Adoptive transfer of M2 macrophages promotes locomotor recovery in adult rats after spinal cord injury.

Brain, Behavior, and Immunity xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Brain, Behavior, and Immunity journal homepage: www.elsevier.com/locate/ybrbi

Adoptive transfer of M2 macrophages promotes locomotor recovery in adult rats after spinal cord injury Shan-Feng Ma a,c,1, Yue-Juan Chen b,1, Jing-Xing Zhang b,1, Lin Shen b, Rui Wang b, Jian-Sheng Zhou b, Jian-Guo Hu b,⇑, He-Zuo Lü a,b,⇑ a b c

Central Laboratory, The First Affiliated Hospital of Bengbu Medical College, Anhui 233004, PR China Anhui Key Laboratory of Tissue Transplantation, The First Affiliated Hospital of Bengbu Medical College, Anhui 233004, PR China Department of Physiology, Bengbu Medical College, Anhui 233030, PR China

a r t i c l e

i n f o

Article history: Received 3 September 2014 Received in revised form 17 November 2014 Accepted 17 November 2014 Available online xxxx Keywords: Spinal cord injury Adoptive transfer Macrophage polarization Microenvironment Locomotor recovery

a b s t r a c t Classically activated pro-inflammatory (M1) and alternatively activated anti-inflammatory (M2) macrophages populate the local microenvironment after spinal cord injury (SCI). The former type is neurotoxic while the latter has positive effects on neuroregeneration and is less toxic. In addition, while the M1 macrophage response is rapidly induced and sustained, M2 induction is transient. A promising strategy for the repair of SCI is to increase the fraction of M2 cells and prolong their residence time. This study investigated the effect of M2 macrophages induced from bone marrow-derived macrophages on the local microenvironment and their possible role in neuroprotection after SCI. M2 macrophages produced anti-inflammatory cytokines such as interleukin (IL)-10 and transforming growth factor b and infiltrated into the injured spinal cord, stimulated M2 and helper T (Th)2 cells, and produced high levels of IL-10 and -13 at the site of injury. M2 cell transfer decreased spinal cord lesion volume and resulted in increased myelination of axons and preservation of neurons. This was accompanied by significant locomotor improvement as revealed by Basso, Beattie and Bresnahan locomotor rating scale, grid walk and footprint analyses. These results indicate that M2 adoptive transfer has beneficial effects for the injured spinal cord, in which the increased number of M2 macrophages causes a shift in the immunological response from Th1- to Th2-dominated through the production of anti-inflammatory cytokines, which in turn induces the polarization of local microglia and/or macrophages to the M2 subtype, and creates a local microenvironment that is conducive to the rescue of residual myelin and neurons and preservation of neuronal function. Ó 2014 Elsevier Inc. All rights reserved.

1. Introduction A variety of immune cell types infiltrate into the local microenvironment at the site of spinal cord injury (SCI) (Plemel et al., 2014). A previous study found that locally activated microglia and/or macrophages derived from infiltrating monocytes play an important role in tissue repair (Hayakawa et al., 2014; Kigerl et al., 2009; Shechter et al., 2013). Two major subsets of macrophages can be distinguished based on the molecular phenotype and effector functions: classically activated pro-inflammatory (M1) and alternatively activated anti-inflammatory (M2) cells (Kigerl et al., 2009). M1 cells are induced by toll-like receptor ligands or pro-inflamma⇑ Corresponding authors at: Anhui Key Laboratory of Tissue Transplantation, The First Affiliated Hospital of Bengbu Medical College, 287 Chang Huai Road, Bengbu 233004, PR China. Tel.: +86 552 3170692 (H.-Z. Lü). E-mail address: [email protected] (H.-Z. Lü). 1 These authors contributed equally to this work.

tory cytokines such as interferon (IFN)-c and tumor necrosis factor (TNF)-a (Kigerl et al., 2009; Mosser and Edwards, 2008). On the other hand, M2 macrophages are induced by anti-inflammatory cytokines such as interleukin (IL)-4, -10, and -13 (Bethea et al., 1999; Kigerl et al., 2009; Martinez et al., 2008; Sica et al., 2006). The M1:M2 ratio is an important factor in SCI repair. M1 macrophages are neurotoxic, while M2 macrophages promote axonal regeneration after central nervous system (CNS) injury (Goerdt and Orfanos, 1999; Kigerl et al., 2009; Mikita et al., 2011); moreover, the M1 response is rapidly induced and then maintained, whereas M2 induction is transient (Kigerl et al., 2009). Therefore, increasing the M2 cell population and prolonging the presence of this macrophage subtype in the injured local microenvironment may represent a promising strategy for tissue repair after SCI. Certain cytokines and stimuli can induce macrophage polarization into M1 or M2 phenotypes in vitro. M1 macrophages can be induced using IFN-c and lipopolysaccharide (LPS), whereas M2

http://dx.doi.org/10.1016/j.bbi.2014.11.007 0889-1591/Ó 2014 Elsevier Inc. All rights reserved.

Please cite this article in press as: Ma, S.-F., et al. Adoptive transfer of M2 macrophages promotes locomotor recovery in adult rats after spinal cord injury. Brain Behav. Immun. (2014), http://dx.doi.org/10.1016/j.bbi.2014.11.007

2

S.-F. Ma et al. / Brain, Behavior, and Immunity xxx (2014) xxx–xxx

macrophages are induced by treatment with the helper T (Th)2 cytokines IL-4 or -13; in addition, an M1-to-M2 switch is promoted by IL-10 (Vereyken et al., 2011; Weisser et al., 2013). M2 macrophage transfer has been used experimentally to treat type 1 diabetes, autoimmune encephalomyelitis, and chronic inflammatory renal disease in animal models (Parsa et al., 2012; Wang et al., 2007; Zhang et al., 2014); however, there are no reports about the application of this method to SCI treatment. In the present study, a rat SCI model was used to investigate the therapeutic utility of M2 macrophage adoptive transfer and to evaluate their effects on the injury microenvironment and tissue repair. 2. Materials and methods 2.1. Animals A total of 115 eight-week-old female Sprague–Dawley (SD) rats (220–250 g) were used in this study. All surgical procedures and post-operative animal care were in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council, 1996) and the Guidelines and Policies for Rodent Survival Surgery provided by the Animal Care and Use Committees of Bengbu Medical College. 2.2. Culture, polarization and identification of bone marrow derived macrophages Culture and identification of bone marrow derived macrophages were performed as described previously (Huang et al., 2013). Rat bone marrow cells were flushed from the femur with sterilized pH 7.4 phosphate buffered saline (PBS) buffer. The cells were cultured for 7 days in 10 cm dishes using DMEM medium containing 10% fetal bovine serum (FBS), penicillin (100 U/ml), streptomycin (100 lg/ml) and L929-cell conditioned medium prepared as described previously (Davies and Gordon, 2005). The cells cultured in the above medium were defined as M0 macrophages. For M1 polarization, the M0 macrophages were undergone a 24h incubation with 25 ng/ml IFN-c (R&D systems, Minneapolis, MN) and 100 ng/ml LPS (Sigma, St. Louis, MO). The cells undergoing the incubation with 10 ng/ml IL-4, -10, and transforming growth factor (TGF)-b1 (R&D systems) for 12 h were defined as M2 macrophages. Flow cytometry and immunocytochemistry were used to identify the macrophage phenotypes. 2.3. Flow cytometry Antibodies against cluster of differentiation (CD)68, CD86, and CD163 were used to identify the macrophage subtypes by flow cytometry. For immunolabeling, cells were incubated with the following panel of anti-rat monoclonal antibodies: fluorescein isothiocyanate (FITC)-conjugated anti-CD68 (1 lg/106 cells; AbD Serotech, Oxford, UK), Alexa FluorÒ 647-conjugated anti-CD163 (1 lg/106 cells; AbD Serotech), and PE-conjugated anti-CD86 (0.2 lg/106 cells; eBioscience). After incubation at 4 °C for 30 min, cells were washed three times with staining buffer, fixed with 1% paraformaldehyde (PFA) in PBS and analyzed using a FACSCalibur flow cytometer (Becton Dickinson, San Diego, CA). Isotype-matched antibodies were used to control for non-specific staining that was subtracted from specific staining results. A minimum of 10,000 events were collected and analyzed by WinMDI 2.8 software (J. Trotter, The Scripps Research Institute, La Jolla, CA). 2.4. Immunocytochemistry To identify the macrophage subsets, the cells were seeded onto 200 lg/ml poly-L-lysine-coated coverslips at 5 104 cells/cover-

slip. Then, the different subtypes of macrophage polarization were induced. The cells were fixed with 4% PFA in PBS (0.01 M, pH 7.4) for 10 min, blocked with 10% normal goat serum (NGS) containing 0.1% Triton X-100 for 1 h at room temperature (RT), and then incubated with mouse anti-rat CD68 (1:200; AbD Serotech) and rabbit anti-rat C–C chemokine receptor type 7 (CCR7) (1:250; Cell Application, San Diego, CA) or rabbit anti-rat arginase I (Arg1) (1:200; Thermo Fisher Scientific Inc., Rockford, IL), overnight at 4 °C. The following day, sections were incubated for 60 min at 37 °C with rhodamine-conjugated goat anti-mouse (1:200; Jackson Immuno Research Lab., West Grove, PA) and goat anti-rabbit antibodies (1:200; Jackson Immuno Research Lab.) The coverslips were rinsed and mounted with mounting media containing Hoechst 33342 (0.5 lM, Sigma) to visualize nuclei. The immunostaining were examined with an Olympus BX60 microscope. 2.5. Cytokines and nitric oxide (NO) assay Levels of IL-6, -10, TGF-b, and TNF-a in M0, M1, and M2 cell culture supernatants were measured by enzyme-linked immunosorbent assay (ELISA) according to the manufacturer’s instructions (Minneapolis, MN). The total NO was measured using the Griess reagent (Promega, Madison, WI). 2.6. Contusive SCI Contusive SCI was performed using a New York University Impactor as described (Lu et al., 2008). Rats were anesthetized with pentobarbital (50 mg/kg, intraperitoneal) and received a laminectomy at the T9 vertebra. After spinous processes of the T7 and T11 vertebrae were clamped to stabilize the spine, the exposed dorsal surface of the cord was subjected to a weight drop injury using a 10 g rod (2.5 mm diameter) dropped at a height of 25 mm. After SCI, muscles and skin were closed in layers, and rats were placed in a temperature- and humidity-controlled chamber. Manual bladder emptying was performed three times daily until reflex bladder emptying was established. To prevent infections, animals were daily provided with chloramphenicol (50–75 mg/ kg) via drinking water. 2.7. Macrophage labeling and adoptive transfer Seven days post-SCI, before transfer, macrophages were labeled with carboxyfluorescein diacetate-succinimidyl ester (CFSE) (Invitrogen, Carlsbad, CA). Freshly dissociated cells were resuspended in PBS containing 0.1% bovine serum albumin at 5 106 cells/ml, and incubated with CFSE (final working concentration: 5 lM) for 10 min at 37 °C. The staining was quenched by the addition of 5 volumes of ice-cold culture media to the cells and 5 min incubation on ice. The cells were pelleted by centrifugation, washed by resuspending the pellet in fresh media, and centrifuged for 8 min at 134 g. Then, the cells were pelleted and resuspended in fresh media further two times. For adoptive transfer, the labeled cells were suspended in PBS at 1 107 cells/ml. The rats were intravenously injected with 1 ml M0, M1, or M2 cells, respectively. Rats in vehicle control group were intravenously injected with 1 ml sterile PBS only. 2.8. Detection of transferred cells in injured spinal cord Infiltration of transferred cells in injured spinal cord was detected using fluorescence microscope and flow cytometry 7 days after cell transfer. For fluorescence microscope detection, the animals were administered an overdose of sodium pentobarbital (nembutal; 80 mg/kg, interperitoneal) and transcardially exsanguinated with 200 ml physiological saline followed by fixation with


3


300 ml ice-cold 4% PFA in 0.01 M PBS (pH 7.4). After perfusion, a 1 cm spinal cord segment containing the injury epicenter was removed, postfixed overnight in 4% PFA in 0.01 M PBS (pH 7.4), and transferred to 30% sucrose in 0.01 M PBS (pH 7.4) at 4 °C overnight. Then, the segments were placed in OCT compound embedding medium (Tissue-Tek, Miles, Elkart, IN) and 8 lm frozen sections were obtained longitudinally using a cryostat (Leica CM1900, Bannockburn, IL), followed by thaw-mounting on polyL-lysine-coated slides (Sigma). The CFSE-labeling cells were examined with an Olympus BX60 microscope. CFSE-labeling cells and their phenotypes were detected by flow cytometry. At the indicated time periods post-injury, the rats were perfused with PBS, and spinal cord segments T8–10 were removed by insufflation and dissociated by gently grinding the tissue into single-cell suspension that was passed through a 45 lm nylon mesh with a syringe plunger. The infiltrated cells were isolated by Percoll gradient centrifugation and resuspended in staining buffer (PBS containing 5% FBS and 0.01 M sodium azide) for immunolabeling. Biotin-conjugated anti-CD68 mAb (1 lg/106 cells; AbD Serotech) followed by PerCP-conjugated streptavidin (0.2 lg/106 cells; eBioscience), Alexa FluorÒ 647-conjugated anti-CD163 (1 lg/106 cells; AbD Serotech) and PE-conjugated anti-CD86 (0.2 lg/106 cells; eBioscience) were used to label the cells. The subtypes of the CFSElabeled cells were analyzed by WinMDI 2.8 software (J. Trotter, The Scripps Research Institute). 2.9. RNA extraction and real-time reverse transcription PCR The mRNA expression was measured by real-time reverse transcription PCR as described (Hu et al., 2012). Seven days after cell transfer, total RNA from injured spinal cords (1 cm spinal cord segment containing the injury epicenter) was extracted using TRI reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer’s instructions. RNA was reverse transcribed into cDNA using a reverse transcription system (Promega, Madison, WI). Real-time PCR was performed on an ABI 7900 PCR detection system (Applied Biosystems, Foster City, CA) using a SYBR Green PCR Master Mix (Applied Biosystems). Parallel amplification of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping gene was used to normalize gene expression. PCR primer sequences are listed in Table 1. The relative expression level of target mRNAs was calculated using the DDCt method (Pfaffl, 2001) and expressed relative to the value in the vehicle group (designated as 1).

Mouse anti-rat CD68 (1:200; AbD Serotech) and rabbit anti-rat CCR7 (1:250; Cell Application) or rabbit anti-rat arginase I (1:200; Thermo Fisher Scientific Inc.) were used to identify M1 and M2 macrophages; mouse anti-rat CD4 (1:100; Sero Tec Inc., Raleigh, NC) and rabbit anti-rat T-bet (1:200; Sigma) or GATAbinding protein 3 (GATA3) (1:200; Sigma) were used to identify Th1 and Th2 cells by immunocytochemistry. Finally, the slides were washed, coverslipped, and examined using an Olympus BX60 microscope. Cell quantification of spinal cord tissue was performed in an unbiased stereological manner as described elsewhere (Karimi-Abdolrezaee et al., 2006). 2.11. Histological analyses Six weeks after SCI, animals were sacrificed and histological analyses were performed as described (Lu et al., 2008). The spinal cords were blocked into 10 mm segments, serial 20-lm-thick sections through the entire injury site were cut transversely. Two sets of slides (each set containing serial sections spaced 200 lm apart) were stained with Luxol fast blue (LFB) and Neutral Red, respectively, to identify myelinated white matter and residual ventral horn motoneurons. Lesion epicenter was defined as the section containing the least amount of spared white matter. The total and cross sectional area of the spinal cord and the lesion boundary were measured with an Olympus BX60 microscope attached to a Neurolucida system (Microbrightfield Inc., Colchester, VT, USA). An unbiased estimation of the percentage of spared tissue was calculated using the Cavalieri method (Michel and Cruz-Orive, 1988). The total volume of the lesion area (areas of cavitation and fibrosis) was calculated by summing their individual subvolumes (Oorschot, 1994). Individual subvolumes of the lesion area were calculated by multiplying the cross-sectional area (A) D, where D represents the distance between sections (200 lm). The percentage total volume of the injured area was calculated by dividing the total volume of lesion area by the total spinal cord volume (Cao et al., 2005). LFB and Neutral Red stained sections at the lesion epicenter and 1, 2, 3, and 4 mm rostral and caudal to the epicenter were analyzed for myelinated white matter and residual ventral horn motoneurons, respectively. The myelinated white matter was quantified by Image pro-plus 5.1 (Media Cybernetics, Inc., Atlanta, GA, USA) and the number of surviving ventral horn neurons was confirmed by the exhibition of Nissl substance, euchromatic nucleus, and nucleolus (Teng et al., 1998). 2.12. Toluidine blue staining and electron microscopy

2.10. Immunohistochemical assay Seven days after cell transfer, a 1 cm spinal cord segment containing injury epicenter was removed, postfixed, dehydrated, and embedded. Finally, the 8 lm frozen sections were obtained horizontally and transversely using a cryostat (Leica CM1900), followed by thaw-mounting on poly-L-lysine-coated slides (Sigma).

Toluidine blue staining was performed as described (Lu et al., 2008). Spinal cord segments were fixed overnight in a solution containing 2% glutaraldehyde and 5% sucrose in 0.1 M sodium cacodylate buffer, pH 7.4, followed by 1% osmium tetroxide in the same buffer for 1 h. Tissue was embedded in Spurr’s epoxy resin and cured at 70 °C. Transverse semithin sections (1 lm) were

Table 1 Real-time PCR primers used in the study. Gene

GenBank accession no.

Forward primer 50 –30

Reverse primer 50 –30

IL-10 IL-1b IL-13 IFN-c IL-4 IL-6 TNF-a iNOS GAPDH

NM_012854.2 NM_031512.2 NM_053828.1 NM_138880.2 NM_201270.1 NM_012589.2 NM_012675.3 S71597.1 NM_017008.4

CAGTCAGCCAGACCCACA GGCAACTGTCCCTGAACT AATCCCTGACCAACATCT CTGGCAAAAGGACGGTAA ACCCTGTTCTGCTTTCTC TCCTACCCCAACTTCCAATGC CTCAAGCCCTGGTATGAGCC TTGCTTCTGTGCTAATGCGG AAGGTCGGTGTGAACGGATT

GGCAACCCAAGTAACCCT TCCACAGCCACAATGAGT ATAAACTGGGCTACTTCG TGTGCTGGATCTGTGGGT GTTCTCCGTGGTGTTCCT TAGCACACTAGGTTTGCCGAG GGCTGGGTAGAGAACGGATG AAGGCGTAGCTGAACAAGGA TGAACTTGCCGTGGGTAGAG


4


stained with a mixture of 1% toluidine blue and 1% sodium borate. For statistical analysis, the number of spared myelin in four random microscopic fields (10 40-fold) between the lesion and pial borders in the dorsal, lateral, and ventral columns was calculated. Ultrathin sections (70–90 nm) were collected on copper mesh grids with 600 bars/in, subsequently counterstained with 4% uranyl acetate in 50% ethanol and Reynolds’ lead citrate, and examined using a Philip CM10 electron microscope (Philips, Einhoven, The Netherlands). 2.13. Basso, Beattie and Bresnahan (BBB) locomotor rating scale Behavioral assessment was performed using the BBB locomotor rating scale, a 21 point scale (0–21) based on observations of hindlimb movements of a rat freely moving in an open field (Basso et al., 1995, 1996). The BBB score was evaluated at 1 and 3 days, then 1, 2, 3, 4, 5, 6, and 7 weeks after injury. During the evaluation, animals were allowed to walk freely on the open-field surface for 4 min, while being observed by two blinded scorers. 2.14. Footprint analysis Footprint analysis was performed as described previously (Metz et al., 2000). The animal’s fore and hind paws were inked with red and blue, respectively, and footprints were made on paper covering a narrow runway of 100 cm length and 7 cm width. This device can ensure that the direction of each step was standardized in line. A series of at least eight sequential steps were used to determine the mean values for each measurement of limb rotation, stride length and base of support. To include animals with incomplete weight support, a 4-point scoring system was used: 0, the animal displays constant dorsal stepping or hindlimb dragging, i.e. no footprint was visible; 1, prints of at least three toes are visible in at least three footprints; 2, the animal shows exo- or endo-rotation of the feet that is more than double the baseline values; 3, there are no signs of toe dragging but foot rotation is present; and 4, the animal shows no signs of exo- or endo-rotation (less than twice the baseline angle). 2.15. Grid walk Deficit in descending motor control was examined by assessing the ability to navigate across a 100 cm long runway with irregularly assigned gaps (0.5–5 cm) between round metal bars (Metz et al., 2000). In baseline training and postoperative testing, every animal had to cross the grid for at least three times. The number of footfalls (errors) was counted in each crossing and a mean error rate was calculated. 2.16. Statistical analyses BBB score was analyzed using repeated measure analysis of variance (ANOVA), followed by Tukey’s pairwise comparison at each time point. Footprint analysis score was analyzed using Fisher’s Exact Test, 2-Tail. Other data were analyzed using non-parametric Kruskal–Wallis ANOVA, followed by individual Mann–Whitney U tests. Statistical differences were considered significant at P < 0.05. 3. Results 3.1. Identification of M0, M1, and M2 macrophages M0 macrophages cultured in L929 cell-conditioned medium had a flat shape with ruffled edges (Fig. 1B); M1 macrophages cultured in the medium supplemented with IFN-c and LPS had a fried

egg-shape (Fig. 1D); and M2 macrophages cultured in the medium containing IL-4, -10, and TGF-b1 were spindle-shaped (Fig. 1F). As determined by flow cytometry and immunocytochemistry, nearly all cells were positive for the macrophage marker CD68 (>94%). CD86 was also expressed by nearly all M0 and M1 macrophages (>92%) (Fig. 1A, and C); the expression was lower for the M2 type (66.86% ± 15.96%; P < 0.01) (Fig. 1E, and G). On the other hand, >90% of M2 macrophages expressed CD163 (Fig. 1E), while expression was scarce for M0 and M1 macrophages ( 0.05, Fig. 2D). The fractions of CD68+ and CFSE-labeled and non-labeled cells that expressed CD86 were 93.20% ± 2.42%, 93.67% ± 2.52%, and 92.97% ± 2.44%, respectively, for M0 and 94.29% ± 2.14%, 96.75% ± 1.61%, and 93.08% ± 2.67%, respectively, for M1 cell-transferred groups with no differences between the two groups; the fraction was markedly lower (74.82% ± 11.03%, 70.25% ± 18.42%, and 77.07 ± 8.39%, respectively; P < 0.01) for the M2 cell-transferred group (Fig. 2E). CD163 was expressed by 10.03% ± 2.51%, 6.49% ± 2.18%, and 58.50% ± 5.99% of CD68+ cells; 10.01% ± 2.53%, 1.51% ± 0.88%, and 91.37% ± 0.52% of CFSE-labeled cells; and 10.04% ± 2.75%, 8.95% ± 2.95%, and 42.30 ± 7.13% of non- labeled cells for M0, M1, and M2 cell-transferred groups, respectively. CD163 expression was highest in the M2 cell-transferred group (P < 0.01) (Fig. 2E). 3.4. M1 and M2 macrophage infiltration into the injured spinal cord To determine the effect of cell transfer on the fraction of endogenous M1 and M2 macrophages and resident microglia in the injured spinal cord, macrophage phenotype was assessed by immunohistochemistry 7 days after the transfer. Among CD68+ macrophages, CCR7 (Fig. 3A) and Arg1 (Fig. 3B) were used to distinguish between M1 and M2 subpopulations, respectively. The numbers of CD68+ cells in the injured spinal cord of vehicle, M0, M1, and M2 cell-transferred groups were 1096 ± 395, 1462 ± 548, 1687 ± 540, and 1585 ± 560 per mm2, respectively (Fig. 3C), with no differences observed among the four groups. The number of



5

Fig. 1. Characteristics of M0, M1, and M2 macrophages determined by flow cytometry and immunocytochemistry. (A, C, E) Representative scatterplots of CD68, CD86, and CD163 expression in M0 (A), M1(C), and M2 (E) macrophages. (B, D, F) Representative images of CD68 (green), CCR7 (red), or Arg1 (red) expression in M0 (B), M1 (D), and M2 (F) macrophages. Cells were counterstained with Hoechst 33342 (blue) to visualize nuclei. Scale bars: 25 lm. (G, H) Quantitative analysis of CD68-, CD86-, CD163-, CCR7-, and Arg1-positive cells (G) and levels of IL-6, NO, IL-10, TNF-a, and TGF-b in cell culture supernatants (H) in indicated groups. Data are shown as the mean ± SD of three independent experiments (n = 8). ⁄⁄P < 0.01 (ANOVA). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)


6


Fig. 2. Characteristics of CFSE-labeled macrophages and non-labeled resident microglia and endogenous macrophages in the injured spinal cord. (A–C) The infiltration of CFSE-labeled cells in the spinal cord was detected by fluorescence microscopy 7 days after cell transfer in M0 (A, a), M1 (B, b) and M2 (C, c) cell-transferred groups. Scale bars: 150 lm (A, B, and C) and 25 lm (a, b, and c). Phenotypes were also analyzed by flow cytometry (A0 , B0 , and C0 ). The macrophage region (R1) was initially defined in the CD68 and side-scattered light (SSC) dot plots. CFSE-labeled macrophages (R2) and non-labeled resident microglia and endogenous macrophages recruited to the injury site (R3) were defined in CD68 and CFSE dot plots. The percentages of CD86+ or CD163+ cells in R2 or R3 were analyzed in the respective dot plots. (D) Quantitative analysis of CFSElabeled (CFSE+) and non-labeled (CFSE) cells as a fraction ofCD68+ cells in M0, M1, and M2 cell-transferred groups. (E) Quantitative analysis of CD86+ and CD163+ cells as a fraction of CD68+, CD68+CFSE+, and CD68+CFSE cells in the M0, M1, and M2 groups, respectively. Data in (C) and (D) represent the mean ± SD of three independent experiments (n = 8). ⁄⁄P < 0.01 (ANOVA).



7

Fig. 3. M1 and M2 macrophages in the injured spinal cord as distinguished by immunohistochemistry. (A, B) Representative images of CD68 (green) and CCR7 (red) (A) or Arg1 (red) (B) expression in the injured spinal cord in vehicle, M0, M1, and M2 cell-transferred groups. Cells were counterstained with Hoechst 33342 (blue) to visualize nuclei. Scale bars: 25 lm. (C) Quantitative analysis of CD68+, CD68+CD86+, and CD68+CD163+ cells in the indicated groups. Data represent the mean ± SD of three independent experiments (n = 10). ⁄⁄P < 0.01 (ANOVA). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

CD68+ CCR7+ cells was 1050 ± 365, 1402 ± 513, 1591 ± 473, and 774 ± 316 per mm2, respectively, with no differences observed among the subgroups, except that the number was lower in the M2 cell-transferred than in the M0 and M1 cell-transferred groups (P < 0.05). The CD68+ Arg1+ cells were 38 ± 11, 40 ± 10, 35 ± 12, and 512 ± 106 per mm2, respectively, and were highest in the M2 celltransferred group (P < 0.01). 3.5. Effect of cell transfer on Th1 and Th2 cell polarization in the injured spinal cord To observe the effect of cell transfer on the polarization of infiltrated T cells in the injured spinal cord, the phenotypes of distinct Th subtypes were evaluated by immunohistochemistry 7 days after the transfer. Among CD4+ Th cells, T-bet (Fig. 4A) and GATA3 (Fig. 4B) were used to distinguish between Th1 and Th2 subpopulations, respectively. The numbers of CD4+ cells in the injured spinal cord of vehicle, M0, M1, and M2 cell-transferred groups were 2026 ± 295, 1960 ± 452, 2157 ± 538, and 1849 ± 470 per

mm2, respectively (Fig. 4C), with no differences observed among the four groups; the number of CD4+ T-bet+ cells was 1898 ± 392, 1833 ± 440, 1998 ± 522, and 617 ± 248 per mm2, respectively, with no differences among the groups except for the M2 cell-transferred group, in which the number of double-positive cells was significantly lower than in the other groups (P < 0.01). The number of CD4+ GATA3+ cells was 38 ± 13, 36 ± 15, 41 ± 16, and 540 ± 146 per mm2, respectively, with the highest number observed in the M2 cell-transferred group (P < 0.01). 3.6. Effect of cell transfer on cytokine and inducible NO synthase (iNOS) expression in injured spinal cord tissue The mRNA expression of IFN-c, TNF-a, IL-1b, -4, -6, -10, -13, and iNOS in the injured spinal cord was analyzed by real-time reverse transcription-PCR 7 days after cell transfer. All of the cytokines as well as iNOS were expressed in the tissue samples from each group (Fig. 5). The transcript levels of IFN-c and IL-10 and -13 were similar among vehicle, M0, and M1 cell-transferred groups, however,


8


Fig. 4. Polarization of Th1 and Th2 cells in injured spinal cord as examined by immunohistochemistry. (A, B) Representative images of CD4 (green) and T-bet (red) (A) or GATA3 (red) (B) expression in the injured spinal cord of vehicle, M0, M1, and M2 cell-transferred groups. Cells were counterstained with Hoechst 33342 (blue) to visualize nuclei. Scale bars: 25 lm. (C) Quantitative analysis of CD4+, CD4+T-bet+, and CD4+GATA3+ cells in the injured spinal cord of indicated groups. Data represent the mean ± SD of three independent experiments (n = 10). ⁄⁄P < 0.01 (ANOVA). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

tissue samples from the M2 cell-transferred group had lower IFN-c and higher IL-10 and -13 mRNA expression as compared to the other three groups (P < 0.01). IL-6, TNF-a, and iNOS levels were similar among vehicle, M0, and M2 cell-transferred groups, but were expressed at significantly higher levels in M1 cell-transferred group (P < 0.01). IL-1b and -4 mRNA expression was detected at comparable levels in all groups.

1, 2, 3, and 4 mm rostral and caudal to the epicenter was counted 6 weeks after SCI. A larger number of residual motor neurons were observed in the ventral horn 3 and 4 mm rostral and caudal to the lesion epicenter in the M2 cell-transferred group as compared to vehicle, M0, and M1 cell-transferred groups (P < 0.01) (Fig. 7), which had similar numbers of motor neurons. 3.9. Effect of cell transfer on myelination following SCI

3.7. Effect of cell transfer on spinal cord lesion volume A quantitative analysis of the total lesion volume in injured spinal cords was performed 6 weeks after SCI. The total lesion volumes in vehicle, M0, and M1 cell-transferred groups were similar but were larger than in M2 cell-transferred group (P < 0.01) (Fig. 6). 3.8. Effect of cell transfer on motor neuron survival in the ventral horn following SCI To determine the effect of cell transfer on neuronal survival, the number of ventral horn motor neurons at the injury epicenter and

To investigate the effect of cell transfer on myelin preservation, the extent of residual myelination—as detected by LFB staining— was examined at the injury epicenter and 1, 2, 3, and 4 mm rostral and caudal to the epicenter 6 weeks after SCI. The volume of residual myelin was larger at the epicenter and at 1 mm rostral and 1 and 2 mm caudal to the epicenter in the M2 cell-transferred group as compared to the vehicle, M0, and M1 cell-transferred groups (P < 0.01) (Fig. 8), which did not differ in terms of the volume of residual myelin. To verify the above results, a subset of sections from the injury epicenter was stained with toluidine blue, which revealed wide-



9

Fig. 5. Cytokine and iNOS mRNA expression in injured spinal cord as measured by real-time RT-PCR. The relative expression level of target mRNAs was calculated using the DD Ct method and expressed relative to the value in the vehicle group (designated as 1). Data represent the mean ± SD of three independent experiments (n = 8). ⁄⁄P < 0.01 (ANOVA).

spread demyelination in vehicle (Fig. 9A), M0 (Fig. 9B), and M1 (Fig. 9C) cell-transferred groups, and a greater abundance of myelinated axons in M2 cell-transferred group (Fig. 9D). Myelinated axons were counted in four random microscopic fields (67,500 lm2 per fields) in the middle of the lesion and at the pial borders in the dorsal, lateral, and ventral columns. The number of myelinated axons was higher in M2 cell-transferred group than in the other groups (P < 0.01) (Fig. 9E). The residual areas of the injury epicenter were observed by electron microscopy. Wallerian-like axonal degeneration was the most prominent feature in vehicle, M0, and M1 cell-transferred groups (Fig. 10); active demyelination, as revealed by loosening of the myelin sheath, was also present. In contrast, in the M2

cell-transferred group, a greater preservation of myelinated axons was observed. 3.10. Effect of cell transfer on functional recovery after SCI To determine whether functional recovery occurred after SCI upon adoptive transfer of macrophages, animals were evaluated with the BBB locomotor rating scale 1 and 3 days, and then weekly up to 6 weeks after injury. All animals had the maximum score of 21 points before SCI (Fig. 11A); animals received a score of 0 and 3 weeks are required to obtain myelin basic proteinactivated T cells, which is outside the 1- to 2-week time window for cell-transfer post-SCI; moreover, since the blood brain barrier is closed 3 weeks after SCI, transferred cells would be unable to reach the site of injury (Noble and Wrathall, 1989; Popovich et al., 1996a). For this reason, in the present study, in vitro-polarized M2 macrophages were directly transferred to the site of injury. Macrophages can be derived from spleen, bone marrow, and peritoneal fluid and cultured in vitro (Huang et al., 2013; Mohamed-Ali et al., 1995; Mulder et al., 2014). Here, macrophages were obtained and cultured from bone marrow and induced to polarize into two distinct phenotypes (Huang et al., 2013). Using this protocol, sufficient numbers of M1 and M2 macrophages were generated within 1 week. To distinguish between different subsets of macrophage, a general marker (CD68) (Binder et al., 1992), as well as M0- (CD86), M1- (CCR7), and M2- (CD163 and Arg1) specific markers (Chen et al., 2013) were detected by immunocytochemistry and flow cytometry. Macrophages cultured in L929cell-conditioned medium showed flat-shape with ruffled edges typical of M0, as well as high expression of CD68 and CD86 and absence of CD163, CCR7, and Arg1 (Chen et al., 2013; Eligini et al., 2013; McWhorter et al., 2013). In medium supplemented with IFN-c and LPS, cells became polarized and adopted the fried egg shape of M1 macrophages and expressed high levels of CD68, CD86, and CCR7, but not CD163 or Arg1 (Chen et al., 2013; McWhorter et al., 2013; Zhang et al., 2014). In medium supplemented with IL-4 and -10 and TGF-b1, cells were spindle-shaped and were positive for the M2 markers CD68, CD163, and Arg1



11

Fig. 8. Quantitative analysis of residual myelination in injured spinal cord 6 week after SCI. (A) LFB-stained spinal cord cross-section from the injury epicenter (0) and 1, 2, 3, and 4 mm rostral (+) and caudal () to the epicenter. (B) Comparison of residual myelination between groups at various distances from the injury epicenter. Data represent the mean ± SD of three independent experiments (n = 10). ⁄⁄P < 0.01 (ANOVA).

Fig. 9. Quantitative analysis of residual myelination in injured spinal cord 6 weeks after SCI. (A–D) Representative images of toluidine blue-stained sections from sites between the lesion and pial borders of vehicle (A), M0 (B), M1 (C), and M2 (D) celltransferred groups. (E) Quantitative analysis of myelinated axons in four random microscopic fields (10 40-fold) between the lesion and pial borders in the dorsal, lateral, and ventral columns. Data represent the mean ± SD of three independent experiments (n = 10). ⁄⁄P < 0.01 (ANOVA).

while CD86 expression was downregulated and CCR7 expression was absent (Chen et al., 2013; Fuentes-Duculan et al., 2010; McWhorter et al., 2013; Zhang et al., 2014). M1 macrophages produced high levels of IL-6, NO, and TNF-a, whereas M2 cells produced high levels of IL-10 and TGF-b. These results demonstrate that cultured M1 macrophages produce pro-inflammatory cytokines and reactive oxygen species, whereas M2 macrophages produce anti-inflammatory cytokines and inhibit reactive oxygen species production. The transferred cells were tracked in vivo by labeling M0, M1, and M2 macrophages with CFSE (Penjweini et al., 2012). All three types of CFSE-labeled cells were detected at the site of injury, and a flow cytometry analysis demonstrated that the cells maintained their original polarization. The total numbers of CD68+ macrophages were similar between the vehicle and all cell-transferred groups, and resident M1 macrophages were present in the injured spinal cord in all groups, consistent with a previous report (Kigerl et al., 2009). However, there were fewer M1 macrophages in the M2 cell-transferred group than in the other groups indicating that the M2 macrophage response was maintained at a high level. The M1:M2 ratio is important for SCI repair, since M1 macrophages are neurotoxic whereas M2 macrophages promote axonal regeneration after CNS injury (Goerdt and Orfanos, 1999; Kigerl et al., 2009; Mikita et al., 2011). Th cells play an important role in the local microenvironment of the injured spinal cord. Th1 cells produce IFN-c, IL-2, and TNF-b and express the transcription factor T-bet (Szabo et al., 2000), and induce cell-mediated immunity and phagocyte-dependent inflammation; as such, Th1 cells have a largely destructive role. In contrast, Th2 cells secrete IL-4, -10, and -13, and express the transcription factor GATA3 (Zheng and Flavell, 1997); these cells induce a strong antibody response and eosinophil accumulation while inhibit the functions of phagocytic cells (Romagnani, 2000). Therefore, Th2 cells have a protective role in the


12


Fig. 10. Axon and myelin pathology in the injury epicenter 6 weeks after SCI. Representative electron micrographs are shown of the vehicle (A), M0 (B), and M1 (C) celltransferred groups, in which axonal degeneration and myelin breakdown/active demyelination were prominent. A greater number of myelinated axons were detected in the M2 cell-transferred group (D). Scale bar: 10 lm.

Fig. 11. Analysis of locomotor function after SCI. Locomotor function was evaluated by the BBB locomotor rating scale, footprint analysis, and grid walk in vehicle, M0, M1, and M2 cell-transferred groups. Data represent the mean ± SD of three independent experiments (n = 12). (A) Comparison of BBB scores for the four groups. ⁄P < 0.05 (ANOVA). (B) Gridwalk test at week 6 after SCI. ⁄⁄P < 0.01 (ANOVA). (C) Representative images of the 4-point scoring system used for footprint analysis: 0, the animal displays constant dorsal stepping or hindlimb dragging; (1) prints of at least three toes are visible in at least three footprints; (2) the animal shows exo- or endo-rotation of the feet that is more than double the baseline values; (3) there are no signs of toe dragging but foot rotation is present; and (4) the animal shows no signs of exo- or endo-rotation (less than twice the baseline angle). (D) Footprint analysis of the four groups at week 6 after SCI. ⁄P < 0.05 (Fisher’s Exact Test, 2-Tail).

microenvironment of the injury site. The present results indicate that M2 cell transfer reduced the number of CD4+ T-bet+ Th1 cells and increase the number of CD4+ GATA3+ Th2 cells in the injured spinal cord. Taken together, the results suggest that M2 cell transfer may shift the balance from M1 to M2 macrophages at the injury site and alter the local microenvironment from one that is primarily populated by Th1 cells to one that is dominated by Th2 cells and is conducive for SCI repair.

Anti-inflammatory cytokines such as IL-10, -4, and -13, have neuroprotective effects (Bethea, 2000; Kigerl et al., 2009; Offner et al., 2005; Schroeter and Jander, 2005; Stoll et al., 2000), whereas pro-inflammatory cytokines such as IFN-c, IL-1b and -6, and TNFa, as well as NO have detrimental effects in CNS injury (Bartholdi and Schwab, 1997; Nakamura et al., 2003, 2005; Wu et al., 2003; Yang et al., 2005). Here, it was shown that M2 cell transfer inhibited the expression of IFN-c, IL-6, TNF-a, and iNOS transcripts



but increased those of IL-10 and -13. Therefore, M2 cell transfer may also improve the local microenvironment by shifting the balance from harmful to beneficial cytokines. Pro-inflammatory cytokines such as IFN-c and TNF-a promote the M1 macrophage development (Kigerl et al., 2009; Mosser and Edwards, 2008), whereas M2 macrophages are stimulated by anti-inflammatory cytokines such as IL-4, -10, and -13 (Bethea et al., 1999; Kigerl et al., 2009; Martinez et al., 2008; Sica et al., 2006). Given that M2 cell transfer induces IL-13 and -10 expression, a positive feedback loop is created that stimulates the development of additional M2 macrophages. Matrix metalloproteinase-9 (MMP-9) plays an important role in the cell infiltration and blood–spinal cord barrier dysfunction after SCI (Noble et al., 2002; Lee et al., 2012; Piao et al., 2014). In the injured spinal cord, MMP-9 expression was found in glia, neutrophils, vascular elements, and macrophages (Noble et al., 2002). However, the expression levels of MMP9 in M0/M1/M2 macrophages and in injured spinal cord tissues of rats transferred with M0/M1/M2 cells have not been reported previously. Here, we detected the expression levels of MMP9 mRNA by real-time PCR. Although, its expression could be detected in all groups, no significant difference was found (data not shown). These results indicate that the specific roles in neurotoxicity or neuroprotection of different subsets of macrophages have no direct correlation with MMP9 expression. A significant decrease in spinal cord lesion volume accompanied by higher levels of myelination in axons and number of neurons, as well as corresponding locomotor improvements were observed upon M2 cell transfer, as compared to animals receiving vehicle treatment or M0 or M1 cell transfer, demonstrating that M2 cell transfer promotes functional recovery after SCI. 5. Conclusion The findings of this study elucidate a mechanism by which adoptive transfer of M2 macrophages results in histological improvement and functional recovery in adult rats with SCI. M2 cells induce Th2 cell polarization by producing anti-inflammatory cytokines, which in turn produce anti-inflammatory cytokines that promote M2 cell polarization, creating a microenvironment that promotes tissue repair. Acknowledgment This study was supported by grants from the National Natural Science Foundation of China (no. 81271363). References Bartholdi, D., Schwab, M.E., 1997. Expression of pro-inflammatory cytokine and chemokine mRNA upon experimental spinal cord injury in mouse: an in situ hybridization study. Eur. J. Neurosci. 9, 1422–1438. Basso, D.M., Beattie, M.S., Bresnahan, J.C., 1995. A sensitive and reliable locomotor rating scale for open field testing in rats. J. Neurotrauma 12, 1–21. Basso, D.M., Beattie, M.S., Bresnahan, J.C., Anderson, D.K., Faden, A.I., Gruner, J.A., Holford, T.R., Hsu, C.Y., Noble, L.J., Nockels, R., Perot, P.L., Salzman, S.K., Young, W., 1996. MASCIS evaluation of open field locomotor scores: effects of experience and teamwork on reliability. Multicenter Animal Spinal Cord Injury Study. J. Neurotrauma 13, 343–359. Bethea, J.R., 2000. Spinal cord injury-induced inflammation: a dual-edged sword. Prog. Brain Res. 128, 33–42. Bethea, J.R., Nagashima, H., Acosta, M.C., Briceno, C., Gomez, F., Marcillo, A.E., Loor, K., Green, J., Dietrich, W.D., 1999. Systemically administered interleukin-10 reduces tumor necrosis factor-alpha production and significantly improves functional recovery following traumatic spinal cord injury in rats. J. Neurotrauma 16, 851–863. Binder, S.W., Said, J.W., Shintaku, I.P., Pinkus, G.S., 1992. A histiocyte-specific marker in the diagnosis of malignant fibrous histiocytoma. Use of monoclonal antibody KP-1 (CD68). Am. J. Clin. Pathol. 97, 759–763. Bowes, A.L., Yip, P., 2014. Modulating inflammatory cell responses to spinal cord injury: all in good time. J. Neurotrauma 31, 1753–1766.

13

Cao, Q., Zhang, Y.P., Iannotti, C., DeVries, W.H., Xu, X.M., Shields, C.B., Whittemore, S.R., 2005. Functional and electrophysiological changes after graded traumatic spinal cord injury in adult rat. Exp. Neurol. 191 (Suppl. 1), S3–S16. Chen, J.F., Ni, H.F., Pan, M.M., Liu, H., Xu, M., Zhang, M.H., Liu, B.C., 2013. Pirfenidone inhibits macrophage infiltration in 5/6 nephrectomized rats. Am. J. Physiol. Renal Physiol. 304, F676–F685. Clayton, J.P., Gammon, G.M., Ando, D.G., Kono, D.H., Hood, L., Sercarz, E.E., 1989. Peptide-specific prevention of experimental allergic encephalomyelitis. Neonatal tolerance induced to the dominant T cell determinant of myelin basic protein. J. Exp. Med. 169, 1681–1691. Davies, J.Q., Gordon, S., 2005. Isolation and culture of murine macrophages. Methods Mol. Biol. 290, 91–103. Eligini, S., Crisci, M., Bono, E., Songia, P., Tremoli, E., Colombo, G.I., Colli, S., 2013. Human monocyte-derived macrophages spontaneously differentiated in vitro show distinct phenotypes. J. Cell. Physiol. 228, 1464–1472. Fuentes-Duculan, J., Suarez-Farinas, M., Zaba, L.C., Nograles, K.E., Pierson, K.C., Mitsui, H., Pensabene, C.A., Kzhyshkowska, J., Krueger, J.G., Lowes, M.A., 2010. A subpopulation of CD163-positive macrophages is classically activated in psoriasis. J. Invest. Dermatol. 130, 2412–2422. Goerdt, S., Orfanos, C.E., 1999. Other functions, other genes: alternative activation of antigen-presenting cells. Immunity 10, 137–142. Hayakawa, K., Okazaki, R., Morioka, K., Nakamura, K., Tanaka, S., Ogata, T., 2014. Lipopolysaccharide preconditioning facilitates M2 activation of resident microglia after spinal cord injury. J. Neurosci. Res. 92, 1647–1658. Hu, J.G., Shen, L., Wang, R., Wang, Q.Y., Zhang, C., Xi, J., Ma, S.F., Zhou, J.S., Lu, H.Z., 2012. Effects of Olig2-overexpressing neural stem cells and myelin basic protein-activated T cells on recovery from spinal cord injury. Neurotherapeutics 9, 422–445. Huang, Y., Luo, F., Li, H., Jiang, T., Zhang, N., 2013. Conditioned medium from alternatively activated macrophages induce mesangial cell apoptosis via the effect of Fas. Exp. Cell Res. 319, 3051–3057. Ishii, H., Jin, X., Ueno, M., Tanabe, S., Kubo, T., Serada, S., Naka, T., Yamashita, T., 2012. Adoptive transfer of Th1-conditioned lymphocytes promotes axonal remodeling and functional recovery after spinal cord injury. Cell Death Dis. 3, e363. Karimi-Abdolrezaee, S., Eftekharpour, E., Wang, J., Morshead, C.M., Fehlings, M.G., 2006. Delayed transplantation of adult neural precursor cells promotes remyelination and functional neurological recovery after spinal cord injury. J. Neurosci. 26, 3377–3389. Kigerl, K.A., Gensel, J.C., Ankeny, D.P., Alexander, J.K., Donnelly, D.J., Popovich, P.G., 2009. Identification of two distinct macrophage subsets with divergent effects causing either neurotoxicity or regeneration in the injured mouse spinal cord. J. Neurosci. 29, 13435–13444. Kipnis, J., Mizrahi, T., Hauben, E., Shaked, I., Shevach, E., Schwartz, M., 2002. Neuroprotective autoimmunity: naturally occurring CD4+ CD25+ regulatory T cells suppress the ability to withstand injury to the central nervous system. Proc. Natl. Acad. Sci. U. S. A. 99, 15620–15625. Lee, J.Y., Kim, H.S., Choi, H.Y., Oh, T.H., Yune, T.Y., 2012. Fluoxetine inhibits matrix metalloprotease activation and prevents disruption of blood–spinal cord barrier after spinal cord injury. Brain 135, 2375–2389. Lu, H.Z., Xu, L., Zou, J., Wang, Y.X., Ma, Z.W., Xu, X.M., Lu, P.H., 2008. Effects of autoimmunity on recovery of function in adult rats following spinal cord injury. Brain Behav. Immun. 22, 1217–1230. Martinez, F.O., Sica, A., Mantovani, A., Locati, M., 2008. Macrophage activation and polarization. Front. Biosci. 13, 453–461. McWhorter, F.Y., Wang, T., Nguyen, P., Chung, T., Liu, W.F., 2013. Modulation of macrophage phenotype by cell shape. Proc. Natl. Acad. Sci. U. S. A. 110, 17253– 17258. Metz, G.A., Merkler, D., Dietz, V., Schwab, M.E., Fouad, K., 2000. Efficient testing of motor function in spinal cord injured rats. Brain Res. 883, 165–177. Michel, R.P., Cruz-Orive, L.M., 1988. Application of the Cavalieri principle and vertical sections method to lung: estimation of volume and pleural surface area. J. Microsc. 150, 117–136. Mikita, J., Dubourdieu-Cassagno, N., Deloire, M.S., Vekris, A., Biran, M., Raffard, G., Brochet, B., Canron, M.H., Franconi, J.M., Boiziau, C., Petry, K.G., 2011. Altered M1/M2 activation patterns of monocytes in severe relapsing experimental rat model of multiple sclerosis. Amelioration of clinical status by M2 activated monocyte administration. Mult. Scler. 17, 2–15. Mohamed-Ali, H., de Souza, P., Shakibaei, M., Hecker-Kia, A., Kolkenbrock, H., Merker, H.J., 1995. Synovial and peritoneal macrophages in organoid culture. Histol. Histopathol. 10, 393–403. Mosser, D.M., Edwards, J.P., 2008. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 8, 958–969. Mulder, R., Banete, A., Basta, S., 2014. Spleen-derived macrophages are readily polarized into classically activated (M1) or alternatively activated (M2) states. Immunobiology 219, 737–745. Nakamura, M., Houghtling, R.A., MacArthur, L., Bayer, B.M., Bregman, B.S., 2003. Differences in cytokine gene expression profile between acute and secondary injury in adult rat spinal cord. Exp. Neurol. 184, 313–325. Nakamura, M., Okada, S., Toyama, Y., Okano, H., 2005. Role of IL-6 in spinal cord injury in a mouse model. Clin. Rev. Allergy Immunol. 28, 197–204. Noble, L.J., Wrathall, J.R., 1989. Distribution and time course of protein extravasation in the rat spinal cord after contusive injury. Brain Res. 482, 57–66. Noble, L.J., Donovan, F., Igarashi, T., Goussev, S., Werb, Z., 2002. Matrix metalloproteinases limit functional recovery after spinal cord injury by modulation of early vascular events. J. Neurosci. 22, 7526–7535.


14


Offner, H., Subramanian, S., Wang, C., Afentoulis, M., Vandenbark, A.A., Huan, J., Burrows, G.G., 2005. Treatment of passive experimental autoimmune encephalomyelitis in SJL mice with a recombinant TCR ligand induces IL-13 and prevents axonal injury. J. Immunol. 175, 4103–4111. Oorschot, D.E., 1994. Are you using neuronal densities, synaptic densities or neurochemical densities as your definitive data? There is a better way to go. Prog. Neurobiol. 44, 233–247. Parsa, R., Andresen, P., Gillett, A., Mia, S., Zhang, X.M., Mayans, S., Holmberg, D., Harris, R.A., 2012. Adoptive transfer of immunomodulatory M2 macrophages prevents type 1 diabetes in NOD mice. Diabetes 61, 2881–2892. Penjweini, R., Loew, H.G., Hamblin, M.R., Kratky, K.W., 2012. Long-term monitoring of live cell proliferation in presence of PVP–Hypericin: a new strategy using ms pulses of LED and the fluorescent dye CFSE. J. Microsc. 245, 100–108. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res. 29, e45. Piao, M.S., Lee, J.K., Jang, J.W., Hur, H., Lee, S.S., Xiao, L., Kim, H.S., 2014. Melatonin improves functional outcome via inhibition of matrix metalloproteinases-9 after photothrombotic spinal cord injury in rats. Acta Neurochir. (Wien) 156, 2173–2182. Plemel, J.R., Wee Yong, V., Stirling, D.P., 2014. Immune modulatory therapies for spinal cord injury – past, present and future. Exp. Neurol. 258C, 91–104. Popovich, P.G., Horner, P.J., Mullin, B.B., Stokes, B.T., 1996a. A quantitative spatial analysis of the blood–spinal cord barrier. I. Permeability changes after experimental spinal contusion injury. Exp. Neurol. 142, 258–275. Popovich, P.G., Stokes, B.T., Whitacre, C.C., 1996b. Concept of autoimmunity following spinal cord injury: possible roles for T lymphocytes in the traumatized central nervous system. J. Neurosci. Res. 45, 349–363. Romagnani, S., 2000. T-cell subsets (Th1 versus Th2). Ann. Allergy Asthma Immunol. 85, 9–18 (Quiz 18, 21). Schroeter, M., Jander, S., 2005. T-cell cytokines in injury-induced neural damage and repair. Neuromol. Med. 7, 183–195. Shechter, R., Miller, O., Yovel, G., Rosenzweig, N., London, A., Ruckh, J., Kim, K.W., Klein, E., Kalchenko, V., Bendel, P., Lira, S.A., Jung, S., Schwartz, M., 2013. Recruitment of beneficial M2 macrophages to injured spinal cord is orchestrated by remote brain choroid plexus. Immunity 38, 555–569. Sica, A., Schioppa, T., Mantovani, A., Allavena, P., 2006. Tumour-associated macrophages are a distinct M2 polarised population promoting tumour progression: potential targets of anti-cancer therapy. Eur. J. Cancer 42, 717–727.

Stoll, G., Jander, S., Schroeter, M., 2000. Cytokines in CNS disorders: neurotoxicity versus neuroprotection. J. Neural Transm. Suppl. 59, 81–89. Szabo, S.J., Kim, S.T., Costa, G.L., Zhang, X., Fathman, C.G., Glimcher, L.H., 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100, 655–669. Teng, Y.D., Mocchetti, I., Wrathall, J.R., 1998. Basic and acidic fibroblast growth factors protect spinal motor neurones in vivo after experimental spinal cord injury. Eur. J. Neurosci. 10, 798–802. Thawer, S.G., Mawhinney, L., Chadwick, K., de Chickera, S.N., Weaver, L.C., Brown, A., Dekaban, G.A., 2013. Temporal changes in monocyte and macrophage subsets and microglial macrophages following spinal cord injury in the Lys-Egfp-ki mouse model. J. Neuroimmunol. 261, 7–20. Vereyken, E.J., Heijnen, P.D., Baron, W., de Vries, E.H., Dijkstra, C.D., Teunissen, C.E., 2011. Classically and alternatively activated bone marrow derived macrophages differ in cytoskeletal functions and migration towards specific CNS cell types. J. Neuroinflammation 8, 58. Wang, Y., Wang, Y.P., Zheng, G., Lee, V.W., Ouyang, L., Chang, D.H., Mahajan, D., Coombs, J., Wang, Y.M., Alexander, S.I., Harris, D.C., 2007. Ex vivo programmed macrophages ameliorate experimental chronic inflammatory renal disease. Kidney Int. 72, 290–299. Weisser, S.B., McLarren, K.W., Kuroda, E., Sly, L.M., 2013. Generation and characterization of murine alternatively activated macrophages. Methods Mol. Biol. 946, 225–239. Wu, K.L., Chan, S.H., Chao, Y.M., Chan, J.Y., 2003. Expression of pro-inflammatory cytokine and caspase genes promotes neuronal apoptosis in pontine reticular formation after spinal cord transection. Neurobiol. Dis. 14, 19–31. Wucherpfennig, K.W., 1994. Autoimmunity in the central nervous system: mechanisms of antigen presentation and recognition. Clin. Immunol. Immunopathol. 72, 293–306. Yang, L., Jones, N.R., Blumbergs, P.C., Van Den Heuvel, C., Moore, E.J., Manavis, J., Sarvestani, G.T., Ghabriel, M.N., 2005. Severity-dependent expression of proinflammatory cytokines in traumatic spinal cord injury in the rat. J. Clin. Neurosci. 12, 276–284. Zhang, X.M., Lund, H., Mia, S., Parsa, R., Harris, R.A., 2014. Adoptive transfer of cytokine-induced immunomodulatory adult microglia attenuates experimental autoimmune encephalomyelitis in DBA/1 mice. Glia 62, 804–817. Zheng, W., Flavell, R.A., 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89, 587–596.


Spinal cord transplants enhance the recovery of locomotor function after spinal cord injury at birth.

Sox11 promotes endogenous neurogenesis and locomotor recovery in mice spinal cord injury.

Hyaluronan tetrasaccharide exerts neuroprotective effect and promotes functional recovery after acute spinal cord injury in rats.

Early application of tail nerve electrical stimulation-induced walking training promotes locomotor recovery in rats with spinal cord injury.

Cortex-dependent recovery of unassisted hindlimb locomotion after complete spinal cord injury in adult rats.

Deep brain stimulation for locomotor recovery following spinal cord injury.

Treadmill exercise facilitates recovery of locomotor function through axonal regeneration following spinal cord injury in rats.

Recovery of function after spinal cord hemisection in newborn and adult rats: differential effects on reflex and locomotor function.

Treadmill exercise with bone marrow stromal cells transplantation potentiates recovery of locomotor function after spinal cord injury in rats.

Forelimb locomotor rating scale for behavioral assessment of recovery after unilateral cervical spinal cord injury in rats.

Low-energy extracorporeal shock wave therapy promotes vascular endothelial growth factor expression and improves locomotor recovery after spinal cord injury.

Tamoxifen Administration Immediately or 24 Hours after Spinal Cord Injury Improves Locomotor Recovery and Reduces Secondary Damage in Female Rats.

Diffusion tensor imaging as a predictor of locomotor function after experimental spinal cord injury and recovery.

The Anti-Inflammatory Compound Curcumin Enhances Locomotor and Sensory Recovery after Spinal Cord Injury in Rats by Immunomodulation.

The immunomodulator decoy receptor 3 improves locomotor functional recovery after spinal cord injury.

MicroRNA-155 Deficiency Suppresses Th17 Cell Differentiation and Improves Locomotor Recovery after Spinal Cord Injury.

Locomotor training improves premotoneuronal control after chronic spinal cord injury.

Locomotor training for walking after spinal cord injury.

Ecto-domain phosphorylation promotes functional recovery from spinal cord injury.

Prohibitin 1 gene delivery promotes functional recovery in rats with spinal cord injury.

Oral administration of inosine promotes recovery after experimental spinal cord injury in rat.

A Review on Locomotor Training after Spinal Cord Injury: Reorganization of Spinal Neuronal Circuits and Recovery of Motor Function.

Spinal interneurons and forelimb plasticity after incomplete cervical spinal cord injury in adult rats.

E2F4 Promotes Neuronal Regeneration and Functional Recovery after Spinal Cord Injury in Zebrafish.