al. 2010. Diabetes mellitus as a risk factor for the development of lumbar spinal stenosis. Isr Med Assoc J 12:16–20. 8. Peppa M, Uribarri J, Vlassara H. 2003. Glucose, advanced glycation end products, and diabetes complications: what is new and what works. Clin Diabetes 21:186–187. 9. Goh SY, Cooper ME. 2008. Clinical review: the role of advanced glycation end products in progression and complications of diabetes. J Clin Endocrinol Metab 93:1143–1152. 10. Tsai TT, Lai PL, Liao JC, et al. 2013. Increased periostin gene expression in degenerative intervertebral disc cells. Spine J 13:289–298. 11. Klein R. 1995. Hyperglycemia and microvascular and macrovascular disease in diabetes. Diabetes Care 18:258–268.
JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
12. Vogt MT, Rubin D, Valentin RS, et al. 1998. Lumbar olisthesis and lower back symptoms in elderly white women. The Study of Osteoporotic Fractures. Spine (Phila Pa 1976) 23:2640–2647. 13. Robinson D, Mirovsky Y, Halperin N, et al. 1998. Changes in proteoglycans of intervertebral disc in diabetic patients. A possible cause of increased back pain. Spine (Phila Pa 1976) 23:849–855, discussion 856. 14. Ziv I, Moskowitz RW, Kraise I, et al. 1992. Physicochemical properties of the aging and diabetic sand rat intervertebral disc. J Orthop Res 10:205–210. 15. Won HY, Park JB, Park EY, et al. 2009. Effect of hyperglycemia on apoptosis of notochordal cells and intervertebral disc degeneration in diabetic rats. J Neurosurg Spine 11:741–748. 16. Jiang L, Zhang X, Zheng X, et al. 2013. Apoptosis, senescence, and autophagy in rat nucleus pulposus cells: implications for diabetic intervertebral disc degeneration. J Orthop Res 31:692–702. 17. Tsuru M, Nagata K, Jimi A, et al. 2002. Effect of AGEs on human disc herniation: intervertebral disc hernia is also effected by AGEs. Kurume Med J 49:7–13. 18. Yokosuka K, Park JS, Jimbo K, et al. 2006. Advanced glycation end-products downregulating intervertebral disc cell production of proteoglycans in vitro. J Neurosurg Spine 5:324–329. 19. Singh R, Barden A, Mori T, et al. 2001. Advanced glycation end-products: a review. Diabetologia 44:129–146. 20. Brownlee M, Cerami A, Vlassara H. 1988. Advanced glycosylation end products in tissue and the biochemical basis of diabetic complications. N Engl J Med 318:1315–1321. 21. Wagner DR, Reiser KM, Lotz JC. 2006. Glycation increases human annulus fibrosus stiffness in both experimental measurements and theoretical predictions. J Biomech 39: 1021–1029. 22. Kislinger T, Fu C, Huber B, et al. 1999. N(epsilon)-(carboxymethyl)lysine adducts of proteins are ligands for receptor for advanced glycation end products that activate cell signaling pathways and modulate gene expression. J Biol Chem 274:31740–31749. 23. Death AK, Fisher EJ, McGrath KC, et al. 2003. High glucose alters matrix metalloproteinase expression in two key vascular cells: potential impact on atherosclerosis in diabetes. Atherosclerosis 168:263–269. 24. Aimes RT, Quigley JP. 1995. Matrix metalloproteinase-2 is an interstitial collagenase. Inhibitor-free enzyme catalyzes the cleavage of collagen fibrils and soluble native type I collagen generating the specific 3/4- and 1/4-length fragments. J Biol Chem 270:5872–5876.
Graduate Institute of Clinical Medical Sciences, Chang Gung University, 259 Wenhwa 1st Road, Taoyuan, Taiwan, R.O.C., 2Department of Orthopaedic Surgery, Spine Section, Chang Gung Memorial Hospital, Taoyuan, Taiwan, R.O.C. Received 4 June 2013; accepted 25 September 2013 Published online 22 October 2013 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/jor.22508
ABSTRACT: Diabetes mellitus (DM) has been clinically proved as a risk factor of disc degeneration, and the accumulation of advanced glycation end products (AGEs) is known to be potentially involved in diabetes. The purpose of this study is to investigate the effect of AGEs in the degeneration process of diabetic nucleus pulposus (NP) in rats and humans. Diabetic NP cells from rat coccygeal discs were treated with different concentrations of AGEs (0, 50, and 100 mg/ml) for 3 days, and mRNA expressions of MMP-2 and RAGE were measured by real-time RT-PCR. In addition, conditioned medium from NP cells was used to analyze protein expression of MMP-2 activity and ERK by gelatin zymography and Western blot. These experiments were repeated using human intervertebral disc samples. The immunohistochemical expression of AGEs was significantly increased in diabetic discs. In response to AGEs, an increase of MMP-2, RAGE, and ERK at both mRNA and protein expression levels was observed in diabetic NP cells. The findings suggest that AGEs and DM are associated with disc degeneration in both species. Hyperglycemia in diabetes enhances the accumulation of AGEs in the NP and triggers disc degeneration. ß 2013 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 32:238–244, 2014. Keywords: advanced glycation end products; disc degeneration; diabetes mellitus; glucose
Disc degenerative disease (DDD) has become a medical, social, and economic problem affecting global human population, because it can cause severe chronic low back pain and greatly affect one’s quality of life.1 Degeneration of intervertebral disc is characterized by increased proteolytic degradation of extracellular matrix and ingrowth of bloods and nerves.2 Among the proteolytic enzymes, an increased production and activation of matrix metalloproteinase-2 (MMP-2) has been shown to correlate with age and degeneration change in the nucleus pulposus (NP).3 Diabetes mellitus (DM) is a chronic condition associated with high blood glucose level resulting from insulin secretory defects and insulin resistance, which becomes a multiorgan disorder affecting many types of tissues.4 Insulin is a hormone producing by pancreatic beta cells, and functions as the key regulator of glucose metabolism. Elevated glucose concentration has been associated with an increased risk of disc degeneration by its direct influence on disc cell proliferation and survival.5 Diabetes has been clinically proved as a risk factor of DDD6,7; however, the pathophysiology has not yet been studied at the cellular and molecular level. Advanced glycation end products (AGEs) are a heterogeneous group of molecules formed from nonenzymatic reaction of reducing sugars with free amino groups of proteins, lipids, and nucleic acids.8 In the initial glycation reaction, high glucose concentration
Grant sponsor: National Science Council of Taiwan; Grant number: NSC100-2314-B-182-059; Grant sponsor: Chang Gung Memorial Hospital, Linkou; Grant number: CMRPG3C0821. Correspondence to: Jong-Hwei S. Pang (T: 886-3-2118800 ext. 3482; F: 886-3-328017; E-mail: [email protected]) # 2013 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
238
JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
encourages the sugars to attach to the amino groups, which lead to the formation of AGEs. The glucose level has been associated with an increased risk of disc degeneration, and the accumulation of AGEs is known to be potentially involved in the progression of diabetes and other age-related disease.9 We assumed that hyperglycemia enhances the formation of AGEs and the accumulation of AGEs in NP leads to the progression of disc degeneration. The purpose of this study is to examine the presence and effect of AGEs in the degeneration process of NP cells in human intervertebral discs and rat coccygeal discs.
METHODS Diabetic Rat Model and Coccygeal Disc Harvest Nine 8-week-old male Sprague-Dawley rats were divided into non-diabetic (n ¼ 4) and diabetic groups (n ¼ 5). Experimental diabetes was induced by a single 65 mg/kg intravenous injection of streptozotocin (STZ; Sigma, St. Louis, MO) that was freshly dissolved in 0.1 M citrate buffer (pH 4.5), and vehicle solution was administrated for non-diabetic group. After an overnight fast, blood glucose concentration was measured before, and 1 month after induction. Rats were considered as diabetic if fasting blood glucose level was greater than 270 mg/dl. All rats were sacrificed with CO2. Under aseptic condition, NP tissues were harvested from coccygeal discs of rat tails for cell culture and histological study. All animal studies were approved by the Institutional Animal Care and Use Committees of our institution. Human Nucleus Pulposus Tissues Harvest Informed consent was obtained from subjects under the approval of the Institutional Review Board of Chang Gung Memorial Hospital. NP tissues at the center of an intervertebral disc were harvested from elderly patients with degenerative disc disease during spinal surgeries. Harvested tissue samples were categorized into non-diabetic and diabetic
AGEs IN DIABETIC DEGENERATIVE NP
239
groups (n ¼ 3 per group), which diabetic samples were from patients with degenerative disc disease and type 2 DM.
with statistically significant at p < 0.05, indicating by an asterisk in the figures.
Histological Analysis Disc specimens were fixed in 10% formaldehyde, decalcified, embedded in paraffin, deparaffinized in xylene, and rehydrated through graded ethanol washes. The sections were incubated with anti-AGE antibody (Abcam, Cambridge, MA) in 1% BSA/PBS at a 1:100 dilution for 2 h at RT. After thoroughly washing the sections, the bound primary antibody was incubated with the secondary antibody for 20 min at RT, then incubated with 3,30 -diaminobenzidine (DakoCytomation, Copenhagen, Denmark) for 10 min, and counterstained with hematoxylin.
RESULTS
Nucleus Pulposus Cell Isolation and Culture Rat and human NP tissues were subjected to overnight digestion with type II collagenase (Worthington, Lakewood, NJ) in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA) and antibiotics at 37˚C in a 5% CO2 humidified incubator. All fibrous collagens were degraded which allowed the release of NP cells from tissues. A monolayer of NP cells was seeded into a 10-cm dish at a density of 5 105 cells per dish. Three days after seeding, cells reached 80% confluence and they were treated with different concentrations of AGEs for 3 days, and then used for mRNA and protein analysis. Real-Time RT-PCR and Western Blot Analysis Real-time RT-PCR and Western blotting were performed as previously described.10 The primers used were human MMP-2 (forward: GGATGATGCCTTTGCTCG; reverse: GGAGTCCGTCCTTACCGT), rat MMP-2 (forward: GTAAGAACAAGAAGACATACAT; reverse: TTATCAGGGATGGCATTC), human RAGE (forward: GGCTGGTGTTCCCAATAA; reverse: TCACAGATACTCCCTTCTCATT), rat RAGE (forward: AATGGTTCACTCCTCCTT; reverse: TCGGTAGTTGGACTTGAC). Gelatin Zymography Conditioned medium (20 ml) from NP cultures were mixed with Laemmli’s sample buffer in the absence of b-mercaptoethanol, and then separated on a 10% SDS–PAGE gel containing 0.1% gelatin. After electrophoresis, the gel was washed in a solution containing 2.5% Triton X-100 to remove SDS, and subsequently incubated in 1 M Tris–HCl buffer containing 1 M CaCl2, 30% Brij and 5 M NaCl for 18 h at 37˚C with shaking. The gel was stained with Coomassie brilliant blue R-250, and the gelatinolytic activity was detected as clear bands against the blue background. The band intensity was analyzed by UVP BioSpectrum Imaging System (Upload, CA). Statistical and Image Analysis All analyses were repeated at least in duplicate. Digital images of three disc sections in each group were collected. Three sub-areas of each section were selected, and the relative density of AGEs was analyzed using Image-Pro Plus software (Media Cybernetics, Bethesda, MD). For each disc sections, an average of three sub-areas was calculated and presented as mean standard deviation by bar graph. The difference between non-diabetic and diabetic discs was revealed in fold change of positive staining. Student’s t-test was used to compare the difference between different concentrations by SigmaPlot (Systat Software, Inc., San Jose, CA)
More AGEs Are Detected in Diabetic Discs from Rat and Human The blood glucose level of diabetic rats at 1 month after STZ induction was 469.67 28.31 mg/dl (n ¼ 5), compared to 84.75 8.20 mg/dl (n ¼ 4) for the control normal rats. The presence of AGEs was examined on the three non-diabetic and three diabetic disc specimens using immunohistochemical analysis. Immunopositive staining for AGEs was observed in both nondiabetic and diabetic discs including annulus fibrosus and NP; however, the expression of AGEs was significantly higher in rat diabetic discs with a 2.44fold increase (Fig. 1), and a 3.35-fold increase in human diabetic discs (Fig. 2), compared to nondiabetic discs. AGEs Induced MMP-2 Expression in Disc Cells Isolated from Diabetic Rat We treated the disc cells with AGEs and measured the change of MMP-2 level, since MMP-2 is known to be highly expressed in degenerative discs. As analyzed by real-time RT-PCR, the MMP-2 mRNA expression in disc cells cultured from diabetic rat coccygeal discs was found to be significantly induced by 50–100 mg/ml AGEs (Fig. 3A). The MMP-2 protein level secreted by rat disc cells was determined by Western blot analysis and the result demonstrated a positive correlation between the protein level of MMP-2 and the concentration of AGEs (Fig. 3B). The gelatinolytic activity of MMP-2 in conditioned medium of disc cells cultured from diabetic rat coccygeal discs was examined by gelatin zymography. Both the latent and active forms of MMP-2 were detected; however, the major proportion of MMP-2 produced in response to AGEs treatment was in its active-form. MMP-2 activity was significantly increased with increasing concentration of AGEs in dose-dependent manner (Fig. 3C). Interestingly, the modulation of MMP-2 gene expression by AGEs in disc cells cultured from diabetic rat, however, was not significantly detected in disc cells cultured from normal rat (data not shown). AGEs Increased the RAGE Expression and Activated ERK in Disc Cells Isolated from Diabetic Rat RAGE is a 35 kD transmembrane receptor of the immunoglobulin superfamily that can be bound by AGEs, and triggers the downstream signal pathway such as ERK pathway. Real-time RT-PCR result showed that rat disc cells expressed readily detectable level of RAGE. RAGE expression was dose-dependently up-regulated by AGEs in disc cells from diabetic rat (Fig. 4). Similarly to the AGEs-induced RAGE expression, Western blot analysis revealed that AGEs could also dose-dependently activate phosphorylaion of ERK in disc cells from diabetic rat (Fig. 5). JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
240
TSAI ET AL.
Figure 1. Increased AGEs expression in rodent diabetic coccygeal discs. Comparative immunohistochemical images and qualification of AGEs expression between non-diabetic and diabetic samples. p < 0.05 when compared to non-diabetic samples.
Effect of AGEs on MMP-2, RAGE, and ERK Expressions in Human Disc Cells Cultured from Diabetic Nucleus Pulposus To study whether the similar effect of AGEs also occurs in disc tissue isolated from diabetic patients combined with the problem of disc degeneration, the expression of MMP-2 under the effect of AGEs was further investigated in human disc cells cultured from diabetic NP by real-time RT-PCR and Western blot analysis, respectively. Similar to the findings in the diabetic rat study, disc cells treated with AGEs showed an increase in MMP-2 expression at both the mRNA and the protein levels (Fig. 6A and B); in addition, the up-regulated expressions of RAGE at the mRNA level and the activation of ERK were correlated with the increased concentration of AGEs (Fig. 6C and D).
DISCUSSION The incidence of DDD is increasing in world population and becoming the reason for receiving spinal surgeries. It will be helpful if we can identify the JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
factors involved in the pathogenesis of disc degeneration; therefore, in current study, we would like to focus on investigating the relationship of AGEs and disc degeneration at the cellular and molecular basis, especially in diabetic status. DM is a metabolic disease characterized by persistent hyperglycemia and is associated with many complications including cardiovascular disease, nephropathy, neuropathy, and retinopathy11; however, previous studies have reported conflicting results on the association of disc degeneration and diabetes. In a cross-sectional study by Vogt et al.,12 the results showed no relation between the diabetes and the degeneration changes in the spine. On the contrary, Robinson et al.13 related the degenerative changes in intervertebral disc to diabetes by observing the presence of proteoglycans with lower buoyant density and substantially undersulfated glycosaminoglycan in operated discs of diabetic patients. In Ziv et al.14, similar to human change, the aged and diabetic discs in sand rats demonstrate reduced hydration, and fixed charge density.
AGEs IN DIABETIC DEGENERATIVE NP
241
Figure 2. Increased AGEs expression in human diabetic intervertebral discs. Comparative immunohistochemical images and qualification of AGEs expression between non-diabetic and diabetic samples. p < 0.01 when compared to non-diabetic samples.
Consequently, many later studies have focused on finding the features in diabetes that may be causing disc degeneration. Won et al.15 used spontaneously diabetic rats with mild obesity and late-onset of hyperglycemia to investigate the relationship between high glucose and early disc degeneration. The premature, excessive apoptosis of NP notochordal cells significantly increased the MMPs expression in the NP of diabetic rats, which lead to rapid disc degeneration and fibrosis. Jiang et al.16 demonstrated a direct cause effect relationship between type 1 diabetes and intervertebral disc degeneration. Diabetes decreased the expressions of proteoglycan, aggrecan, and collagen II in NP cells of STZ-induced diabetic rats, while cellular apoptosis and senescence were increased. However, the findings of both studies did not indicate that the exact cause of these premature changes is due to hyperglycemia or other diabetes-related factors.
In addition, the effect of diabetes-related AGE formation on disc degeneration has also been evaluated. Tsuru et al.17 immunologically confirmed the presence of AGE-producing cells in human degenerated intervertebral discs obtained during operation, and concluded that tissue homeostasis and repair may be disturbed by excessive accumulation of AGEs, which could lead to tissue injury. The author suggested that sugar is the cause, and aging is the result. Yokosuka et al.18 showed that AGEs and RAGE were presented in the NP of intervertebral discs, and also demonstrated the suppression of aggrecan expression by treating with AGEs. In the current study, we confirmed that AGEs and RAGE were presented in human and rat discs, with increased expression in diabetic discs, and further proved that AGEs significantly enhanced MMP-2 expression at both the mRNA and protein levels. JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
242
TSAI ET AL.
Figure 3. AGEs increased MMP-2 expression at the mRNA and protein levels. Diabetic NP cells from rats were treated with different concentrations of AGEs and analyzed by (A) real-time PCR, (B) Western blot, and (C) gelatin zymography. p < 0.05, p < 0.01.
AGEs are a complex and heterogeneous group of compounds that have been implicated in diabetesrelated complications. The formation of AGEs is through the reaction of amino groups in protein, lipids, and nucleic acids with the reduced sugars such as
Figure 4. AGEs increased RAGE expression at the mRNA level. Diabetic NP cells from rats were treated with different concentrations of AGEs and analyzed by real-time PCR. JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
Figure 5. AGEs increased ERK expression at the protein level. Diabetic NP cells from rats were treated with different concentrations of AGEs and analyzed by Western blot. p < 0.05, p < 0.01.
AGEs IN DIABETIC DEGENERATIVE NP
243
Figure 6. AGEs increased MMP-2, RAGE, and ERK expressions in human diabetic intervertebral discs. The MMP-2 expression at the mRNA level was measured by (A) real-time PCR and (B) Western blot at the protein level. (C) The RAGE expression was analyzed using real-time PCR and (D) the ERK expression was by Western blot. p < 0.05.
glucose non-enzymatically by Maillard reaction. Advanced glycation occurs over a period of weeks, thereby proteins affected by covalent cross-link formation are stable and long lived, such as collagen.19 Under diabetic conditions, AGEs accumulates abnormally in various tissues and organs, which can contribute to a gradual decline in tissue function and lead to the pathogenesis of diabetic complications. It can lead to structural alterations and functional interference of plasma and extracellular matrix proteins by forming covalent crosslink, which reduces the flexibility and elasticity of proteins.20 AGEs have been shown to increase the mechanical stiffness in many tissues including annulus fibrosus; the concentration of AGEs was positively correlated with collagen crosslinking.21 AGEs can also initiate cellular degradation and harmful inflammatory and autoimmune responses by interacting with a variety of cell-surface AGEbinding receptors. The interaction with AGES and RAGE activates its downstream signaling pathways and cause the overproduction of pro-inflammatory cytokines and oxygen radicals.22 The formation of AGEs is accelerated in diabetes due to the increased concentration of glucose. It has
been suggested that high glucose may play an important role in the pathophysiology of intervertebral disc degeneration by inducing MMP expression and activities.23 MMP-2 (gelatinase A) is an enzyme involved in the breakdown of extracellular matrix components in the NP. It is capable of digesting all denatured collagens and degrading native type I, IV, and V collagens.24 Elevated level of MMP-2 indicates tissue turnover, resulting in increased matrix degradation. The loss of matrix compromises the mechanical function of discs and leads to fibrotic response, which eventually develops disc degeneration.3 There are several limitations in this study. First, genetic and phenotypic heterogeneous in patients may influence our outcomes, and it is difficult to eliminate the inter-individual variation in human disc samples. Secondly, STZ-induced diabetic rat is an experimental animal model of type 1 diabetes, which hyperglycemia is developed primarily by direct cytotoxic action on the beta cells rather than the consequence of insulin resistance like type 2 diabetic patients with disc degeneration. Finally, this study only focused on analyzing the expression of MMP-2 and used it to relate AGEs to disc degeneration; however, there are JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
244
TSAI ET AL.
many other factors have been demonstrated to be involved in disc degeneration such as other matrix metalloproteinases, cell apoptosis, inflammatory cytokines and degradative enzymes, etc. Further studies could be conducted to investigate the role of other contributing factors in diabetic disc degeneration. In conclusion, hyperglycemia is attributable to the formation of AGEs. The accumulation of AGEs is accelerated in DM due to the increased concentration of glucose, which leads to highly expressed MMP-2 of disc cells, matrix degradation and substantially promotes disc degeneration development.
REFERENCES 1. Maniadakis N, Gray A. 2000. The economic burden of back pain in the UK. Pain 84:95–103. 2. Le Maitre CL, Freemont AJ, Hoyland JA. 2004. Localization of degradative enzymes and their inhibitors in the degenerate human intervertebral disc. J Pathol 204:47–54. 3. Crean JK, Roberts S, Jaffray DC, et al. 1997. Matrix metalloproteinases in the human intervertebral disc: role in disc degeneration and scoliosis. Spine (Phila Pa 1976) 22: 2877–2884. 4. Silberberg R. 1986. The skeleton in diabetes mellitus: a review of the literature. Diabetes Res 3:329–338. 5. Johnson WE, Stephan S, Roberts S. 2008. The influence of serum, glucose and oxygen on intervertebral disc cell growth in vitro: implications for degenerative disc disease. Arthritis Res Ther 10:R46. 6. Sakellaridis N. 2006. The influence of diabetes mellitus on lumbar intervertebral disk herniation. Surg Neurol 66: 152–154. 7. Anekstein Y, Smorgick Y, Lotan R, et al. 2010. Diabetes mellitus as a risk factor for the development of lumbar spinal stenosis. Isr Med Assoc J 12:16–20. 8. Peppa M, Uribarri J, Vlassara H. 2003. Glucose, advanced glycation end products, and diabetes complications: what is new and what works. Clin Diabetes 21:186–187. 9. Goh SY, Cooper ME. 2008. Clinical review: the role of advanced glycation end products in progression and complications of diabetes. J Clin Endocrinol Metab 93:1143–1152. 10. Tsai TT, Lai PL, Liao JC, et al. 2013. Increased periostin gene expression in degenerative intervertebral disc cells. Spine J 13:289–298. 11. Klein R. 1995. Hyperglycemia and microvascular and macrovascular disease in diabetes. Diabetes Care 18:258–268.
JOURNAL OF ORTHOPAEDIC RESEARCH FEBRUARY 2014
12. Vogt MT, Rubin D, Valentin RS, et al. 1998. Lumbar olisthesis and lower back symptoms in elderly white women. The Study of Osteoporotic Fractures. Spine (Phila Pa 1976) 23:2640–2647. 13. Robinson D, Mirovsky Y, Halperin N, et al. 1998. Changes in proteoglycans of intervertebral disc in diabetic patients. A possible cause of increased back pain. Spine (Phila Pa 1976) 23:849–855, discussion 856. 14. Ziv I, Moskowitz RW, Kraise I, et al. 1992. Physicochemical properties of the aging and diabetic sand rat intervertebral disc. J Orthop Res 10:205–210. 15. Won HY, Park JB, Park EY, et al. 2009. Effect of hyperglycemia on apoptosis of notochordal cells and intervertebral disc degeneration in diabetic rats. J Neurosurg Spine 11:741–748. 16. Jiang L, Zhang X, Zheng X, et al. 2013. Apoptosis, senescence, and autophagy in rat nucleus pulposus cells: implications for diabetic intervertebral disc degeneration. J Orthop Res 31:692–702. 17. Tsuru M, Nagata K, Jimi A, et al. 2002. Effect of AGEs on human disc herniation: intervertebral disc hernia is also effected by AGEs. Kurume Med J 49:7–13. 18. Yokosuka K, Park JS, Jimbo K, et al. 2006. Advanced glycation end-products downregulating intervertebral disc cell production of proteoglycans in vitro. J Neurosurg Spine 5:324–329. 19. Singh R, Barden A, Mori T, et al. 2001. Advanced glycation end-products: a review. Diabetologia 44:129–146. 20. Brownlee M, Cerami A, Vlassara H. 1988. Advanced glycosylation end products in tissue and the biochemical basis of diabetic complications. N Engl J Med 318:1315–1321. 21. Wagner DR, Reiser KM, Lotz JC. 2006. Glycation increases human annulus fibrosus stiffness in both experimental measurements and theoretical predictions. J Biomech 39: 1021–1029. 22. Kislinger T, Fu C, Huber B, et al. 1999. N(epsilon)-(carboxymethyl)lysine adducts of proteins are ligands for receptor for advanced glycation end products that activate cell signaling pathways and modulate gene expression. J Biol Chem 274:31740–31749. 23. Death AK, Fisher EJ, McGrath KC, et al. 2003. High glucose alters matrix metalloproteinase expression in two key vascular cells: potential impact on atherosclerosis in diabetes. Atherosclerosis 168:263–269. 24. Aimes RT, Quigley JP. 1995. Matrix metalloproteinase-2 is an interstitial collagenase. Inhibitor-free enzyme catalyzes the cleavage of collagen fibrils and soluble native type I collagen generating the specific 3/4- and 1/4-length fragments. J Biol Chem 270:5872–5876.
