Mol Biol Rep (2014) 41:2287–2298 DOI 10.1007/s11033-014-3082-0

Adiponectin gene polymorphisms in Egyptian type 2 diabetes mellitus patients with and without diabetic nephropathy Amal S. El-Shal • Haidy E. Zidan • Nearmeen M. Rashad

Received: 18 April 2013 / Accepted: 4 January 2014 / Published online: 28 January 2014 Ó Springer Science+Business Media Dordrecht 2014

Abstract Recently, several reports addressed the associations of adiponectin (ADIPOQ) gene polymorphisms with abnormal adiponectin serum levels, type 2 diabetes mellitus (T2DM), and diabetic nephropathy (DN); however, results are inconsistent. This study aimed to investigate the possible association of ADIPOQ gene polymorphisms with T2DM and/or DN and whether they affect serum adiponectin levels in Egyptian population. Two hundred and ninety-six T2DM patients (100 normoalbuminuric patients, 103 microalbuminuric patients, and 93 macroalbuminuric patients) and 209 controls were enrolled in the present study. Polymorphisms of ?45, -11391, and ?276 of the ADIPOQ gene were detected using polymerase chain reaction restriction fragment length polymorphism. Serum adiponectin was measured using ELISA. Our results revealed that ADIPOQ ?45 TG and GG genotypes and G allele were significantly associated with T2DM, micro/macroalbuminuria, and decreased serum adiponectin level. ADIPOQ -11391 AA genotype frequency was significantly increased in T2DM group. Moreover, GA and AA genotypes and A allele of ADIPOQ -11391 were significantly associated with susceptibility to macroalbuminuria despite increased serum adiponectin concentrations. While, ADIPOQ ?276 TT genotype and T allele were protective factors regarding the susceptibility to T2DM and micro/macroalbuminuria, and they were significantly associated with increased adiponectin levels. We observed also that the decrease of the serum A. S. El-Shal (&)  H. E. Zidan Medical Biochemistry Department, Faculty of Medicine, Zagazig University, Zagazig, Egypt e-mail: [email protected] N. M. Rashad Internal Medicine Department, Faculty of Medicine, Zagazig University, Zagazig, Egypt

Adiponectin level was accompanied by an insulin resistance, albuminuria, as well as an increase of serum creatinine. We concluded that ADIPOQ ?45; ADIPOQ -11391 gene polymorphisms are associated with T2DM and/or DN in Egyptian population. While, ADIPOQ ?276 gene polymorphism is a protective factor regarding T2DM and/or DN susceptibility. Keywords Type 2 diabetes mellitus  Adiponectin  Gene polymorphism  Diabetic nephropathy

Introduction Type 2 diabetes mellitus (T2DM) is a complex disorder with inherited and environmental factors influencing its occurrence. Recently, substantial progress has been made in dissecting a genetic susceptibility to T2DM. Genome wide association studies revealed more than ten genes as associated with this disease [1]. Nevertheless, a large part of the molecular background of T2DM is not yet identified. Adiponectin (ADIPOQ) gene is one of the interesting candidates which have been linked to a susceptibility locus for metabolic syndrome, T2DM and cardiovascular disease [2]. The global increase in diabetes prevalence has been accompanied by a rise in a number of patients with diabetic nephropathy (DN). This complication affects 30–40 % of the patients with type 1 and type 2 diabetes mellitus, and has become the most common cause of endstage renal disease [3]. The management of DN has become a significant economic burden on health care budgets [4]. Subjects with type 2 diabetes, particularly those with high urinary albumin concentrations, are at high risk of renal disease [5].

123

2288

Adiponectin is a cytokine secreted in differentiated adipocytes and credited with insulin-sensitizing, antiinflammatory and antiatherogenic properties [6]. In recent experimental studies, it has been shown that adiponectin has antiproteinuric and nephroprotective effects in diabetic and nondiabetic chronic kidney disease models [7]. Adiponectin is encoded in the ADIPOQ gene situated in the 3q27 region, where several quantitative trait loci for the susceptibility for T2DM have been identified [8]. During the past few years, several polymorphisms at this locus have been tested for associations with T2DM, diabetes related traits, and adiponectin level in various ethnic groups. Studies have focused mostly on three single nucleotide polymorphisms (SNPs), which were among the first to be discovered by targeted resequencing efforts [9]. One of these [-11391G/ A (rs17300539)] is placed in the immediate five flanking region of the gene, and the other two [?45T/G (rs2241766), and ?276G/T (rs1501299)] are located in exon 2 and intron 2, respectively. In general, the results of these studies have been contradictory concerning whether variation at this locus has an impact on metabolic phenotypes and which polymorphisms are responsible for such an effect [10]. Some variants in the ADIPOQ gene were also shown to modulate adiponectin secretion, but they could explain only a small proportion (2–8 %) of serum adiponectin variance [11]. Thus, further studies for the association of ADIPOQ gene polymorphisms with T2DM and its associated kidney disease are necessary. Therefore, we aimed by this study to investigate whether ADIPOQ gene polymorphisms are associated with T2DM and/or DN in Egyptian population; and whether they influence serum adiponectin levels.

Mol Biol Rep (2014) 41:2287–2298

macroalbuminuria as an AER [ 200 lg/min or [300 mg/ 24 h in at least two out of three urine collections. Patients with normal AER were required to have neither antihypertensive medication nor signs of cardiovascular disease. This avoided the possible misclassification of a diabetic individual as having a ‘normal AER phenotype’ where the use of antihypertensive treatment may have reduced urinary albumin excretion into the normal range. Patients with micro/macroalbuminuria were required to receive treatment with angiotensin-converting enzyme inhibitors to be representative of T2DM patients with micro/macroalbuminuria. Thereafter, patients were primarily matched for sex and, secondly, for duration of diabetes. All patients were subjected to thorough medical history taking and full physical examination including blood pressure and anthropometric variables including body mass index (BMI) and waist/hip ratio. Data on medication, cardiovascular status, diabetes complications, hypertension, and cardiovascular disease were obtained using a standardized questionnaire. We estimated glomerular filtration rate (GFR) by using the Cockroft-Gault formula [13]. None of the participants in the current study had liver, thyroid, any active inflammatory diseases and receiving insulin therapy for at least 2 years or on hemodialysis. It is known that the adiponectin levels increase in chronic kidney disease as GFR falls [14]; therefore, we excluded patients with GFR \ 30 ml/min in order to limit the influence of this confounding factor on serum adiponectin. The study protocol was approved by the Ethics Committees of Faculty of Medicine, Zagazig University. Informed written consent was obtained from each individual. Blood sampling

Materials and methods Patients A total of 505 unrelated individuals was included in this study: 296 T2DM patients and 209 healthy volunteers’ age, sex and ethnic origin matched with the patients, and with normal fasting blood glucose and had no evidence of microalbuminuria or hypertension. All cases were recruited from cases admitted and followed in diabetes and endocrinology outpatient clinics of Internal Medicine Departments of Zagazig University hospitals. T2DM patients were diagnosed according to their fasting blood glucose based on the American Diabetes Association criteria, reported in 2008 [12]. The T2DM patients were then divided into three subgroups according to their urinary albumin excretion rate (AER) in 24 h urine collections. Normal AER was defined as an AER persistently\20 lg/min or \30 mg/24 h, microalbuminuria as an AER between 20 and 200 lg/min or 30 and 300 mg/24 h, and

123

Blood samples were drawn from all subjects after an overnight fast and divided into three portions: 1 ml of whole blood was collected into tubes containing EDTA, for genomic DNA extraction and HbA1c; 1 ml of whole blood was collected into tubes containing fluoride for fasting blood glucose. Serum was separated immediately from remaining part of the sample and stored at -20 °C until analysis. Urine sampling Twenty-four h urine samples were collected from each participant in sterilized urine containers and used to determine albumin in 24 h urine specimen. Biochemical measurements Fasting blood glucose concentration was measured using the glucose oxidase method (Spinreact, Girona, Spain).

Mol Biol Rep (2014) 41:2287–2298

2289

Table 1 PCR primers sequence, amplification conditions, restriction enzymes and fragment size before and after digestion

ADIPOQ ?45

PCR primers

Amplification conditions

F:50 GAAGTAGACTCTGCTGAGATGG30

94 °C 5 min

R:50 TATCAGTGTAGGAGGTCTGTGATG30

94 °C 60 s

Product size (bp)

Restriction enzyme

Fragment size

372

SmaI

T allele: not digested

35 cycles

G allele: 219 ? 153 bp

58 °C 45 s 72 °C 45 s 72 °C 5 min ADIPOQ -11391

F:50 -CATCAGAATGTGTGGCTTGC-30

94 °C 5 min

R:50 -AGAAGCAGCCTGGAGAACTG-30

94 °C 60 s

163

MspI

35 cycles

G allele: 137 ? 26 bp A allele: not digested

60 °C 45 s 72 °C 45 s 72 °C 5 min ADIPOQ ?276

F:50 -TCTCTCCATGGCTGACAGTG-30

94 °C 10 min

R:50 -AGATGCAGCAAAGCCAAAGT-30

94 °C 30 s

468 35 cycles

BsmI

G allele: 320 ? 148 bp T allele: not digested

55 °C 30 s 72 °C 30 s 72 °C 10 min

The concentrations of adiponectin in serum were determined using a double antibody sandwich ELISA (kit provided by Biosource Europe S.A, Belgium) according to the manufacturer’s instructions.

in the ADIPOQ gene were performed by a polymerase chain reaction restriction fragment length polymorphism (PCR–RFLP) method described in the previous studies respectively [15–17] . Amplification was performed using a PTC-100 thermal cycler (MJ Research, Inc., Watertown, Massachusetts, USA) (Table 1). The PCR reaction mixtures of the total volume of 25 ll included 10 lg genomic DNA, 5 pmol of each primer, (Promega, Madison, WI) and 1X PCR mix (Taq PCR Master Mix Kit, QIAGEN, GmbH, Hilden, Germany) containing (200 lmol/l of each d NTP, 5 ll of 10 9 reaction buffer, and 1.25 U Taq Gold Polymerase, and 4 mmol/l MgCl2). All PCR products were digested with restriction enzymes (Fermentas–Euromedex) and the fragments were resolved by electrophoresis in a 3.5 % agarose gel after staining with ethidium bromide (Figs. 1, 2, 3).

DNA extraction

Statistical analysis

Genomic DNA was extracted from EDTA whole blood using a spin column method according to the protocol (QIAamp Blood Kit; Qiagen GmbH, Hilden, Germany) DNA was stored at -20 °C till the time of use.

Statistical analyses were performed using the Statistical Package for the Social Sciences for Windows (version 17.0; SPSS Inc., Chicago, IL, USA). The results for continuous variables were expressed using descriptive statistic (mean ± standard deviation, and were analyzed using ‘‘t’’ test. One way analysis of variance (ANOVA) test was done to compare different parameters between more than two groups. The means of three genotype groups were compared by ANOVA. The ADIPOQ gene variants under

Total cholesterol and triglyceride levels were measured by routine enzymatic methods (Spinreact, Girona, Spain). HDL cholesterol concentration was determined after precipitation of the apoB-containing lipoproteins. The LDL cholesterol level was calculated using the Friedewald formula. We determined serum creatinine concentrations using a Jaffe reaction method (Spinreact, Girona, Spain). Quantification of albumin levels in 24 h urine samples was performed by the turbidimetric method (Stanbio Laboratory Inc., San Antonio, TX, USA). Measurement of serum adiponectin concentration

Adiponectin gene polymorphisms analyses Genotyping for the ?45 T/G (rs2241766), -11391G/A (rs17300539), and ?276 G/T (rs1501299) polymorphisms

123

2290

Mol Biol Rep (2014) 41:2287–2298

Fig. 1 Agarose gel electrophoresis showing the PCR–RFLP of ADIPOQ ?45 single nucleotide polymorphism on 3.5 % agarose gel. M: 100 bp marker; lane 1: TT genotype; lanes 3, 6, 9: TG genotype; lanes 2, 5, 7, 10, 12: GG genotype; lanes 4, 8, 11

bp bp bp

Fig. 2 Agarose gel electrophoresis showing the PCR–RFLP of ADIPOQ -11391 single nucleotide polymorphism on 3.5 % agarose gel. M: 50 bp marker; lane 1: GG genotype; lanes 2, 4, 7, 12: GA genotype; lanes 3, 5, 6, 8, 10: AA genotype; lanes 9, 11

bp bp

bp

investigation were evaluated for deviation from Hardy– Weinberg equilibrium by comparing observed and expected genotype frequencies using the Pearson’s two-sided Chi square (v2) or Fisher’s exact tests in T2DM cases and control groups. The statistical difference in genotype distribution and allele frequencies in both control and case subjects was analyzed using v2 or Fisher’s exact tests. Odds ratios (ORs) and confidence intervals (CIs) were calculated. A stepwise multiple regression analysis was performed to detect the relationships of serum Adiponectin concentration with other variables in T2DM patients group. The P value of \0.05 was defined as significant.

123

Results General characteristics of the study subjects General characteristics of the study subjects are summarized in Table 2. There were no significant differences in terms of distributions of age and gender between healthy controls and T2DM patient groups. T2DM cases had higher levels of total cholesterol, triglycerides, LDL cholesterol, fasting blood glucose, fasting serum insulin, HbA1c, HOMA-IR, and serum creatinine more than healthy subjects. Compared with those in controls, HOMA-B, HDL cholesterol, GFR, and

Mol Biol Rep (2014) 41:2287–2298 Fig. 3 Agarose gel electrophoresis showing the PCR–RFLP of ADIPOQ ?276 single nucleotide polymorphism on 3.5 % agarose gel. M: 100 bp marker; lane 1: GG genotype; lanes 2, 4, 7, 8, 10, 12: GT genotype; lanes 3, 5, 6, 9: TT genotype; lane 11

2291

Marker

bp bp

bp

serum ADIPOQ values were decreased in T2DM patients (P \ 0.001). Characteristics of type 2 diabetic patients with or without nephropathy A total of 296 T2DM patients was divided into three subgroups according to their urinary AER in 24 h urine collections: 100 with normoalbuminuria; 103 with microalbuminuria; 93 with macroalbuminuria (Table 3). There were no significant differences in terms of distributions of age, gender, and BMI between groups. Patients with micro/ macroalbuminuria had higher levels of total cholesterol, triglycerides, LDL cholesterol, fasting blood glucose, fasting serum insulin, HbA1c, HOMA-IR, and serum creatinine as compared to patients with normoalbuminuria (P \ 0.001). On the other hand, HOMA-B, HDL cholesterol, GFR, and serum ADIPOQ values were decreased in T2DM patients with micro/macroalbuminuria than normoalbuminuric patients (P \ 0.001). Adiponectin polymorphisms in T2DM patients and controls Compared to healthy controls, T2DM genotype and allelic frequencies of ADIPOQ [?45 (rs2241766), -11391 (rs17300539), and ?276 (rs1501299)] gene polymorphisms of the patients and healthy volunteers are presented in Table 4. The genotype distributions were in Hardy–Weinberg equilibrium in each studied group. T2DM patients had higher frequencies of TG or GG genotypes and G allele at position ?45 of ADIPOQ gene

than healthy controls (49 vs. 37.3 %; 11.5 vs. 4.8 %; 36 vs. 23.4 % respectively). The ADIPOQ ?45 TG or GG genotypes and G allele were significantly associated with susceptibility to T2DM as compared to TT genotype and T allele [OR (95 % CI) 1.92 (1.32–2.79), P = 0. 029; OR (95 % CI) 3.52 (1.66–7.44), P = 0. 023; OR (95 % CI) 1.83 (1.38–2.43), P = 0. 044]. The AA genotype distribution at position -11391 of ADIPOQ gene was significantly higher in T2DM patients than healthy controls (11.1 vs. 3.8 %). Moreover, ADIPOQ -11391 AA genotype was significantly associated with susceptibility to T2DM compared to GG genotype (OR (95 % CI) 4.2 (1.85–9.54), P = 0. 021). After comparing our patients and controls, it was evident that the presence of the A allele was associated with T2DM susceptibility, however this association did not reach formal statistical significance (P = 0.097). Compared to healthy controls, T2DM patients had lower frequencies of ADIPOQ ?276 TT genotype and T allele (1.4 vs. 13.4 %; 18.6 vs. 32.1 % respectively). The TT genotype and T allele of ADIPOQ ?276 were significantly associated with protection from T2DM compared to GG genotype and G allele [OR (95 % CI) 0.08 (0.03–0.23), P \ 0.001; OR (95 % CI) 0.48 (0.36–0.65), P = 0. 035 respectively]. ADIPOQ polymorphisms in T2DM patients with or without nephropathy The TG, GG genotypes and G allele frequencies of the ADIPOQ ?45 polymorphism were significantly higher in those micro/macroalbuminuric T2DM patients (TG:

123

2292

Mol Biol Rep (2014) 41:2287–2298

Table 2 Characteristics of the studied groups

HOMA-IR homeostasis model assessments of insulin resistance, HOMA-b an index of b-cell function, GFR glomerular filtration rate Data are given as mean ± SD;*P \ 0.05 when compared with control group

Patient with type 2 diabetes mellitus (n = 296)

Age (years)

48.9 ± 9.1

49.3 ± 8.6

Sex (male/female)

(103/106)

(146/150)

Body mass index (kg/m2)

22.8 ± 1.2

36.09 ± 2.5*

Waist/hip ratio

0.86 ± 0.01

1.1 ± 0.25*

Systolic blood pressure (mmHg)

117 ± 4.4

136.3 ± 17*

Diastolic blood pressure (mmHg)

75.5 ± 4.1

90.6 ± 13.7*

Fasting blood glucose (mg/dl)

87.9 ± 4.6

195.6 ± 28.2*

Total cholesterol (mg/dl)

178.2 ± 15.6

224.3 ± 25.02*

Triglycerides (mg/dl)

181.5 ± 14.3

230.9 ± 30.8*

LDL cholesterol (mg/dl)

96.2 ± 18.1

143.5 ± 24.7*

HDL cholesterol (mg/dl) Fasting serum insulin (lU/ml)

45.6 ± 5.7 7.49 ± 1.9

34.6 ± 5.9* 18.4 ± 4.8*

HbA1c (%)

5.5 ± 0.48

7.5 ± 0.7*

HOMA-IR

3.1 ± 3.9

8.3 ± 3.1*

HOMA-B

114.02 ± 34.34

48.4 ± 14.6* 10.01 ± 0.81*

Serum adiponectin (ng/ml)

14.8 ± 1.12

GFR (ml/min per 1.73 m2)

69.7 ± 11.7

52.1 ± 29.4*

Serum creatinine (mg/dl)

1.08 ± .09

2.43 ± 1.12*

57.3 %; GG: 12.6 %, G allele: 41.3 %; TG: 58.1 %; GG: 18.3 %, G allele: 47.3 % respectively) than normoalbuminuria T2DM patients (TG: 32 %; GG: 4 %, G allele: 20 %). The TG or GG genotypes and G allele were significantly associated with microalbuminuria compared to TT genotype or T allele [OR (95 % CI) 3.8 (2.07–6.99), P \ 0.001; OR (95 % CI) 6.7 (2.02–22.27), P = 0.001; OR (95 % CI) 2.8 (1.80–4.38), P = 0. 001 respectively]. Similarly, the TG or GG genotypes and G allele were significantly associated with susceptibility to macroalbuminuria as compared to TT genotype or a T allele [OR (95 % CI) 4.9 (2.56–9.43), P \ 0.001; OR (95 % CI) 12.4 (3.75–40.72) P \ 0.001; OR (95 % CI) 3.6 (2.29–5.64), P \ 0.001 respectively]. There were no significant differences in ADIPOQ -11391 genotypes and allele distributions between normoalbuminuric and microalbuminuric T2DM patient groups. While, the GA or AA genotypes and A allele frequencies of the ADIPOQ -11391 polymorphism were significantly higher in those T2DM with macroalbuminuria than normoalbuminuric patients (67.7 vs. 46 %; 17.2 vs. 7 %; 51.1 vs. 30 % respectively). The GA or AA genotypes and A allele were significantly associated with susceptibility to macroalbuminuria in T2DM patients compared to GG genotype and G allele [OR (95 % CI) 4.6 (2.27–9.33, P \ 0.001; OR (95 % CI) 7.7 (2.63–22.37), P \ 0.001; OR (95 % CI) 2.4 (1.60–3.69), P = 0.002 respectively]. On the other hand, ADIPOQ ?276 GT genotype and T allele frequencies were significantly lower in those T2DM with microalbuminuria or with macroalbuminuria (GT:

123

Healthy controls (n = 209)

28.1 %; T allele: 15 %; GT: 11.8 %; T allele: 7 % respectively) than normoalbuminuric T2DM patients (GT: 62 %; T allele: 33 %). The GT genotype and T allele were significantly associated with protection from microalbuminuria among T2DM patients compared to GG genotype and G allele [OR (95 % CI) 0.23 (0.13–0.42), P \ 0.001; OR (95 % CI) 0.36 (0.22–0.58), P = 0.003 respectively]. Moreover, ADIPOQ ?276 GT genotype and T allele were significantly associated with protection from macroalbuminuria in T2DM patients compared to GG genotype and G allele [OR (95 % CI) 0.08 (0.04–0.17), P \ 0.001; OR (95 % CI) 0.15 (0.08–0.29) P \ 0.001 respectively] (Table 5).

Impact of ADIPOQ gene polymorphisms on serum adiponectin level We assessed serum adiponectin levels in different ADIPOQ genotypes among healthy control and T2DM patient groups to analyze the impact of ADIPOQ gene polymorphisms on serum adiponectin levels. The adiponectin levels were significantly lower in T2DM cases with ADIPOQ ?45 TG genotype (9.8 ± 0.85 ng/ml), and GG genotype (9 ± 0.29 ng/ml) than in those with TT genotype (10.15 ± 0.84 ng/ml) (P \ 0.001). On the other hand, serum concentration of adiponectin was significantly higher in patients with ADIPOQ -11391 GA genotype (9.9 ± 0.8 ng/ml), and AA genotype (10.5 ± 0.03 ng/ml) than in those with GG genotype (9.0 ± 0.7 ng/ml) (P \ 0.001).

Mol Biol Rep (2014) 41:2287–2298

2293

Table 3 Characteristics of type 2 diabetic patients with or without nephropathy

By ANOVA test * Statistically significant (P \ 0.05)

Patient with type 2 diabetes mellitus Patients with normoalbuminuria (n = 100)

Patients with microalbuminuria (n = 103)

Patients with macroalbuminuria (n = 93) 49.6 ± 11.6

Age (years)

48.8 ± 6.4

49.6 ± 7.3

Sex (male/female)

(49/51)

(50/53)

(47/46)

Body mass index (kg/m2) Waist/hip ratio

34.6 ± 2.1 0.94 ± 0.01

35.8 ± .5 1 ± 0.07

34.9 ± .5 1.1 ± 0.06

Systolic blood pressure (mmHg)

121.1 ± 5.6

133.9 ± 12.6

155.4 ± 9.3*

Diastolic blood pressure (mmHg)

77.1 ± 5.5

91.1 ± 9.3

104.4 ± 8.8*

Fasting blood glucose (mg/dl)

160.7 ± 4.78

199.1 ± 5.9

229.1 ± 4.8*

Total cholesterol (mg/dl)

195.8 ± 6.2

238.5 ± 8.2

239.3 ± 23.5*

Triglycerides (mg/dl)

192.4 ± 19.4

247.3 ± 11.2

254.2 ± 6.7*

LDL cholesterol (mg/dl)

115.4 ± 4.5

157.4 ± 9.6

158.2 ± 23.4*

HDL cholesterol (mg/dl)

41.9 ± 0.63

31.6 ± 4.4

30.2 ± 1.45*

Fasting serum insulin (lU/ml)

12.2 ± 1.38

20.6 ± 1.9

22.8 ± 1.19*

HbA1c (%)

7.04 ± .3

7.78 ± 3.9

7.92 ± .2.6*

HOMA-IR

6.9 ± 1.8

7.7 ± 3.9

9.4 ± 2.9*

HOMA-B

66.9 ± 4.1

44.5 ± 3.5

32.8 ± 4.8* 9.08 ± 0.28*

Serum adiponectin (ng/ml)

10.9 ± 0.14

9.8 ± 0.7

GFR (ml/min per 1.73 m2)

82.4 ± 25.5

42.7 ± 18.8

29.9 ± 9.04*

Albuminuria (mg/l) Serum creatinine(mg/dl)

20.3 ± 6.1 1.2 ± 0.4

202.3 ± 72.1 2.4 ± 0.6

859.6 ± 183.1* 3.6 ± 0.6*

Table 4 Distribution of adiponectin genotypes and alleles frequencies in healthy controls and patient with type 2 diabetes mellitus ADIPOQ ? 45

Healthy controls n = 209 n (%)

Type 2 diabetes mellitus Patients n = 296 n (%)

TT

121 (57.9)

117 (39.5)

TG

78 (37.3)

GG

ADIPOQ - 11391

34 (11.5)

P

1.92 (1.32–2.79)

0.029*

3.52 (1.66–7.44)

0.023*

1.83 (1.38–2.43)

0.044*

T allele G allele

320 (76.6) 98 (23.4)

379 (64) 213 (36)

GG

104 (49.8)

102 (34.5)

GA

97 (46.4)

161 (54.4)

1.69 (1.17–2.45)

0.08

8 (3.8)

33 (11.1)

4.21 (1.85–9.54)

0.021*

305 (73)

365 (61.7) 1.62 (1.24–2.12)

0.097

AA G allele ADIPOQ ? 276

10 (4.8)

145 (49)

OR (95 % CI)

A allele

117 (27)

227 (38.3)

GG

103 (49.3)

190 (64.2)

GT

78 (37.3)

102 (34.4)

0.71 (0.48–1.04)

0.25

0.08 (0.03–0.23)

\0.001*

0.48 (0.36–0.65)

0.035*

OR odd ratio, 95 % CI 95 % confidence interval

TT

28 (13.4)

4 (1.4)

G allele

284 (67.9)

482 (81.4)

* Statistically significant (P \ 0.05)

T allele

134 (32.1)

110 (18.6)

Similarly, adiponectin levels were significantly higher in T2DM patients with ADIPOQ ?276 GT genotype (9.9 ± 0.68 ng/ml), and in those with TT genotype (10.4 ± 0.89 ng/ml) than in those with GG genotype (9 ± 0.03 ng/ml) (P = 0.001) (data not shown).

Stepwise multiple regression analysis with adiponectin as dependent variable in studied groups A stepwise multiple linear regression analysis in T2DM patient group revealed that HOMA-IR, serum creatinine,

123

2294

Mol Biol Rep (2014) 41:2287–2298

Table 5 Distribution of adiponectin genotypes and alleles in type 2 diabetic patients with or without nephropathy Patients with normoalbuminuria n = 100 n (%) ADIPOQ ? 45

ADIPOQ - 11391

ADIPOQ ? 276

Patients with microalbuminuria n = 103 n (%)

OR (95 % CI)

P

Patients with macroalbuminuria n = 93 n (%)

TT

64 (64)

31 (30.1)

TG

32 (32)

59 (57.3)

3.8 (2.07–6.99)

GG

4 (4)

13 (12.6)

T allele

160 (80)

121 (58.7)

G allele

40 (20)

85 (41.3)

GG

47 (47)

41 (39.8)

GA

46 (46)

52 (50.5)

1.3 (0.73–2.31)

0.37

AA

7 (7)

10 (9.7)

1.6 (0.57–4.69)

0.33

1.2 (0.83–1.90)

0.45

G allele

140 (70)

134 (65)

A allele

60 (30)

72 (35)

GG

36 (36)

73 (70.9)

GT

62 (62)

29 (28.1)

TT

2 (2)

1 (1)

G allele

134 (67)

175 (85)

T allele

66 (33)

31 (15)

OR (95 % CI)

P

22 (23.6) \0.001

54 (58.1)

6.7 (2.02–22.27)

0.001

17 (18.3)

2.8 (1.80–4.38)

0.001

4.9 (2.56–9.43)

\0.001

12.4 (3.75–40.72) \0.001

98 (52.7) 3.6 (2.29–5.64)

\0.001

63 (67.7)

4.6 (2.27–9.33)

\0.001

16 (17.2)

7.7 (2.63–22.37) \0.001

88 (47.3) 14 (15.1)

91 (48.9) 95 (51.1)

2.4 (1.60–3.69)

0.002

81 (87.1) 0.23 (0.13–0.42)

\0.001

11 (11.8)

0.08 (0.04–0.17)

\0.001

0.25 (0.02–2.81)

0.24

1 (1.1)

0.22 (0.02–2.53)

0.16

0.15 (0.08–0.29)

\0.001

173 (93) 0.36 (0.22–0.58)

0.003

13 (7)

Table 6 Stepwise multiple regression analysis with serum adiponectin level as dependent variable in T2DM patients Model

Model 1 Model 2

Model 3

Unstandardized coefficients

Standardized coefficients

95 % CI

b

b

Lower bound 22.52

23.26

121.2

\0.001

-0.93

-0.37

-0.34

-58.97

\0.001

22.04

22.86

107.14

\0.001

-36.69

\0.001

SE

t

P value

Upper bound

Constant

22.89

0.189

HOMA-IR

-0.35

0.006

Constant

22.45

0.210

HOMA-IR

-0.32

0.009

-0.86

-0.34

-0.31

Serum creatinine

-0.25

0.056

-0.11

-0.36

-0.14

-4.53

\0.001

Constant

22.72

0.222

22.28

23.16

102.34

\0.001

HOMA-IR

-0.33

0.009

-0.86

-0.34

-0.31

-37.21

\0.001

Serum creatinine

-0.46

0.083

-0.19

-0.628

-0.30

Albuminuria

0.001

0.00

0.11

and albuminuria were independently related to serum adiponectin concentrations (Table 6).

Discussion Several genetic variants in the ADIPOQ gene had been identified and their associations with T2DM were studied; however, the results are inconsistent between different reports. To the best of our knowledge there are no previous studies concerning the role of ADIPOQ gene polymorphisms in Egyptian T2DM and/or DN patients have been reported. We aimed by this study to evaluate the associations of ADIPOQ gene polymorphisms (?45, -11391, and ?276) with T2DM and/or DN in Egyptian population.

123

0.00

0.001

-5.591

\0.001

3.414

0.001

The results of the present study suggested that ADIPOQ ?45 gene SNP analysis was significantly associated with susceptibility to T2DM as both TG and GG genotypes and G allele were significantly increased in T2DM patients [OR (95 % CI) 1.92 (1.32–2.79), P = 0.029; OR (95 % CI) 3.52 (1.66–7.44), P = 0.023; OR (95 % CI) 1.83 (1.38–2.43), P = 0. 044 respectively]. In accordance with our result Hara et al. [8]; and Li et al. [18] found a significant association of the ADIPOQ ?45 SNP with T2DM in Japanese and Chinese populations respectively. Li et al. [19] reported also that T2DM group had a higher distribution of the TG?GG genotype and G allele frequency than the normal glucose tolerance group. Moreover, Zacharova et al. [20] concluded that the ADIPOQ ?45 G allele was an independent predictor of

Mol Biol Rep (2014) 41:2287–2298

conversion to T2DM. On the contrary, no significant associations were found between the ADIPOQ ?45 polymorphism and T2DM in French Caucasian and Swedish whites’ populations [21, 22]. Recently, in a meta-analysis by Han et al. [23] did not detect any association of ADIPOQ ?45 with T2DM in Asians and whites. One possible explanation of these different results is that different populations may have experienced very diverse environmental impacts during their evolution. In addition, different lifestyle as well as study sample size might also have contributed to this difference [24]. Regarding ADIPOQ -11391 gene polymorphism, we observed that AA genotype was significantly associated with T2DM susceptibility in our population [OR (95 % CI) 4.2 (1.85–9.54), P = 0. 021]. This was in line with the previous study of Vasseur et al. [22] who revealed that ADIPOQ -11391 polymorphism was significantly associated with susceptibility to T2DM in a French Caucasian population. Our findings were also similar to those reported by Roszkowska-Gancarz et al. [25] who found that the ADIPOQ -11391 AA genotype was significantly associated with T2DM. In contrast to our results, Shirin et al. [16] found no significant association between ADIPOQ -11391 polymorphism and T2DM in Iranian population. Also a study by Olckers et al. [26], on black South African type 2 diabetics, revealed that the G allele of -11391 had a protective effect against T2DM. In the present study, we suggested that TT genotype and T allele of ADIPOQ ?276 were significantly associated with protection from T2DM [OR (95 % CI) 0.08 (0.03–0.23), P \ 0.001; OR (95 % CI) 0.48 (0.36–0.65), P = 0. 035 respectively]. Our findings were similar to those reported in the American, Fenland, and Korean populations as they reported that the T allele of ADIPOQ ?276 may confer protection from T2DM [27–29]. Moreover results of Szopa et al. [11] revealed decreased T2DM risk and higher insulin sensitivity in carriers of the T allele indicating that this allele was a protective factor for T2DM in a Polish population. On the other hand, Lee et al. [30] suggested that ADIPOQ ?276 SNP was not associated with T2DM or insulin resistance in Korean subjects. Several studies in Swedish, French, American, Japanese, Chinese and Romanian Caucasian populations did not detect any association of this SNP with T2DM [31–35]. The contrast was found also in the study of Hara et al. [8] suggesting that ADIPOQ ?276 SNP was significantly associated with T2DM and insulin resistance in Japanese population. Menzaghi et al. [36] also reported that this SNP was significantly associated with insulin resistance in Italian subjects. In disagreement with our findings, neither SNP ?45 nor SNP ?276 of the ADIPOQ gene were associated with susceptibility to T2DM in Han Chinese, Japanese, Brazilian,

2295

and African American populations [37–39]. Moreover, results from a meta-analysis of Xu et al. [34] demonstrated a large heterogeneity among the studies on both SNPs. These differences among different populations may be attributed to the heterogeneity of the studied population, or gene environment interaction. Since several previous reports addressed that the ADIPOQ gene polymorphisms were associated with variations in circulating adiponectin levels, we analyzed possible influences of ADIPOQ SNPs on serum adiponectin concentrations. In the current study, the presence of the ADIPOQ ?45 G allele was significantly associated with lower concentrations of adiponectin in controls and T2DM patient groups and this decrease in concentration was higher among individuals homozygous for the G allele than in a heterozygote, suggesting a dose–response effect of the G allele on circulating concentrations of adiponectin. These findings were in agreement with previous results of Li et al. [19]; and Gu et al. [40] who reported that the ADIPOQ 45 polymorphism was significantly associated with hypoAdiponectinmia in T2DM patients when compared with normal glucose tolerant subjects. Furthermore, they observed that T2DM patients carrying the G allele of ADIPOQ ?45 exhibited much lower adiponectin levels than those patients carrying the T allele. These data indicated a significant role of G allele in hypoadiponectinemia and in the susceptibility to T2DM [19]. They hypothesized that ADIPOQ ?45 SNP may affect insulin resistance, possibly through changes in mRNA stability, levels of adiponectin and eventually reduced adiponectin concentrations [19]. The contrast was found in the study of Yang et al. [41] suggesting that the presence of a TT rather than a GG genotype at position ?45 of the ADIPOQ gene was associated with insulin resistance. Moreover Gonzalez-Sanchez et al. [42] showed that the G allele of ADIPOQ ?45 SNP did not result in any change in serum adiponectin concentrations. Our results showed a significant elevation in the serum adiponectin level in ADIPOQ -11391 GA or AA genotypes as compared to GG genotype among all studied groups including control group. Our results were in consonant with that of Fumeron et al. [24]; Vasseur et al. [31]; and Jaziri et al. [43] who reported significant elevations in serum adiponectin levels in ADIPOQ -11391 A allele carriers. Recently Also Roszkowska-Gancarz et al. [25] demonstrated that ADIPOQ -11391 AA genotype was associated with a 2.4-fold higher mean concentration of adiponectin compared to its level in GG genotype. This may be explained by the fact that a deletion of the human promoter region where ADIPOQ -11391 was located increased its transcriptional activity [15].

123

2296

In the current study, we found a significant higher serum adiponectin level in an ADIPOQ ?276 GT or TT genotypes than in those with GG genotype among controls and T2DM patient groups. Our findings were similar to those reported in American, Fenland, and Korean populations as they reported that ADIPOQ ?276 T allele was significantly associated with higher levels of serum adiponectin [27–29]. This finding was in line also with the previous study of Menzaghi et al. [44] who revealed that subjects with ADIPOQ ?276 TT genotype had a higher serum adiponectin level than subjects with the other genotypes. Recently two studies in Chinese and Caucasian T2DM patients reported that the presence of the T allele at ADIPOQ ?276 was associated with higher adiponectin concentrations [34, 45]. On the contrary, Gonzalez-Sanchez et al. [42] reported that ADIPOQ ?276 GG genotype was associated with reduced serum adiponectin levels in Spanish subjects [42]. Moreover, a study among Japanese subjects demonstrated that ADIPOQ ?276 SNP was significantly associated with decreased levels of circulating adiponectin [8]. However, Lee et al. [30] stated that ADIPOQ ?276 SNP was not associated with expression of adiponectin in Korean population. Among T2DM patients, ADIPOQ ?45 TG or GG genotypes and G allele was significantly associated with susceptibility to micro/macroalbuminuria. Our findings were in agreement with Jaziri et al. [43] who showed that the subjects with the G allele at position ADIPOQ ?45 might be associated with risk of incident renal events. However, ADIPOQ ?45 polymorphism was not associated with DN in a Swedish Caucasian population [46]. In the present study, no significant difference was observed in ADIPOQ -11391 allele and genotype frequencies between T2DM patients with microalbuminuria and normoalbuminuric T2DM patients. While, we found that ADIPOQ -11391 GA or AA genotypes and A allele were significantly associated with susceptibility to macroalbuminuria in T2DM patients. Our findings concerning -11391A and ?45G alleles of the ADIPOQ gene were also similar to those in a French population as they reported that -11391 A and ?45 G alleles were associated with increased risk of renal events [44]. They stated that adiponectin gene variants are determinants of early renal dysfunction in T2DM patients. Moreover they hypothesized that ADIPOQ -11391A and ?45G alleles may affect renal risk by leading to higher circulating adiponectin concentrations [44]. Putting our finding together, the significant association of ADIPOQ -11391 GA or AA genotypes and A allele with macroalbuminuria despite high serum adiponectin levels in T2DM patients. In agreement with this finding, nephropathy has been associated with high adiponectin

123

Mol Biol Rep (2014) 41:2287–2298

levels in type 2 diabetes [43, 47], chronic kidney disease and renal failure [48]. This is could be explained as renal failure per se may lead to the stimulation of adiponectin production as a physiological counter-regulatory response to restrict endothelial damage [49]. Furthermore, renal failure may also decrease adiponectin clearance [50], and the kidney may develop secondary resistance to adiponectin [48]. On the contrary, we found that ADIPOQ ?276 GT genotype and T allele may confer protection from micro/ macroalbuminuria in T2DM patients. This confirmed the result obtained by Jaziri et al. [43] which clearly showed that the ?276 G allele was associated with a higher risk of incident renal events in Caucasians. In agreement with our results, Kacso et al. [45] found that increased levels of adiponectin paralleled kidney injury; but were not its cause. The same authors suggested that the synthesis of adiponectin is possibly enhanced in an effort to counteract inflammation associated with kidney disease, which might be successful in the early stages of nephropathy. Therefore the T allele of ADIPOQ ?276 can be considered as a protective factor for albuminuria in Caucasian T2DM patients [45]. The mechanisms for the antiproteinuric action of adiponectin are currently under study, but it is likely for adiponectin to be protective against endothelial dysfunction. Adiponectin is inversely related to leukocyte adhesion [51], and markers of endothelial dysfunction in T2DM patients [52]. Another target of the antiproteinuric effect of endothelin is the podocyte, as adiponectin has been shown to influence foot process fusion and nephrin synthesis [47]. Thus, an increase in adiponectin might be an attractive future target for prevention or therapy of diabetes-associated kidney disease. On the contrary Bostrom et al. [53] showed lack of association between ADIPOQ ?276 polymorphism and nephropathy in African-American T2DM diabetic patients. Ethnic differences may explain the discrepancy in the results obtained by several reports. We further analyzed our results to elucidate the relationships other independent variables with adiponectin level using stepwise multiple linear regression analysis in T2DM patient groups. We observed that the decrease of adiponectin concentration was independently related to insulin resistance, albuminuria, as well as an increase of serum creatinine in T2DM patients. This was in line with the previous studies of Kacso et al. [45] who revealed that lower adiponectin levels seem to be predictive of increased urinary albumin/creatinine ratio. Moreover, Yilmaz et al. [54] reported that the presence of proteinuria is an important predictor of endothelial dysfunction in early DN and that it is associated with altered circulating adiponectin levels. In contrast, Lenghel et al. [52] stated that

Mol Biol Rep (2014) 41:2287–2298

albuminuric patients had a significantly higher adiponectin level compared to normoalbuminuric ones. In conclusion, the results of this study suggest that ADIPOQ ?45 and ADIPOQ -11391 gene polymorphisms are associated with susceptibility to T2DM and DN in Egyptian population. Additionally; ADIPOQ ?276 polymorphism may confer protection from T2DM and DN. Further studies are needed to elucidate the role of genetic variants of the ADIPOQ gene in the pathogenesis of T2DM and DN. Also further replication studies and meta-analysis are necessary. Funding This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors. Conflict of interest

None declared.

Ethical approval The study protocol was approved by a medical ethics committee of Faculty of Medicine, Zagazig University.

References 1. Kronenberg F (2008) Genome-wide association studies in aging related processes such as diabetes mellitus, atherosclerosis and cancer. Exp Gerontol 43:39–43 2. Vionnet N, Hani EH, Dupont S, Gallina S, Francke S, Dotte S et al (2000) Genome wide search for type 2 diabetes susceptibility genes in French whites: evidence for a novel susceptibility locus for early-onset diabetes on chromosome 3q27-qter and independent replication of a type 2 diabetes locus on chromosome 1q21q24. Am J Hum Genet 67:1470–1480 3. Hasslacher C, Ritz E, Wahl P, Michael C (1989) Similar risks of nephropathy in patients with type 1 or type 2 diabetes mellitus. Nephrol Dial Transplant 4:859–863 4. Gordosi A, Scuffham P, Shearer A, Oglesby A (2004) The health care costs of diabetic nephropathy in the United States and the United Kingdom. J Diabetes Complicat 18:18–26 5. Mogensen CE (1984) Microalbuminuria predicts clinical proteinuria and early mortality in maturity-onset diabetes. N Engl J Med 3106:356–360 6. Hopkins TA, Ouchi N, Shibata R, Walsh K (2007) Adiponectin actions in the cardiovascular system. Cardiovasc Res 74(1):11–18 7. Sharma K, Ramachandrarao S, Qiu G, Usui HK, Zhu Y, Dunn SR et al (2008) Adiponectin regulates albuminuria and podocyte function in mice. J Clin Invest 118(5):1645–1656 8. Hara K, Boutin P, Mori Y, Tobe K, Dina C, Yasuda K et al (2002) Genetic variation in the gene encoding adiponectin is associated with an increased risk of type 2 diabetes in the Japanese population. Diabetes 51(2):536–540 9. Takahashi M, Arita Y, Yamagata K, Matsukawa Y, Okutomi K, Horie M et al (2000) Genomic structure and mutations in adipose-specific gene, adiponectin. Int J Obes Relat Metab Disord 24:861–868 10. Menzaghi C, Trischitta V, Doria A (2007) Genetic influences of adiponectin on insulin resistance, type 2 diabetes and cardiovascular disease. Diabetes 56:1198–1209 11. Szopa M, Malczewska-Malec M, Kiec-Wilk B, Skupien J, Wolkow P, Malecki MT et al (2009) Variants of the adiponectin gene and type 2 diabetes in a polish population. Acta Diabetol 46(4):317– 322 12. American Diabetes Association (2008) Diagnosis and classification of diabetes mellitus. Diabetes Care 31:55–60

2297 13. Cockroft DW, Gault MH (1976) Prediction of creatinine clearance from serum creatinine. Nephron 16:31–41 14. Komaba H, Igaki N, Goto S, Yokota K, Doi H, Takemoto T (2006) Increased serum high-molecular-weight complex of adiponectin in type 2 diabetic patients with impaired renal function. Am J Nephrol 26(5):476–482 15. Sabouri S, Ghayour-Mobarhan M, Moohebati M, Hassani M, Kassaeian J, Tatari F et al (2011) Association between 45T/G polymorphism of adiponectin gene and coronary artery disease in an Iranian population. Sci World J 11:93–101 16. Shirin HR, Mahsa MA, Mohammadali S, Parisa PA, Mahsa N, Ramin H et al (2011) Genetic association analysis of the adiponectin polymorphisms in type 2 diabetes with and without complications. Iranian J Diabetes Lipid Disorders 10:1–4 17. Zhang N, Shi YH, Hao CF, Gu HF, Li Y, Zhao YR et al (2008) Association of ?45G15G (T/G) and ?276(G/T) polymorphisms in the ADIPOQ gene with polycystic ovary syndrome among Han Chinese women. Eur J Endocrinol 158(2):255–260 18. Li S, Li L, Li K, Qi X, Hoekema D, Liu H et al (2004) Association of adipose most abundant transcript 1 gene (apM1) with type 2 diabetes mellitus in a Chinese population: a meta-analysis of case–control studies. Clin Endocrinol (Oxf) 68:885–889 19. Li LL, Kang XL, Ran XJ, Wang Y, Wang CH, Huang L et al (2007) Associations between 45T/G polymorphism of the adiponectin gene and plasma adiponectin levels with type 2 diabetes. Clin Exp Pharmacol Physiol 34:1287–1290 20. Zacharova J, Chiasson JL, Laakso M (2005) STOP-NIDDM study group the common polymorphisms (single nucleotide polymorphism [SNP] ?45 and SNP?276 of the of the adiponectin gene predict the conversion from impaired glucose tolerance to type 2 diabetes: the STOP-NIDDM trial. Diabetes 54:893–899 21. Gu HF, Abulaiti A, Ostenson CG, Humphreys K, Wahlestedt C, Brookes AJ et al (2004) Single nucleotide polymorphisms in the proximal promoter region of the adiponectin (APM1) gene are associated with type 2 diabetes in Swedish Caucasians. Diabetes 53(1):31–35 22. Vasseur F, Helbecque N, Lobbens S, Vasseur-Delannoy V, Dina C, Cle´ment K et al (2005) Hypoadiponectinaemia and high risk of type 2 diabetes are associated with adiponectin-encoding (ACDC) gene promoter variants in morbid obesity: evidence for a role of ACDC in diabesity. Diabetologia 48:892–899 23. Han LY, Wu QH, Jiao ML, Hao YH, Liang LB, Gao LJ et al (2011) Associations between single-nucleotide polymorphisms (?45T [ G, ?276G [ T, -11377C [ G, -11391G [ A) of adiponectin gene and type 2 diabetes mellitus: a systematic review and meta-analysis. Diabetologia 54:2303–2314 24. Fumeron F, Aubert R, Siddiq A, Betoulle D, Pean F, Hadjadj S et al (2004) Adiponectin gene polymorphisms and adiponectin levels are independently associated with the development of hyperglycemia during a 3-year period: the epidemiologic data on the insulin resistance prospective study. Diabetes 53(4):1150– 1157 25. Roszkowska-Gancarz M, Bartoszewicz Z, Polosak J, Kurylowicz A, Jonas M, Mossakowska M et al (2012) Total and high molecular weight adiponectin and level-modifying polymorphisms of ADIPOQ in centenarians. Endokrynologia Polska 63(6):439–446 26. Olckers A, Towers GW, van der Merwe A, Schwarz PE, Rheeder P, Schutte AE (2007) Protective effect against type 2 diabetes mellitus identified within the ACDC gene in a black South African diabetic cohort. Metabolism 56(5):587–592 27. Qi L, Li T, Rimm E, Zhang C, Rifai N, Hunter D et al (2005) The ?276 polymorphism of the APM1 gene, plasma adiponectin concentration, and cardiovascular risk in diabetic men. Diabetes 54(5):1607–1610

123

2298 28. Mousavinasab F, Ta¨htinen T, Jokelainen J, Koskela P, Vanhala M, Oikarinen J et al (2006) Commom polymorphisms (singlenucleotide polymorphysims SNP?45 and SNP?276 of the adiponectin gene regulate serum adiponectin concentrations and blood pressure in young Finnish men. Mol Genet Metab 87(2):147–151 29. Jang Y, Lee JH, Chae JS, Kim OY, Koh SJ, Kim JY et al (2005) Association of 276 G [ T polymorphism of the adiponectin gene with cardiovascular disease risk factors in nondiabetic Koreans. Am J Clin Nutr 82(4):760–767 30. Lee YY, Lee NS, Cho YM, Moon MK, Jung HS, Park YJ et al (2005) Genetic association study of adiponectin polymorphisms with risk of type 2 diabetes mellitus in Korean population. Diabet Med 22:569–575 31. Vasseur F, Helbecque N, Dina C, Lobbens S, Delannoy V, Gaget S et al (2002) Single-nucleotide polymorphism haplotypes in the both proximal promoter and exon 3 of the APM1 gene modulate adipocyte-secreted adiponectin hormone levels and contribute to the genetic risk for type 2 diabetes in French Caucasians. Hum Mol Genet 11:2607–2614 32. Hu FB, Doria A, Li T, Meigs JB, Liu S, Memisoglu A et al (2004) Genetic variation at the adiponectin locus and risk of type 2 diabetes in women. Diabetes 53:209–213 33. Populaire C, Mori Y, Dina C, Vasseur F, Vaxillaire M, Kadowaki et al (2003) Does the -11377 promoter variant of APM1 gene contribute to the genetic risk for type 2 diabetes mellitus in Japanese families? Diabetologia 46:443–445 34. Xu MT, Chen XC, Jin LZ, Chen WQ (2008) A meta-analysis on the association between adiponectin gene 45T/G ?276G/T polymorphisms and type 2 diabetes in Chinese population. Zhonghua Liu Xing Bing Xue Za Zhi 29:1132–1136 35. Kacso IM, Farcas MF, Pop IV, Bondor CI, Potra AR, Moldovan D et al (2012) 267 G [ T polymorphism of the ADIPOQ gene influences plasma adiponectin in type 2 diabetes patients but is not predictive for presence of in type 2 diabetes in a Caucasian Cohort from Romania. Maedica (Buchar). 7(4):271–276 36. Menzaghi C, Ercolino T, Di Paola R, Berg AH, Warram JH, Scherer PE et al (2002) A haplotype at the adiponectin locus is associated with obesity and other features of the insulin resistance syndrome. Diabetes 51:2306–2312 37. Wang Y, Zhang D, Liu Y, Yang Y, Zhao T, Xu J et al (2009) Association study of the single nucleotide polymorphisms in adiponectin-associated genes with type 2 diabetes in Han Chinese. J Genet Genomics 36:417–423 38. Vendramini MF, Pereira AC, Ferreira SR, Kasamatsu TS, Moises RS (2010) Association of genetic variants in the adiponectin encoding gene (ADIPOQ) with type 2 diabetes in Japanese Brazilians. J Diabetes Complicat 24:115–120 39. Bostrom MA, Freedman BI, Langefeld CD, Liu L, Hicks PJ, Bowden DW (2009) Association of adiponectin gene polymorphisms with type 2 diabetes in an African American population enriched for nephropathy. Diabetes 58:499–504 40. Gu HF (2009) Biomarkers of adiponectin: plasma protein variation and genomic DNA polymorphisms. Biomark Insights 4:123–133 41. Yang WS, Hsiung CA, Ho LT, Chen YT, He CT, Curb JD et al (2003) Genetic epistasis of adiponectin and PPAR gamma2

123

Mol Biol Rep (2014) 41:2287–2298

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

53.

54.

genotypes in modulation of insulin sensitivity: a family-based association study. Diabetologia 46:977–983 Gonzalez-Sanchez JL, Zebena CA, Martinez-Larrad MT, Ferna´ndez-Pe´rez C, Pe´rez-Barba M, Laakso M et al (2005) An SNP in the adiponectin gene is associated with decreased serum adiponectin levels and risk for impaired glucose tolerance. Obes Res 13:807 Jaziri R, Aubert R, Roussel R, Emery N, Maimaitiming S, Bellili N et al (2010) Association of ADIPOQ genetic variants and plasma adiponectin isoforms with the risk of incident renal events in type 2 diabetes. Nephrol Dial Transplant 25(7):2231–2237 Menzaghi C, Ercolino T, Salvemini L, Coco A, Kim SH, Fini G et al (2004) Multigenic control of serum adiponectin levels. Evidence for a role of the APM1 gene and a locus on 14q13. Physiol Genomics 19:170–174 Kacso IM, Trifa AP, Popp RA, Kasco G (2012) Association of 276G [ T adiponectin gene polymorphism to plasma adiponectin and albuminuria in type 2 diabetic patients Int Urol Nephrol (2012). Int Urol Nephrol 44(6):1771–1777 Ma J, Mo¨llsten A, Falhammar H, Brismar K, Dahlquist G, Efendic S et al (2007) Genetic association analysis of the adiponectin polymorphisms in type 1 diabetes with and without diabetic nephropathy. J Diabetes Complicat 21:28–33 Looker HC, Krakoff J, Funahashi T, Matsuzawa Y, Tanaka S, Nelson RG et al (2004) Adiponectin concentrations are influenced by renal function and diabetes duration in Pima Indians with type 2 diabetes. J Clin Endocrinol Metab 89:4010–4017 Kollerits B, Fliser D, Heid IM, Ritz E, Kronenberg F (2007) MMKD Study Group. Gender-specific association of adiponectin as a predictor of progression of chronic kidney disease: the mild to moderate kidney disease study. Kidney Int 71:1279–1286 Schalkwijk CG, Chaturvedi N, Schram MT, Fuller JH, Stehouwer CD (2006) EURODIAB Prospective Complications Study Group. For the EURODIAB Prospective Complications Study Group. Adiponectin is inversely associated with renal function in type 1 diabetic patients. J Clin Endocrinol Metab 91:129–135 Saraheimo M, Forsblom C, Fagerudd J, Teppo AM, PetterssonFernholm K, Frystyk J et al (2005) Serum adiponectin is increased in type 1 diabetic patients with nephropathy. Diabetes Care 28:1410–1414 Ouedraogo R, Gong Y, Berzins B, Wu X, Mahadev K, Hough K et al (2007) Adiponectin deficiency increases leukocyte endothelium interactions via upregulation of endothelial cell adhesion molecules in vivo. J Clin Invest 117(6):1718–1726 Lenghel AR, Kacso IM, Bondor CI, Rusu C, Rahaian R, Gherman Caprioara M (2012) Intercellular adhesion molecule, plasma adiponectin and albuminuria in type 2 diabetic patients. Diab Diabetes Res Clin Pract 95(1):55–61 Bostrom MA, Freedman BI, Langefeld CD, Liu L, Hicks PJ, Bowden DW et al (2009) Association of adiponectin gene polymorphisms with type 2 diabetes in an African American population enriched for nephropathy. Diabetes 58(2):499–504 Yilmaz MI, Saglam M, Qureshi AR, Carrero JJ, Caglar K, Eyileten T et al (2008) Endothelial dysfunction in type-2 diabetics with early diabetic nephropathy is associated with low circulating adiponectin. Nephrol Dial Transplant 23(5):1621–1627