LFS-14311; No of Pages 8 Life Sciences xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Life Sciences journal homepage: www.elsevier.com/locate/lifescie
F
O
4
Eugene Chang a, Jung Mook Choi b, Se Eun Park c, Eun-Jung Rhee c, Won-Young Lee c, Ki Won Oh c, Sung Woo Park c, Cheol-Young Park b,c,⁎
5 6 7
a
8
a r t i c l e
9 10 11 12 13
Article history: Received 15 September 2014 Received in revised form 27 January 2015 Accepted 12 February 2015 Available online xxxx
14 15 16 17 18
Keywords: Adipocytes Adiponectin Insulin signaling Insulin resistance
Department of Nutritional Science and Food Management, Ewha Womans University, Seoul, Republic of Korea Diabetes Research Institute, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Republic of Korea Division of Endocrinology and Metabolism, Department of Endocrinology and Metabolism, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Republic of Korea
i n f o
a b s t r a c t
Aims: Previous reports have demonstrated that the adipocyte-derived peptide adiponectin is closely associated with insulin resistance due to its insulin-sensitizing and anti-inflammatory properties in peripheral tissues; however the autocrine effects of adiponectin remain elusive. This study investigated regulatory effects of adiponectin on glucose transport and insulin signaling in insulin-sensitive or insulin-resistant 3T3-L1 adipocytes. Main methods: 3T3-L1 fibroblasts were transfected with non-target or adiponectin (ADN) siRNA and differentiated. Chronic treatment with insulin (24 h, 100 nM) was employed to induce insulin resistance in differentiated adipocytes. Insulin-stimulated glucose transport was measured and protein and mRNA levels were assessed by Western blot and RT-PCR. Key findings: Prolonged incubation with insulin significantly reduced insulin-stimulated glucose uptake, suggesting the development of insulin resistance and adiponectin mRNA expression. In this insulin-resistant condition, adiponectin deletion did not alter insulin-stimulated glucose uptake. In insulin-sensitive adipocytes, adiponectin ablation reduced insulin-stimulated glucose uptake, expression of IRS-1 and GLUT4, and GLUT4 translocation to the membrane. Adiponectin knockdown did not affect the activation of AKT and p38MAPK (phosphorylation form/total form), but significantly decreased the activation of AMPK in insulin-responsive adipocytes. Significance: Adiponectin deficiency suppresses insulin-induced glucose uptake, insulin signaling, and the AMPK pathway only in insulin-responsive 3T3-L1 adipocytes. © 2015 Published by Elsevier Inc.
E
E
C
c
T
b
R O
3Q3
P
2
Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes
D
1Q2
R
35 39 37 36
R
38
1. Introduction
41
The dramatically increased prevalence of obesity is closely associated with features of the metabolic syndrome, including type 2 diabetes, dyslipidemia, hypertension, and heart disease [8]. Obesity and type 2 diabetes are associated with alterations in adipose tissue size and function. During energy surplus, adipose tissue expands to store excess energy and the synthesis and release of adipocyte-derived factors regulating insulin sensitivity are altered [14,22]. Of these, adiponectin (ADN, also known as ACRP30 and gelatin-binding protein-28) is the most abundant circulating adipokine. Plasma adiponectin levels are reduced in obesity and type 2 diabetes [12,30]. Moreover, genetic variation in the ADIPOQ gene promoter is associated with the development of
46 47 48 49 50 51
U
44 45
N C O
40
42 43
19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34
⁎ Corresponding author at: Diabetes Research Institute & Division of Endocrinology and Metabolism, Department of Internal Medicine, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, No. 108, Pyung-Dong, Jongno-Ku, Seoul 110-746, Republic of Korea. Tel.: +82 2 2001 1869; fax: +82 2 2001 1588. E-mail address: [email protected] (C.-Y. Park).
type 2 diabetes [25]. Hypoadiponectinemia is considered to be an independent risk factor for the progression of type 2 diabetes [12]. Thus, targeting adiponectin has been regarded as a therapeutic tool for treating type 2 diabetes and metabolic syndrome [1,3,9,35]. Adiponectin exerts its insulin-sensitizing and other beneficial metabolic effects by inhibiting hepatic gluconeogenesis [1] and increasing fatty acid oxidation [9,35] via the activation of AMP-activated protein kinase (AMPK) and peroxisome proliferator-activated receptor α (PPARα) [36], and the inhibition of acetyl coenzyme A carboxylase (ACC) [28,34,36] in liver and muscle. Moreover, its anti-inflammatory effects result from decreased migration of macrophages and foam cells across the vascular wall [20] and macrophage polarization [19]. Previous studies examining the autocrine effects of adiponectin on adipocyte biology show that overexpression of adiponectin in adipocytes enhances insulin sensitivity by modulating proliferation, differentiation, and lipid accumulation [10]. Globular adiponectin treatment in primary rat adipocytes increases insulin-stimulated glucose uptake via activation of AMPK [31]. In addition, fat tissue-specific overexpression of adiponectin further increases circulating adiponectin levels, and
http://dx.doi.org/10.1016/j.lfs.2015.02.013 0024-3205/© 2015 Published by Elsevier Inc.
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70
81 82
93
Murine 3T3-L1 cells obtained from American Type Culture Collection (ATCC CL-173; Manassas, VA, USA) were maintained in high glucose (HG)-DMEM (Gibco, Grand Island, NY, USA), 10% bovine calf serum (Gibco), 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco) at 37 °C in 95% air and 5% CO2. After 2 days post-confluence (day 0), adipocyte differentiation was induced by adding a cocktail composed of 520 μM isobutylmethylxanthine (Sigma, St. Louis, MO, USA), 1 μM dexamethasone (Sigma, St. Louis, MO, USA), and 1 μg/mL bovine insulin (Sigma, St. Louis, MO, USA) to 10% fetal bovine serum (FBS) contained HG-DMEM. After 48 h, medium was replaced with HG-DMEM containing 10% FBS, antibiotics and insulin. Until more than 95% of the cells contained lipid droplets, the medium was renewed every two days with HG-DMEM containing 10% FBS.
94
2.2. RNA interference
95
104 105
All RNAi constructs and reagents were obtained from Thermo Scientific Dharmacon (Pittsburgh, PA, USA). 3T3-L1 fibroblasts were transfected with adiponectin siRNA (ADN siRNA, ON-TARGETplus SMARTpool) consisting of a mixture of four unique siRNAs using DharmaFECT transfection reagent. As control, non-target siRNA (Dharmacon's non-target siRNA pool of four) was used. After 24-h incubation, differentiation was induced as described above. Differentiated adipocytes were treated with insulin (24 h, 100 nM) to induce insulin resistance. Insulin stimulation was followed by treatment with insulin (30 min, 100 nM) for the assays of glucose transport and protein expression.
106
2.3. Determination of insulin-stimulated glucose uptake
107
119 120
Differentiated 3T3-L1 adipocytes incubated with or without chronic insulin (24 h, 100 nM) on 12-well tissue culture plates were washed with sterile PBS twice and incubated in serum-free HG-DMEM for 6 h prior to uptake experiments. Cells were pretreated with insulin (30 min, 100 nM) followed by incubation for 10 min in PBS containing 100 μM unlabeled 2-deoxyglucose and 1 μCi/mL 2-deoxy-[3H]-glucose (PerkinElmer, MA, USA). The reaction was terminated by washing three times with ice-cold 0.2 N NaOH solution. Nonspecific uptake was determined in the presence of 20 μM cytochalasin B. Cellassociated radioactivity was determined by lysing cells with 1% SDS, followed by liquid scintillation counting. Results were expressed as percent of basal glucose rate in non-target siRNA transfected cells. Insulin-stimulated glucose transport was expressed as percent of basal glucose uptake in non-target siRNA transfected adipocytes.
121
2.4. Reverse transcription and quantitative RT-PCR
122
Total RNA was purified using RNeasy Mini Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. For cDNA preparation, the high-capacity cDNA Kit (Applied Biosystems, Foster City, CA, USA) was utilized, and the reaction was performed at 37 °C for 60 min and subsequently incubated at 95 °C for 5 min. Primers used are shown in Table 1. RT-PCR was carried out using Roche real-time PCR
102 103
108 109 110 111 112 113 114 115 116 117 118
123 124 125 126 127
C
100 101
E
98 99
R
96 97
R
91 92
O
89 90
C
87 88
N
85 86
U
83 84
t1:3
ccaccgatccacacagagta ctttcctgccaggggttc agaggggcagtcctgagagt ccagtgttatagccgaactgc gccacgatggagacatagc
t1:4 t1:5 t1:6 t1:7 t1:8
actgctctggctcctagcac agggagagaaaggagatgcag aaggagtcggctccagtgt atggatcccagcagcaag gacggacactccatctgttg
master mix with UPL and Roche LightCycler 480 (Roche, Mannheim, Germany) as follows: one cycle of pre-denaturation at 95 °C for 10 min, followed by 45 cycles of denaturation at 95 °C for 10 s, and annealing and extension at 60 °C for 20 s. Each target gene was normalized to that of β-actin and expressed as fold change compared to controls.
128
133
F
2.1. Cell culture
Reverse primer
NM_007393.3 NM_009605.4 NM_010570.4 NM_011400.3 NM_009204.2
O
80
77
Accession number Forward primer
β-Actin Adiponectin IRS-1 GLUT1 GLUT4
2.5. Western blot analysis
129 130 131 132
Differentiated adipocytes were washed in ice-cold PBS and lysed in RIPA lysis buffer (Amresco, Solon, OH, USA) including protease inhibitor and phosphatase inhibitor cocktails (Sigma, St. Louis, MO, USA). Protein concentrations were determined by BCA assay (Pierce, Rockford, IL, USA). Equal protein aliquots of 3T3-L1 lysates were loaded to 4–20% gradient SDS-PAGE gels (Bio-rad, Hercules, CA, USA), separated by electrophoresis, and then transferred to PVDF membrane (Millipore, Marlborough, MA, USA). Membranes were blocked in 5% non-fat dry milk in TBST (0.05% Tween 20, 50 mM Tris–HCL, pH 7.5 and 150 mM NaCl) for 1 h at room temperature then incubated overnight with primary antibodies in blocking buffer at 4 °C. The following primary antibodies were used: phospho-protein kinase B (serine/threonine-specific protein kinase (phospho-AKT); Ser473), total AKT, insulin receptor substrate-1 (IRS-1), glucose transporter (GLUT)1, GLUT4, phospho-AMPK, total AMPK, phospho-p38 mitogen-activated protein kinases (phosphop38MAPK), total p38MAPK, and β-actin (Cell Signaling Technology, MA, USA). After washing, secondary antibodies were employed for 1 h at room temperature, and membranes were developed using Amersham ECL plus system (Amersham-Pharmacia Biotech, Arlington Heights, IL, USA). Density of immunoreactive bands was determined using Geliance Imaging software (PerkinElmer Life and Analytical Sciences, Boston, MA, USA). Results were expressed as fold change compared to control or as the ratio of phospho-protein to total protein.
134
2.6. 3T3-L1 cell membrane fractionation and GLUT4 detection
157
The preparation of plasma membrane and post-plasma membrane was completed as described previously [18]. 3T3-L1 adipocytes were rinsed with Buffer A (50 mM Tris, pH 8.0, and 0.5 mM dithiothreitol) including protease and phosphatase inhibitors, and homogenized with a Teflon pestle and 25-gauge needle. Total membranes were pelleted at 1000 ×g for 10 min twice, and resuspended in Buffer A including protease and phosphatase inhibitors. After centrifugation at 16,000 ×g for 20 min at 4 °C, the supernatant was saved as plasma membrane. The cytosolic supernatants from the first and the second 1000 ×g centrifugation were gathered and centrifuged at 16,000 ×g for 20 min at 4 °C. The supernatant was used as intracellular membrane. Protein quantification for all fractions was determined by BCA method as described above. To detect GLUT4, Western blots were conducted. GLUT4 abundance in plasma membrane and intracellular fraction was expressed as insulin-stimulated GLUT4 expression/basal GLUT4 level followed by sample/control (non-targeted siRNA transfected adipocytes in a state of insulin sensitivity).
158 159
2.7. Statistical analysis
175
R O
2. Materials and methods
75 76
Gene
P
79
73 74
t1:1 t1:2
Table 1 Characteristics of the specific primers used for RT-PCR.
T
78
improved insulin sensitivity [4]. However, autocrine effects of adiponectin on glucose transport and insulin signaling according to the different insulin sensitivity in adipocytes remain less clear. To clarify autocrine function of adiponectin, this study investigated the effects of siRNA against adiponectin on adipocyte glucose transport and insulin signaling in both insulin-sensitive and insulin-resistant adipocytes. Furthermore, we evaluated the mechanisms of insulinsensitizing effect of adiponectin on adipocyte insulin signaling.
D
71 72
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
E
2
135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156
160 161 162 163 164 165 166 167 168 169 170 171 172 173 174
Data are presented as means ± standard error of mean (SEM) of at 176 Q4 least two independent triplicate experiments. Data were performed 177
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
183
3. Results
184 185
3.1. Effect of adiponectin (ADN) siRNA transfection on adiponectin expression in 3T3-L1 adipocytes
186
The effectiveness of ADN siRNA transfection was assessed by Western blot and RT-PCR. ADN siRNA transfection significantly decreased adiponectin protein abundance (Fig. 1A and B) and mRNA expression (Fig. 1C). Reduced protein and mRNA expression of adiponectin was evidence for the success of ADN siRNA transfection. Interestingly, chronic
180 181
187 188
To investigate the autocrine effects of adiponectin on insulin sensitivity, glucose uptake was first determined in non-target or ADN siRNA-transfected 3T3-L1 cells in insulin-responsive or resistant state. Whereas insulin stimulation (30 min, 100 nM) in non-target siRNA transfected insulin responsive adipocytes significantly increased insulin-induced glucose transport by 421% compared to basal status (Fig. 2A, columns 1 & 2), chronic insulin treatment (24 h, 100 nM) did not induce insulin-stimulated glucose uptake in insulin resistant control cells (Fig. 2, columns 3 & 4), indicating the status of insulin resistance. Basal glucose transport was not significantly different according to insulin sensitivity and/or adiponectin deficiency, however, insulinstimulated glucose transport was influenced by the presence of adiponectin only in insulin-responsive adipocytes. Insulin-stimulated glucose rate was significantly increased by 421% in non-target siRNA transfected cells compared to 316% induction in ADN siRNAtransfected adipocytes (Fig. 2, columns 2 & 6). Thus, adiponectin deletion in 3T3-L1 adipocytes affected insulin-induced glucose uptake. However, there was no alteration in insulin-stimulated glucose uptake between non-target siRNA and ADN siRNA transfected cells in the insulin resistant state (Fig. 2B, columns 4 & 8). This suggests that decreased adiponectin might induce dysfunctional adipocyte glucose transport.
P
D
E T C E
To determine the impact of adiponectin knockdown on insulin signaling, insulin-induced activation of AKT (a downstream target of insulin signaling) was assessed and expressed as phospho-AKT/total AKT followed by sample/control, since no significant change of AKT activation in basal state was observed (not shown). There was no statistical
N C O
R
R
193 194 195 196
199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219
3.3. Effect of adiponectin deletion on AKT activation in differentiated 220 adipocytes 221
U Q1
Fig. 1. Adiponectin mRNA expression in non-target and adiponectin (AND) siRNA transfected adipocytes. 3T3-L1 adipocytes were transfected with non-target (lanes 1 and 2) or adiponectin target siRNA (lanes 3 and 4), and treated with (lanes 2 and 4) or without insulin (24 h, 100 nM; lanes 1 and 3). mRNA level was expressed as adiponectin/β-actin. Results are presented as means ± SEM. Significant differences are indicated by different letters (a, b, c) (p b 0.05).
191 192
3.2. Effect of ADN siRNA mediated adiponectin downregulation on glucose 197 uptake in 3T3-L1 adipocytes 198
R O
189 190
insulin treatment (24 h, 100 nM, Fig. 1C, column 2) significantly reduced mRNA expression of adiponectin compared to untreated control adipocytes in non-target siRNA transfected adipocytes (Fig. 1C, column 1), which was not observed in ADN siRNA-transfected cells (Fig. 1C, columns 3 & 4). Thus, mRNA level was dependent on insulin sensitivity in non-target siRNA transfected adipocytes.
F
182
using PASW Statistics 18 (SPSS Inc., Chicago, IL, USA). Differences among groups were determined using a Student's t-test or one-way ANOVA procedure for the multiple comparisons followed by Student– Newman–Keul post-hoc tests. Statistical significance was defined as p b 0.05 level.
O
178 179
3
Fig. 2. Adiponectin deletion decreases insulin-stimulated glucose uptake in insulinresponsive adipocytes. Differentiated 3T3-L1 adipocytes were treated with (columns 3, 4, 7, and 8) or without 100 nM insulin (24 h; columns 1, 2, 5, and 6) to induce adipocyte insulin resistance (A). Insulin stimulation was followed by incubation with insulin (30 min, 100 nM; columns 2, 4, 6, and 8). Each value was subtracted from 20 μM cytochalasin B treated samples to delete nonspecific glucose uptake. Results are expressed as percent of basal glucose uptake. Bars with an asterisk (**) are different from basal glucose uptake (p b 0.01). Different letters (a, b, c) indicate statistically different insulin-stimulated glucose uptakes (p b 0.05).
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
222 223 224 225 226
4
F
O
R O
247 248
P
245 246
D
243 244
E
241 242
Chronic exposure of insulin to differentiated 3T3-L1 adipocytes significantly suppressed IRS-1 protein level in adiponectin abundant adipocytes (Fig. 4B, column 2) which did not occur in adiponectin knockdown cells (Fig. 4B, column 4). Adiponectin deficiency significantly decreased IRS-1 protein level, but not mRNA abundance (Fig. 4B & C, column 3). There was no change in GLUT1 expression due to prolonged insulin incubation and/or ADN siRNA transfection (Fig. 4D, E and F). In addition, mRNA and protein abundance of GLUT4 were decreased by 63% (Fig. 4H, column 3) and 50% (Fig. 4I, column 3) in adiponectindeleted adipocytes, respectively. Adiponectin-deficient adipocytes treated with chronic insulin induced a significant decrease in GLUT4 mRNA (Fig. 4I, column 4) but not protein levels (Fig. 4H, column 4).
T
239 240
257 258
C
237 238
3.4. Adiponectin down-regulation alters protein and mRNA expression in insulin signaling pathway
E
236
R
235
R
234
O
233
The distribution of GLUT4 between the plasma membrane and the intracellular compartments affects the rate of glucose uptake during insulin stimulation in adipocytes. To determine whether the decrease in insulin-stimulated glucose uptake in adiponectin-ablated adipocytes was due to suppression of GLUT4 translocation to the cell surface, plasma membrane and intracellular membrane were prepared to assess GLUT4 expression. On insulin stimulation, prolonged insulin incubation in non-target siRNA transfected 3T3-L1 adipocytes significantly decreased GLUT4 levels in plasma membrane by 25% (Fig. 5B, column 2), but increased its abundance in intracellular fraction by 27% (Fig. 5C, column 2). It demonstrates that chronic insulin treatment inhibits the release of GLUT4 from releasing from the static storage compartment to plasma membrane. In the state of insulin sensitivity, adiponectin deletion significantly reduced plasma membrane GLUT4 by 12% (Fig. 5B, column 3) and increased intracellular GLUT4 by compared to control cells (Fig. 5C, column 3). Insulin resistance further altered GLUT4 expression in plasma membrane and intracellular compartments in adiponectin-deleted adipocytes (Fig. 5B & C, column 4). These results demonstrate that adiponectin-mediated glucose uptake is involved in not only total GLUT4 quantity, but also translocation to cell surface in response to insulin.
C
231 232
3.5. Adiponectin ablation in 3T3-L1 adipocyte decreases insulin-induced 249 GLUT4 translocation to the cell surface 250
N
229 230
difference in insulin stimulated-AKT activation between non-target siRNA-transfected adipocytes (control) and adiponectin deficient adipocytes (Fig. 3B, columns 1 & 3). Regardless of the presence or absence of adiponectin, insulin resistance did not induce any change in insulinstimulated AKT activity (Fig. 3B, columns 2 & 4). This demonstrates that the inhibitory effect of adiponectin knockdown on insulinstimulated glucose uptake in insulin-sensitive adipocytes was not associated with AKT activation.
U
227 228
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
Fig. 3. Adiponectin deficiency does not change insulin-stimulated AKT activity. 3T3-L1 cells were transfected with non-target (lanes 1, 2, 3 and 4) or ADN siRNA (lanes 5, 6, 7, and 8). Chronic insulin (24 h, 100 nM) was administered (lanes 3, 4, 7, and 8); then cells were stimulated by insulin for 30 min (lanes 2, 4, 6 and 8). Cell lysates were probed for phospho-AKT and total AKT using Western blotting. Representative blots of phospho-AKT in upper panel and total AKT in lower panel are shown (A). Density of signal (B) was quantified and expressed as insulinstimulated phospho-AKT/total AKT followed by sample/control (mean ± SEM). Bars with different letters (a, b) differ among groups (p b 0.05).
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
251 252 253 254 255 256
259 260 261 262 263 264 265 266 267 268 269 270 271
5
N C O
R
R
E
C
T
E
D
P
R O
O
F
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
U
Fig. 4. Adiponectin deletion alters insulin signaling pathway expression. 3T3-L1 adipocytes were treated with (lanes 2 and 4) or without insulin (24 h, 100 nM; lanes 1 and 3). Western blot and RT-PCR were conducted for IRS-1, GLUT1 and GLUT4 (A, D, and G. representative blots; B, E, and H. quantification of protein level; and C, F, and I. mRNA expression). Protein and mRNA abundance were normalized to β-actin expression. Bars with different letters (a, b, c, d) show statistical difference among groups (p b 0.05).
272 273
3.6. Adiponectin deficiency in adipocytes did not alter p38MAPK activation, but decreased AMPK activation
274
To investigate the influence of adiponectin downstream effectors on adipocyte insulin signaling, phosphorylation and total forms of AMPK and p38MAPK were analyzed. Compared to the lack of adiponectindeletion effect observed on p38MAPK activation (Fig. 6A and B), ADN siRNA transfection significantly decreased the activation of AMPK in differentiated adipocytes by 20% (Fig. 6D, column 3). However, there was no further impact of insulin resistance on AMPK activation in adiponectin-deleted adipocytes (Fig. 6D, column 4).
275 276 277 278 279 280 281
4. Discussion
282
Adipose tissue exhibits dynamic growth during the progression of obesity: hyperplasia (increase in cell number) and hypertrophy (enlarged cell size). In response to energy balance, adipocytes produce and secrete various peptides. Adiponectin, one of these adipocytederived peptides, has been shown to be a potential key mediator of glucose and fat homeostasis in obesity and insulin resistance states [12,30]. The consequences of reduced adiponectin level and its insulinsensitizing property for obese and diabetic subjects point to a possible strategy for diabetic treatment [12]. However, the autocrine actions
283 284
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
285 286 287 288 289 290 291
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
P
R O
O
F
6
E
D
Fig. 5. Downregulation of adiponectin reduces insulin-induced GLUT4 translocation in adipocytes. Non-target (lanes 1, 2, 3 and 4) or ADN siRNA transfected adipocytes (lanes 5, 6, 7, and 8) were separated to the plasma membrane (B) and the intracellular membrane (C) after insulin stimulation (lanes 2, 4, 6, and 8) followed by chronic insulin treatment (lanes 3, 4, 7, and 8). Cell lysates were probed for GLUT4 and β-actin. Representative blots of GLUT4 in plasma membrane (upper panel), intracellular membrane (middle panel) and β-actin (lower panel) are shown (A). Signal density was quantified and expressed as insulin-stimulated GLUT4 expression/basal GLUT4 level followed by sample/control (B and C). *p b 0.05, **p b 0.01 compared to insulin sensitive non-targeted siRNA transfected adipocytes. #p b 0.05, ##p b 0.01 compared between insulin sensitive and insulin resistant ADN-siRNA transfected adipocytes.
U
N
C
O
R
R
E
C
T
and functions of adiponectin for adipocyte insulin signaling and glucose transport have not been fully determined. In the present study, chronic insulin treatment induced reduction of adiponectin mRNA expression and glucose uptake in parallel with downregulation in adipocyte insulin signaling pathway. However, there was no further impact of adiponectin deletion on insulin-resistant adipocytes. Adiponectin deficiency reduced insulin-stimulated glucose uptake and regulatory mediators in adipocyte insulin signaling pathway, concurrently with reduction of AMPK activation only in insulin-responsive 3T3-L1 adipocytes. Regarding decreased adiponectin level in the state of insulin resistance, adipose tissue adiponectin mRNA levels are negatively correlated with insulin sensitivity [7,13,35]. Consistent with these data, in the present study, insulin resistance leads to decreased adiponectin mRNA expression in 3T3-L1 adipocytes (Fig. 1). Significant reduction in insulinstimulated glucose uptake by adiponectin siRNA transfection (Fig. 2) is consistent with previous studies indicating that adipocyte adiponectin ablation or administration regulates glucose homeostasis. Adiponectin deficiency in 3T3-L1 adipocytes via adenovirus-expressing short hairpin RNA against adiponectin reduced glucose uptake rate [17]. A 2 h incubation with globular adiponectin in primary rat adipocytes enhanced glucose uptake to 82% compared to basal rate [31]. Regarding adiponectinmediated insulin signaling pathway, adiponectin directly targets IRS-1 rather than the insulin receptor (IR) [29]. We also found no distinguishable change in IR expression (data not shown). ADN-siRNA transfection significantly reduces IRS-1 abundance in insulin-responsive adipocytes (Fig. 4). The main docking protein IRS-1 for IR plays a pivotal role in insulin mediation of glucose uptake in adipocytes [24]. Decreased IRS-1 content is associated with insulin resistance and type 2 diabetes [6,15, 23], as well as decreased IRS-1 phosphorylation [5,27]. A previous report using short hairpin RNA-mediated adiponectin decreased IRS-1 tyrosine phosphorylation [17]. Moreover, administration of globular adiponectin to lipotropic mice improved insulin sensitivity by enhancing insulinstimulated tyrosine phosphorylation of IRS-1 in muscle [35]. In C2C12 myotubes, adiponectin treatment reduces IRS-1 phosphorylation at Ser636/639, which inhibits the subsequent insulin-stimulated tyrosine
Fig. 6. Adiponectin ablation decreases AMPK activation, but not p38MAPK. Activation of p38MAPK and AMPK is expressed as phospho-protein/total protein (B and D) in nontarget (lanes 1, 2, 3, and 4) or ADN siRNA transfected 3T3-L1 adipocytes (lanes 5, 6, 7, and 8). Insulin (lanes 3, 4, 7 and 8) was administered for 24 h to induce insulin resistance, and then cells were stimulated with 30 min insulin treatment (lanes 2, 4, 6, and 8). Representative blots of phospho-p38MAPK (upper panel) and p38MAPK (lower panel) in left side (A), and phospho-AMPK (upper panel) and AMPK (lower panel) in right side (C) are shown. Results are expressed as mean ± SEM. Statistical differences are represented as different letters (a, b) (p b 0.05).
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392
Insulin sensitizing effects of adiponectin were mostly elucidated in peripheral tissues such as muscle and liver. However, autocrine effects of adiponectin on adipocyte glucose uptake and insulin signaling have not been fully elucidated. In the present study, adiponectin deletion impairs insulin signaling, concurrently with reduced AMPK activation in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes. There was no further impact of insulin resistance on insulin signaling in adiponectin-deleted adipocytes. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.lfs.2015.02.013.
403
Conflict of interest statement
413
O
F
402
R O
346 347
5. Conclusion
P
344 345
393 394
The authors declare that there is no conflict of interest.
D
342 343
regulated by adiponectin deletion, and that result in the improvement of adipocyte insulin signaling and whole body glucose metabolism are needed. For the first time, this study indicated that adiponectin deficiency reduced insulin-stimulated glucose uptake, IRS-1 abundance, and total and plasma membrane GLUT4 protein expression accompanied with reduced AMPK activation only in insulin-responsive adipocytes. Taken together, decreased adipocyte adiponectin caused by insulin resistance may be a therapeutic target for the treatment of type 2 diabetes.
395 396 397 398 399 400 401
404 405 406 407 408 409 410 411 412
414
Acknowledgments
415
This work was supported by a grant from the Korea Institute of Medicine (http://www.kiom.org). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
416 Q5 417
References
420
[1] A.H. Berg, T.P. Combs, X. Du, M. Brownlee, P.E. Scherer, The adipocyte-secreted protein Acrp30 enhances hepatic insulin action, Nat. Med. 7 (8) (2001) 947–953. [2] E. Carvalho, P.A. Jansson, I. Nagaev, A.-M. Wenthzel, U. Smith, Insulin resistance with low cellular IRS-1 expression is also associated with low GLUT4 expression and impaired insulin-stimulated glucose transport, FASEB J. 15 (6) (2001) 1101–1103. [3] T.P. Combs, A.H. Berg, S. Obici, P.E. Scherer, L. Rossetti, Endogenous glucose production is inhibited by the adipose-derived protein Acrp30, J. Clin. Invest. 108 (12) (2001) 1875–1881. [4] T.P. Combs, U.B. Pajvani, A.H. Berg, Y. Lin, L.A. Jelicks, M. Laplante, et al., A transgenic mouse with a deletion in the collagenous domain of adiponectin displays elevated circulating adiponectin and improved insulin sensitivity, Endocrinology 145 (1) (2004) 367–383. [5] K. Cusi, K. Maezono, A. Osman, M. Pendergrass, M.E. Patti, T. Pratipanawatr, et al., Insulin resistance differentially affects the PI 3-kinase- and MAP kinase-mediated signaling in human muscle, J. Clin. Invest. 105 (3) (2000) 311–320. [6] A. Danielsson, A. Ost, E. Lystedt, P. Kjolhede, J. Gustavsson, F.H. Nystrom, et al., Insulin resistance in human adipocytes occurs downstream of IRS1 after surgical cell isolation but at the level of phosphorylation of IRS1 in type 2 diabetes, FEBS J 272 (2005) 141–151. [7] M. Fasshauer, J. Klein, S. Neumann, M. Eszlinger, R. Paschke, Hormonal regulation of adiponectin gene expression in 3T3-L1 adipocytes, Biochem. Biophys. Res. Commun. 290 (2002) 1084–1089. [8] J.M. Friedman, Obesity in the new millennium, Nature 404 (6778) (2000) 632–634. [9] J. Fruebis, T.S. Tsao, S. Javorschi, D. Ebbets-Reed, M.R.S. Erickson, F.T. Yen, et al., Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice, Proc. Natl. Acad. Sci. U. S. A. 98 (4) (2001) 2005–2010. [10] Y. Fu, N. Luo, R.L. Klein, W.T. Garvey, Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation, J. Lipid Res. 46 (7) (2005) 1369–1379. [11] A. Hammarstedt, T.E. Graham, B.B. Kahn, Adipose tissue dysregulation and reduced insulin sensitivity in non-obese individuals with enlarged abdominal adipose cells, Diabetol. Metab. Syndr. 4 (1) (2012) 42. [12] K. Hotta, T. Funahashi, Y. Arita, M. Takahashi, M. Matsuda, Y. Okamoto, et al., Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients, Arterioscler. Thromb. Vasc. Biol. 20 (6) (2000) 1595–1599. [13] P.A. Kern, G.B. Di Gregorio, T. Lu, N. Rassouli, G. Ranganathan, Adiponectin expression from human adipose tissue: relation to obesity, insulin resistance, and tumor necrosis factor-alpha expression, Diabetes 52 (2003) 1779–1785.
421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459
E
340 341
T
338 339
C
336 337
E
334 335
R
333
R
331 332
N C O
329 330
phosphorylation of IRS-1 by the IR and following insulin signaling [29]. In the present study, chronic insulin treatment (24 h, 100 nM) increased IRS-1 serine phosphorylation despite of small sample size (n = 1). Moreover, IRS-1 serine phosphorylation at serine636/639 was increased in adiponectin deletion. No further influence of insulin resistance on IRS-1 serine phosphorylation was observed in adiponectin deficient adipocytes (Supplementary Fig. 1). Insulin resistance further altered GLUT4 expression in plasma membrane and intracellular compartments in adiponectin-deleted adipocytes there was no further impact of insulin resistance on AMPK activation in adiponectin-deleted adipocytes. AKT, another major downstream target of insulin signaling, also elicits several insulin-mediated metabolic actions [21]. Phosphorylation of AKT substrates and AKT activity is remarkably decreased in type 2 diabetes [16]. This study's in vitro cell culture model revealed that chronic insulin treatment decreased insulin-stimulated glucose uptake accompanied by AKT activation, representing insulin resistant state in adipocytes. However, adiponectin deletion did not result in further AKT activation compared to non-target siRNA transfected controls (Fig. 3). These results suggest that AKT signaling is not involved in adiponectin ablation-induced reduction in insulin-stimulated glucose transport. Maintenance of glucose homeostasis is mediated by insulin-stimulated glucose transport. In this process, GLUT4 has a prominent role in glucose clearance, and GLUT1 plays a minor role, mostly for glucose uptake during non-insulin stimulation [21]. In insulin resistant states including obesity and type 2 diabetes, GLUT4 expression in adipocytes is reduced [2,11]. Overexpression of GLUT4 in adipose tissue results in improved glucose tolerance [26]. In our study, ADN siRNA-transfected adipocytes in the state of insulin sensitivity significantly decreased not only GLUT4 mRNA and protein abundance (Fig. 4), but also insulin-induced translocation of GLUT4 to the plasma membrane; however, there was no statistical change in GLUT1 expression (Fig. 5). Taken together, changes in IRS-1 and GLUT4 expression and GLUT4 translocation to the plasma membrane may play a role in glucose transport in adiponectin-lacking adipocytes. With respect to the molecular mechanisms underlying the insulinsensitizing effects of adiponectin, a growing body of evidence suggests adiponectin activates intracellular signaling pathways via activation of AMPK and p38MAPK in skeletal muscle cells [32,33,36]. Stimulation of glucose utilization and fatty acid oxidation by adiponectin is mediated by AMPK and p38MAPK [28,34,36]. Overexpression of dominantnegative AMPK, but not p38MAPK in C2C12 myotubes reduced the insulin-sensitizing effects of adiponectin [29]. Moreover, dominantnegative AMPK blocking of AMPK activation inhibits adiponectininduced insulin-sensitizing effects; therefore the actions of adiponectin occur through an AMPK-dependent mechanism [33,34]. In not only muscle cells, but also rat primary adipocytes, enhanced glucose uptake due to treatment with globular adiponectin was dependent on AMPK activation [31]. Our results demonstrate that adiponectin deletion significantly reduced AMPK activation, but not p38MAPK in insulinresponsive 3T3-L1 adipocytes. Moreover, insulin resistance decreased AMPK activation, which was not altered by adiponectin ablation (Fig. 6). Our current study has limitations. First, adiponectin deletion, per se decreases insulin sensitivity. ADN-siRNA transfection might be not appropriate especially in insulin resistant adipocyte, suggesting a method of adiponectin overexpression needs to be considered in following studies. Second, molecular mechanisms by which decreased IRS-1 level but no alteration of AKT activation in ADN knockout adipocytes have not been fully determined. With low physiological level of insulin (10 nM), IRS-1 tyrosine and serine phosphorylation and its-associated docking proteins and downstream signaling including phosphorylation of AKT at both sites of serine473 and threonine308 needs to be elucidated in ADN-ablated adipocytes. In addition, more sensitive methodology to measure insulin-induced GLUT4 translocation in plasma membrane needs to be taken into consideration, since there is discrepancy between glucose uptake and GLUT4 level in plasma membrane. In addition, further studies investigating AMPK subunits and/or adiponectin receptors
U
327 328
7
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
418 419
P
R O
O
F
[26] P.R. Shepherd, L. Gnudi, E. Tozzo, H. Yang, F. Leach, B.B. Kahn, Adipose cell hyperplasia and enhanced glucose disposal in transgenic mice overexpressing GLUT4 selectively in adipose tissue, J Biol Chem 268 (30) (1993) 22243–22246. [27] H. Storgaard, X.M. Song, C.B. Jensen, S. Madsbad, M. Björnholm, A. Vaag, et al., Insulin signal transduction in skeletal muscle from glucose-intolerant relatives with type 2 diabetes, Diabetes 50 (12) (2001) 2770–2778. [28] E. Tomas, T.S. Tsao, A.K. Saha, H.E. Murrey, C.C. Zhang, S.I. Itani, et al., Enhanced muscle fat oxidation and glucose transport by ACRP30 globular domain: acetyl– CoA carboxylase inhibition and AMP-activated protein kinase activation, Proc. Natl. Acad. Sci. U. S. A. 99 (25) (2002) 16309–16313. [29] C. Wang, X. Mao, L. Wang, M. Liu, M.D. Wetzel, K.L. Guan, et al., Adiponectin sensitizes insulin signaling by reducing p70 S6 kinase-mediated serine phosphorylation of IRS-1, J Biol Chem 282 (11) (2007) 7991–7996. [30] C. Weyer, T. Funahashi, S. Tanaka, K. Hotta, Y. Matsuzawa, R.E. Pratley, et al., Hypoadiponectinemia in obesity and type 2 diabetes: close association with insulin resistance and hyperinsulinemia, J Clin Endocrinol Metab 86 (5) (2001) 1930–1935. [31] X. Wu, H. Motoshima, K. Mahadev, T.J. Stalker, R. Scalia, B.J. Goldstein, Involvement of AMP-activated protein kinase in glucose uptake stimulated by the globular domain of adiponectin in primary rat adipocytes, Diabetes 52 (6) (2003) 1355–1363. [32] X. Xin, L. Zhou, C.M. Reyes, F. Liu, L.Q. Dong, APPL1 mediates adiponectin-stimulated p38 MAPK activation by scaffolding the TAK1-MKK3-p38 MAPK pathway, Am J Physiol Endocrinol Metab 300 (1) (2011) (E103-E10). [33] T. Yamauchi, J. Kamon, Y. Ito, A. Tsuchida, T. Yokomizo, S. Kita, et al., Cloning of adiponectin receptors that mediate antidiabetic metabolic effects, Nature 423 (6941) (2003) 762–769. [34] T. Yamauchi, J. Kamon, Y. Minokoshi, Y. Ito, H. Waki, S. Uchida, et al., Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase, Nat. Med. 8 (11) (2002) 1288–1295. [35] T. Yamauchi, J. Kamon, H. Waki, Y. Terauchi, N. Kubota, K. Hara, et al., The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity, Nat. Med. 7 (8) (2001) 941–946. [36] M.J. Yoon, G.Y. Lee, J.J. Chung, Y.H. Ahn, S.H. Hong, J.B. Kim, Adiponectin increases fatty acid oxidation in skeletal muscle cells by sequential activation of AMPactivated protein kinase, p38 mitogen-activated protein kinase, and peroxisome proliferator-activated receptor α, Diabetes 55 (9) (2006) 2562–2570.
N
C
O
R
R
E
C
T
E
[14] E.E. Kershaw, J.S. Flier, Adipose tissue as an endocrine organ, J Clin Endocrinol Metab 89 (6) (2004) 2548–2556. [15] P. Kovacs, R.L. Hanson, Y.H. Lee, X. Yang, S. Kobes, P.A. Permana, et al., The role of insulin receptor substrate-1 gene (IRS1) in type 2 diabetes in Pima Indians, Diabetes 52 (2003) 3005–3009. [16] A. Krook, R.A. Roth, X.J. Jiang, J.R. Zierath, H. Wallberg-Henriksson, Insulinstimulated Akt kinase activity is reduced in skeletal muscle from NIDDM subjects, Diabetes 47 (8) (1998) 1281–1286. [17] K. Li, L. Li, G. Yang, H. Liu, S. Li, G. Boden, Effect of short hairpin RNA-mediated adiponectin/Acrp30 down-regulation on insulin signaling and glucose uptake in the 3T3-L1 adipocytes, J. Endocrinol. Investig. 33 (2) (2010) 96–102. [18] S. Nishiumi, H. Ashida, Rapid preparation of a plasma membrane fraction from adipocytes and muscle cells: application to detection of translocated glucose transporter 4 on the plasma membrane, Biosci. Biotechnol. Biochem. 71 (9) (2007) 2343–2346. [19] K. Ohashi, J.L. Parker, N. Ouchi, A. Higuchi, J.A. Vita, N. Gokce, et al., Adiponectin promotes macrophage polarization toward an anti-inflammatory phenotype, J Biol Chem 285 (9) (2010) 6153–6160. [20] N. Ouchi, S. Kihara, Y. Arita, M. Nishida, A. Matsuyama, Y. Okamoto, et al., Adipocytederived plasma protein, adiponectin, suppresses lipid accumulation and class A scavenger receptor expression in human monocyte-derived macrophages, Circulation 103 (8) (2001) 1057–1063. [21] J.E. Pessin, A.R. Saltiel, Signaling pathways in insulin action: molecular targets of insulin resistance, J. Clin. Invest. 106 (2) (2000) 165–169. [22] E. Ravussin, S.R. Smith, Increased fat intake, impaired fat oxidation, and failure of fat cell proliferation result in ectopic fat storage, insulin resistance, and type 2 diabetes mellitus, Ann. N. Y. Acad. Sci. 967 (2002) 363–378. [23] C.M. Rondinone, L.M. Wang, P. Lonnroth, C. Wesslau, J.H. Pierce, U. Smith, Insulin receptor substrate (IRS) 1 is reduced and IRS-2 is the main docking protein for phosphatidylinositol 3-kinase in adipocytes from subjects with non-insulin-dependent diabetes mellitus, Proc. Natl. Acad. Sci. U. S. A. 94 (8) (1997) 4171–4175. [24] A.R. Saltiel, J.E. Pessin, Insulin signaling pathways in time and space, Trends Cell Biol. 12 (2) (2002) 65–71. [25] P.E. Schwarz, G.W. Towers, S. Fischer, S. Govindarajalu, J. Schulze, S.R. Bornstein, et al., Hypoadiponectinemia is associated with progression toward type 2 diabetes and genetic variation in the ADIPOQ gene promoter, Diabetes Care 29 (7) (2006) 1645–1650.
U
460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 532
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
D
8
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531
Contents lists available at ScienceDirect
Life Sciences journal homepage: www.elsevier.com/locate/lifescie
F
O
4
Eugene Chang a, Jung Mook Choi b, Se Eun Park c, Eun-Jung Rhee c, Won-Young Lee c, Ki Won Oh c, Sung Woo Park c, Cheol-Young Park b,c,⁎
5 6 7
a
8
a r t i c l e
9 10 11 12 13
Article history: Received 15 September 2014 Received in revised form 27 January 2015 Accepted 12 February 2015 Available online xxxx
14 15 16 17 18
Keywords: Adipocytes Adiponectin Insulin signaling Insulin resistance
Department of Nutritional Science and Food Management, Ewha Womans University, Seoul, Republic of Korea Diabetes Research Institute, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Republic of Korea Division of Endocrinology and Metabolism, Department of Endocrinology and Metabolism, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Republic of Korea
i n f o
a b s t r a c t
Aims: Previous reports have demonstrated that the adipocyte-derived peptide adiponectin is closely associated with insulin resistance due to its insulin-sensitizing and anti-inflammatory properties in peripheral tissues; however the autocrine effects of adiponectin remain elusive. This study investigated regulatory effects of adiponectin on glucose transport and insulin signaling in insulin-sensitive or insulin-resistant 3T3-L1 adipocytes. Main methods: 3T3-L1 fibroblasts were transfected with non-target or adiponectin (ADN) siRNA and differentiated. Chronic treatment with insulin (24 h, 100 nM) was employed to induce insulin resistance in differentiated adipocytes. Insulin-stimulated glucose transport was measured and protein and mRNA levels were assessed by Western blot and RT-PCR. Key findings: Prolonged incubation with insulin significantly reduced insulin-stimulated glucose uptake, suggesting the development of insulin resistance and adiponectin mRNA expression. In this insulin-resistant condition, adiponectin deletion did not alter insulin-stimulated glucose uptake. In insulin-sensitive adipocytes, adiponectin ablation reduced insulin-stimulated glucose uptake, expression of IRS-1 and GLUT4, and GLUT4 translocation to the membrane. Adiponectin knockdown did not affect the activation of AKT and p38MAPK (phosphorylation form/total form), but significantly decreased the activation of AMPK in insulin-responsive adipocytes. Significance: Adiponectin deficiency suppresses insulin-induced glucose uptake, insulin signaling, and the AMPK pathway only in insulin-responsive 3T3-L1 adipocytes. © 2015 Published by Elsevier Inc.
E
E
C
c
T
b
R O
3Q3
P
2
Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes
D
1Q2
R
35 39 37 36
R
38
1. Introduction
41
The dramatically increased prevalence of obesity is closely associated with features of the metabolic syndrome, including type 2 diabetes, dyslipidemia, hypertension, and heart disease [8]. Obesity and type 2 diabetes are associated with alterations in adipose tissue size and function. During energy surplus, adipose tissue expands to store excess energy and the synthesis and release of adipocyte-derived factors regulating insulin sensitivity are altered [14,22]. Of these, adiponectin (ADN, also known as ACRP30 and gelatin-binding protein-28) is the most abundant circulating adipokine. Plasma adiponectin levels are reduced in obesity and type 2 diabetes [12,30]. Moreover, genetic variation in the ADIPOQ gene promoter is associated with the development of
46 47 48 49 50 51
U
44 45
N C O
40
42 43
19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34
⁎ Corresponding author at: Diabetes Research Institute & Division of Endocrinology and Metabolism, Department of Internal Medicine, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, No. 108, Pyung-Dong, Jongno-Ku, Seoul 110-746, Republic of Korea. Tel.: +82 2 2001 1869; fax: +82 2 2001 1588. E-mail address: [email protected] (C.-Y. Park).
type 2 diabetes [25]. Hypoadiponectinemia is considered to be an independent risk factor for the progression of type 2 diabetes [12]. Thus, targeting adiponectin has been regarded as a therapeutic tool for treating type 2 diabetes and metabolic syndrome [1,3,9,35]. Adiponectin exerts its insulin-sensitizing and other beneficial metabolic effects by inhibiting hepatic gluconeogenesis [1] and increasing fatty acid oxidation [9,35] via the activation of AMP-activated protein kinase (AMPK) and peroxisome proliferator-activated receptor α (PPARα) [36], and the inhibition of acetyl coenzyme A carboxylase (ACC) [28,34,36] in liver and muscle. Moreover, its anti-inflammatory effects result from decreased migration of macrophages and foam cells across the vascular wall [20] and macrophage polarization [19]. Previous studies examining the autocrine effects of adiponectin on adipocyte biology show that overexpression of adiponectin in adipocytes enhances insulin sensitivity by modulating proliferation, differentiation, and lipid accumulation [10]. Globular adiponectin treatment in primary rat adipocytes increases insulin-stimulated glucose uptake via activation of AMPK [31]. In addition, fat tissue-specific overexpression of adiponectin further increases circulating adiponectin levels, and
http://dx.doi.org/10.1016/j.lfs.2015.02.013 0024-3205/© 2015 Published by Elsevier Inc.
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70
81 82
93
Murine 3T3-L1 cells obtained from American Type Culture Collection (ATCC CL-173; Manassas, VA, USA) were maintained in high glucose (HG)-DMEM (Gibco, Grand Island, NY, USA), 10% bovine calf serum (Gibco), 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco) at 37 °C in 95% air and 5% CO2. After 2 days post-confluence (day 0), adipocyte differentiation was induced by adding a cocktail composed of 520 μM isobutylmethylxanthine (Sigma, St. Louis, MO, USA), 1 μM dexamethasone (Sigma, St. Louis, MO, USA), and 1 μg/mL bovine insulin (Sigma, St. Louis, MO, USA) to 10% fetal bovine serum (FBS) contained HG-DMEM. After 48 h, medium was replaced with HG-DMEM containing 10% FBS, antibiotics and insulin. Until more than 95% of the cells contained lipid droplets, the medium was renewed every two days with HG-DMEM containing 10% FBS.
94
2.2. RNA interference
95
104 105
All RNAi constructs and reagents were obtained from Thermo Scientific Dharmacon (Pittsburgh, PA, USA). 3T3-L1 fibroblasts were transfected with adiponectin siRNA (ADN siRNA, ON-TARGETplus SMARTpool) consisting of a mixture of four unique siRNAs using DharmaFECT transfection reagent. As control, non-target siRNA (Dharmacon's non-target siRNA pool of four) was used. After 24-h incubation, differentiation was induced as described above. Differentiated adipocytes were treated with insulin (24 h, 100 nM) to induce insulin resistance. Insulin stimulation was followed by treatment with insulin (30 min, 100 nM) for the assays of glucose transport and protein expression.
106
2.3. Determination of insulin-stimulated glucose uptake
107
119 120
Differentiated 3T3-L1 adipocytes incubated with or without chronic insulin (24 h, 100 nM) on 12-well tissue culture plates were washed with sterile PBS twice and incubated in serum-free HG-DMEM for 6 h prior to uptake experiments. Cells were pretreated with insulin (30 min, 100 nM) followed by incubation for 10 min in PBS containing 100 μM unlabeled 2-deoxyglucose and 1 μCi/mL 2-deoxy-[3H]-glucose (PerkinElmer, MA, USA). The reaction was terminated by washing three times with ice-cold 0.2 N NaOH solution. Nonspecific uptake was determined in the presence of 20 μM cytochalasin B. Cellassociated radioactivity was determined by lysing cells with 1% SDS, followed by liquid scintillation counting. Results were expressed as percent of basal glucose rate in non-target siRNA transfected cells. Insulin-stimulated glucose transport was expressed as percent of basal glucose uptake in non-target siRNA transfected adipocytes.
121
2.4. Reverse transcription and quantitative RT-PCR
122
Total RNA was purified using RNeasy Mini Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. For cDNA preparation, the high-capacity cDNA Kit (Applied Biosystems, Foster City, CA, USA) was utilized, and the reaction was performed at 37 °C for 60 min and subsequently incubated at 95 °C for 5 min. Primers used are shown in Table 1. RT-PCR was carried out using Roche real-time PCR
102 103
108 109 110 111 112 113 114 115 116 117 118
123 124 125 126 127
C
100 101
E
98 99
R
96 97
R
91 92
O
89 90
C
87 88
N
85 86
U
83 84
t1:3
ccaccgatccacacagagta ctttcctgccaggggttc agaggggcagtcctgagagt ccagtgttatagccgaactgc gccacgatggagacatagc
t1:4 t1:5 t1:6 t1:7 t1:8
actgctctggctcctagcac agggagagaaaggagatgcag aaggagtcggctccagtgt atggatcccagcagcaag gacggacactccatctgttg
master mix with UPL and Roche LightCycler 480 (Roche, Mannheim, Germany) as follows: one cycle of pre-denaturation at 95 °C for 10 min, followed by 45 cycles of denaturation at 95 °C for 10 s, and annealing and extension at 60 °C for 20 s. Each target gene was normalized to that of β-actin and expressed as fold change compared to controls.
128
133
F
2.1. Cell culture
Reverse primer
NM_007393.3 NM_009605.4 NM_010570.4 NM_011400.3 NM_009204.2
O
80
77
Accession number Forward primer
β-Actin Adiponectin IRS-1 GLUT1 GLUT4
2.5. Western blot analysis
129 130 131 132
Differentiated adipocytes were washed in ice-cold PBS and lysed in RIPA lysis buffer (Amresco, Solon, OH, USA) including protease inhibitor and phosphatase inhibitor cocktails (Sigma, St. Louis, MO, USA). Protein concentrations were determined by BCA assay (Pierce, Rockford, IL, USA). Equal protein aliquots of 3T3-L1 lysates were loaded to 4–20% gradient SDS-PAGE gels (Bio-rad, Hercules, CA, USA), separated by electrophoresis, and then transferred to PVDF membrane (Millipore, Marlborough, MA, USA). Membranes were blocked in 5% non-fat dry milk in TBST (0.05% Tween 20, 50 mM Tris–HCL, pH 7.5 and 150 mM NaCl) for 1 h at room temperature then incubated overnight with primary antibodies in blocking buffer at 4 °C. The following primary antibodies were used: phospho-protein kinase B (serine/threonine-specific protein kinase (phospho-AKT); Ser473), total AKT, insulin receptor substrate-1 (IRS-1), glucose transporter (GLUT)1, GLUT4, phospho-AMPK, total AMPK, phospho-p38 mitogen-activated protein kinases (phosphop38MAPK), total p38MAPK, and β-actin (Cell Signaling Technology, MA, USA). After washing, secondary antibodies were employed for 1 h at room temperature, and membranes were developed using Amersham ECL plus system (Amersham-Pharmacia Biotech, Arlington Heights, IL, USA). Density of immunoreactive bands was determined using Geliance Imaging software (PerkinElmer Life and Analytical Sciences, Boston, MA, USA). Results were expressed as fold change compared to control or as the ratio of phospho-protein to total protein.
134
2.6. 3T3-L1 cell membrane fractionation and GLUT4 detection
157
The preparation of plasma membrane and post-plasma membrane was completed as described previously [18]. 3T3-L1 adipocytes were rinsed with Buffer A (50 mM Tris, pH 8.0, and 0.5 mM dithiothreitol) including protease and phosphatase inhibitors, and homogenized with a Teflon pestle and 25-gauge needle. Total membranes were pelleted at 1000 ×g for 10 min twice, and resuspended in Buffer A including protease and phosphatase inhibitors. After centrifugation at 16,000 ×g for 20 min at 4 °C, the supernatant was saved as plasma membrane. The cytosolic supernatants from the first and the second 1000 ×g centrifugation were gathered and centrifuged at 16,000 ×g for 20 min at 4 °C. The supernatant was used as intracellular membrane. Protein quantification for all fractions was determined by BCA method as described above. To detect GLUT4, Western blots were conducted. GLUT4 abundance in plasma membrane and intracellular fraction was expressed as insulin-stimulated GLUT4 expression/basal GLUT4 level followed by sample/control (non-targeted siRNA transfected adipocytes in a state of insulin sensitivity).
158 159
2.7. Statistical analysis
175
R O
2. Materials and methods
75 76
Gene
P
79
73 74
t1:1 t1:2
Table 1 Characteristics of the specific primers used for RT-PCR.
T
78
improved insulin sensitivity [4]. However, autocrine effects of adiponectin on glucose transport and insulin signaling according to the different insulin sensitivity in adipocytes remain less clear. To clarify autocrine function of adiponectin, this study investigated the effects of siRNA against adiponectin on adipocyte glucose transport and insulin signaling in both insulin-sensitive and insulin-resistant adipocytes. Furthermore, we evaluated the mechanisms of insulinsensitizing effect of adiponectin on adipocyte insulin signaling.
D
71 72
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
E
2
135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156
160 161 162 163 164 165 166 167 168 169 170 171 172 173 174
Data are presented as means ± standard error of mean (SEM) of at 176 Q4 least two independent triplicate experiments. Data were performed 177
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
183
3. Results
184 185
3.1. Effect of adiponectin (ADN) siRNA transfection on adiponectin expression in 3T3-L1 adipocytes
186
The effectiveness of ADN siRNA transfection was assessed by Western blot and RT-PCR. ADN siRNA transfection significantly decreased adiponectin protein abundance (Fig. 1A and B) and mRNA expression (Fig. 1C). Reduced protein and mRNA expression of adiponectin was evidence for the success of ADN siRNA transfection. Interestingly, chronic
180 181
187 188
To investigate the autocrine effects of adiponectin on insulin sensitivity, glucose uptake was first determined in non-target or ADN siRNA-transfected 3T3-L1 cells in insulin-responsive or resistant state. Whereas insulin stimulation (30 min, 100 nM) in non-target siRNA transfected insulin responsive adipocytes significantly increased insulin-induced glucose transport by 421% compared to basal status (Fig. 2A, columns 1 & 2), chronic insulin treatment (24 h, 100 nM) did not induce insulin-stimulated glucose uptake in insulin resistant control cells (Fig. 2, columns 3 & 4), indicating the status of insulin resistance. Basal glucose transport was not significantly different according to insulin sensitivity and/or adiponectin deficiency, however, insulinstimulated glucose transport was influenced by the presence of adiponectin only in insulin-responsive adipocytes. Insulin-stimulated glucose rate was significantly increased by 421% in non-target siRNA transfected cells compared to 316% induction in ADN siRNAtransfected adipocytes (Fig. 2, columns 2 & 6). Thus, adiponectin deletion in 3T3-L1 adipocytes affected insulin-induced glucose uptake. However, there was no alteration in insulin-stimulated glucose uptake between non-target siRNA and ADN siRNA transfected cells in the insulin resistant state (Fig. 2B, columns 4 & 8). This suggests that decreased adiponectin might induce dysfunctional adipocyte glucose transport.
P
D
E T C E
To determine the impact of adiponectin knockdown on insulin signaling, insulin-induced activation of AKT (a downstream target of insulin signaling) was assessed and expressed as phospho-AKT/total AKT followed by sample/control, since no significant change of AKT activation in basal state was observed (not shown). There was no statistical
N C O
R
R
193 194 195 196
199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219
3.3. Effect of adiponectin deletion on AKT activation in differentiated 220 adipocytes 221
U Q1
Fig. 1. Adiponectin mRNA expression in non-target and adiponectin (AND) siRNA transfected adipocytes. 3T3-L1 adipocytes were transfected with non-target (lanes 1 and 2) or adiponectin target siRNA (lanes 3 and 4), and treated with (lanes 2 and 4) or without insulin (24 h, 100 nM; lanes 1 and 3). mRNA level was expressed as adiponectin/β-actin. Results are presented as means ± SEM. Significant differences are indicated by different letters (a, b, c) (p b 0.05).
191 192
3.2. Effect of ADN siRNA mediated adiponectin downregulation on glucose 197 uptake in 3T3-L1 adipocytes 198
R O
189 190
insulin treatment (24 h, 100 nM, Fig. 1C, column 2) significantly reduced mRNA expression of adiponectin compared to untreated control adipocytes in non-target siRNA transfected adipocytes (Fig. 1C, column 1), which was not observed in ADN siRNA-transfected cells (Fig. 1C, columns 3 & 4). Thus, mRNA level was dependent on insulin sensitivity in non-target siRNA transfected adipocytes.
F
182
using PASW Statistics 18 (SPSS Inc., Chicago, IL, USA). Differences among groups were determined using a Student's t-test or one-way ANOVA procedure for the multiple comparisons followed by Student– Newman–Keul post-hoc tests. Statistical significance was defined as p b 0.05 level.
O
178 179
3
Fig. 2. Adiponectin deletion decreases insulin-stimulated glucose uptake in insulinresponsive adipocytes. Differentiated 3T3-L1 adipocytes were treated with (columns 3, 4, 7, and 8) or without 100 nM insulin (24 h; columns 1, 2, 5, and 6) to induce adipocyte insulin resistance (A). Insulin stimulation was followed by incubation with insulin (30 min, 100 nM; columns 2, 4, 6, and 8). Each value was subtracted from 20 μM cytochalasin B treated samples to delete nonspecific glucose uptake. Results are expressed as percent of basal glucose uptake. Bars with an asterisk (**) are different from basal glucose uptake (p b 0.01). Different letters (a, b, c) indicate statistically different insulin-stimulated glucose uptakes (p b 0.05).
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
222 223 224 225 226
4
F
O
R O
247 248
P
245 246
D
243 244
E
241 242
Chronic exposure of insulin to differentiated 3T3-L1 adipocytes significantly suppressed IRS-1 protein level in adiponectin abundant adipocytes (Fig. 4B, column 2) which did not occur in adiponectin knockdown cells (Fig. 4B, column 4). Adiponectin deficiency significantly decreased IRS-1 protein level, but not mRNA abundance (Fig. 4B & C, column 3). There was no change in GLUT1 expression due to prolonged insulin incubation and/or ADN siRNA transfection (Fig. 4D, E and F). In addition, mRNA and protein abundance of GLUT4 were decreased by 63% (Fig. 4H, column 3) and 50% (Fig. 4I, column 3) in adiponectindeleted adipocytes, respectively. Adiponectin-deficient adipocytes treated with chronic insulin induced a significant decrease in GLUT4 mRNA (Fig. 4I, column 4) but not protein levels (Fig. 4H, column 4).
T
239 240
257 258
C
237 238
3.4. Adiponectin down-regulation alters protein and mRNA expression in insulin signaling pathway
E
236
R
235
R
234
O
233
The distribution of GLUT4 between the plasma membrane and the intracellular compartments affects the rate of glucose uptake during insulin stimulation in adipocytes. To determine whether the decrease in insulin-stimulated glucose uptake in adiponectin-ablated adipocytes was due to suppression of GLUT4 translocation to the cell surface, plasma membrane and intracellular membrane were prepared to assess GLUT4 expression. On insulin stimulation, prolonged insulin incubation in non-target siRNA transfected 3T3-L1 adipocytes significantly decreased GLUT4 levels in plasma membrane by 25% (Fig. 5B, column 2), but increased its abundance in intracellular fraction by 27% (Fig. 5C, column 2). It demonstrates that chronic insulin treatment inhibits the release of GLUT4 from releasing from the static storage compartment to plasma membrane. In the state of insulin sensitivity, adiponectin deletion significantly reduced plasma membrane GLUT4 by 12% (Fig. 5B, column 3) and increased intracellular GLUT4 by compared to control cells (Fig. 5C, column 3). Insulin resistance further altered GLUT4 expression in plasma membrane and intracellular compartments in adiponectin-deleted adipocytes (Fig. 5B & C, column 4). These results demonstrate that adiponectin-mediated glucose uptake is involved in not only total GLUT4 quantity, but also translocation to cell surface in response to insulin.
C
231 232
3.5. Adiponectin ablation in 3T3-L1 adipocyte decreases insulin-induced 249 GLUT4 translocation to the cell surface 250
N
229 230
difference in insulin stimulated-AKT activation between non-target siRNA-transfected adipocytes (control) and adiponectin deficient adipocytes (Fig. 3B, columns 1 & 3). Regardless of the presence or absence of adiponectin, insulin resistance did not induce any change in insulinstimulated AKT activity (Fig. 3B, columns 2 & 4). This demonstrates that the inhibitory effect of adiponectin knockdown on insulinstimulated glucose uptake in insulin-sensitive adipocytes was not associated with AKT activation.
U
227 228
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
Fig. 3. Adiponectin deficiency does not change insulin-stimulated AKT activity. 3T3-L1 cells were transfected with non-target (lanes 1, 2, 3 and 4) or ADN siRNA (lanes 5, 6, 7, and 8). Chronic insulin (24 h, 100 nM) was administered (lanes 3, 4, 7, and 8); then cells were stimulated by insulin for 30 min (lanes 2, 4, 6 and 8). Cell lysates were probed for phospho-AKT and total AKT using Western blotting. Representative blots of phospho-AKT in upper panel and total AKT in lower panel are shown (A). Density of signal (B) was quantified and expressed as insulinstimulated phospho-AKT/total AKT followed by sample/control (mean ± SEM). Bars with different letters (a, b) differ among groups (p b 0.05).
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
251 252 253 254 255 256
259 260 261 262 263 264 265 266 267 268 269 270 271
5
N C O
R
R
E
C
T
E
D
P
R O
O
F
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
U
Fig. 4. Adiponectin deletion alters insulin signaling pathway expression. 3T3-L1 adipocytes were treated with (lanes 2 and 4) or without insulin (24 h, 100 nM; lanes 1 and 3). Western blot and RT-PCR were conducted for IRS-1, GLUT1 and GLUT4 (A, D, and G. representative blots; B, E, and H. quantification of protein level; and C, F, and I. mRNA expression). Protein and mRNA abundance were normalized to β-actin expression. Bars with different letters (a, b, c, d) show statistical difference among groups (p b 0.05).
272 273
3.6. Adiponectin deficiency in adipocytes did not alter p38MAPK activation, but decreased AMPK activation
274
To investigate the influence of adiponectin downstream effectors on adipocyte insulin signaling, phosphorylation and total forms of AMPK and p38MAPK were analyzed. Compared to the lack of adiponectindeletion effect observed on p38MAPK activation (Fig. 6A and B), ADN siRNA transfection significantly decreased the activation of AMPK in differentiated adipocytes by 20% (Fig. 6D, column 3). However, there was no further impact of insulin resistance on AMPK activation in adiponectin-deleted adipocytes (Fig. 6D, column 4).
275 276 277 278 279 280 281
4. Discussion
282
Adipose tissue exhibits dynamic growth during the progression of obesity: hyperplasia (increase in cell number) and hypertrophy (enlarged cell size). In response to energy balance, adipocytes produce and secrete various peptides. Adiponectin, one of these adipocytederived peptides, has been shown to be a potential key mediator of glucose and fat homeostasis in obesity and insulin resistance states [12,30]. The consequences of reduced adiponectin level and its insulinsensitizing property for obese and diabetic subjects point to a possible strategy for diabetic treatment [12]. However, the autocrine actions
283 284
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
285 286 287 288 289 290 291
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
P
R O
O
F
6
E
D
Fig. 5. Downregulation of adiponectin reduces insulin-induced GLUT4 translocation in adipocytes. Non-target (lanes 1, 2, 3 and 4) or ADN siRNA transfected adipocytes (lanes 5, 6, 7, and 8) were separated to the plasma membrane (B) and the intracellular membrane (C) after insulin stimulation (lanes 2, 4, 6, and 8) followed by chronic insulin treatment (lanes 3, 4, 7, and 8). Cell lysates were probed for GLUT4 and β-actin. Representative blots of GLUT4 in plasma membrane (upper panel), intracellular membrane (middle panel) and β-actin (lower panel) are shown (A). Signal density was quantified and expressed as insulin-stimulated GLUT4 expression/basal GLUT4 level followed by sample/control (B and C). *p b 0.05, **p b 0.01 compared to insulin sensitive non-targeted siRNA transfected adipocytes. #p b 0.05, ##p b 0.01 compared between insulin sensitive and insulin resistant ADN-siRNA transfected adipocytes.
U
N
C
O
R
R
E
C
T
and functions of adiponectin for adipocyte insulin signaling and glucose transport have not been fully determined. In the present study, chronic insulin treatment induced reduction of adiponectin mRNA expression and glucose uptake in parallel with downregulation in adipocyte insulin signaling pathway. However, there was no further impact of adiponectin deletion on insulin-resistant adipocytes. Adiponectin deficiency reduced insulin-stimulated glucose uptake and regulatory mediators in adipocyte insulin signaling pathway, concurrently with reduction of AMPK activation only in insulin-responsive 3T3-L1 adipocytes. Regarding decreased adiponectin level in the state of insulin resistance, adipose tissue adiponectin mRNA levels are negatively correlated with insulin sensitivity [7,13,35]. Consistent with these data, in the present study, insulin resistance leads to decreased adiponectin mRNA expression in 3T3-L1 adipocytes (Fig. 1). Significant reduction in insulinstimulated glucose uptake by adiponectin siRNA transfection (Fig. 2) is consistent with previous studies indicating that adipocyte adiponectin ablation or administration regulates glucose homeostasis. Adiponectin deficiency in 3T3-L1 adipocytes via adenovirus-expressing short hairpin RNA against adiponectin reduced glucose uptake rate [17]. A 2 h incubation with globular adiponectin in primary rat adipocytes enhanced glucose uptake to 82% compared to basal rate [31]. Regarding adiponectinmediated insulin signaling pathway, adiponectin directly targets IRS-1 rather than the insulin receptor (IR) [29]. We also found no distinguishable change in IR expression (data not shown). ADN-siRNA transfection significantly reduces IRS-1 abundance in insulin-responsive adipocytes (Fig. 4). The main docking protein IRS-1 for IR plays a pivotal role in insulin mediation of glucose uptake in adipocytes [24]. Decreased IRS-1 content is associated with insulin resistance and type 2 diabetes [6,15, 23], as well as decreased IRS-1 phosphorylation [5,27]. A previous report using short hairpin RNA-mediated adiponectin decreased IRS-1 tyrosine phosphorylation [17]. Moreover, administration of globular adiponectin to lipotropic mice improved insulin sensitivity by enhancing insulinstimulated tyrosine phosphorylation of IRS-1 in muscle [35]. In C2C12 myotubes, adiponectin treatment reduces IRS-1 phosphorylation at Ser636/639, which inhibits the subsequent insulin-stimulated tyrosine
Fig. 6. Adiponectin ablation decreases AMPK activation, but not p38MAPK. Activation of p38MAPK and AMPK is expressed as phospho-protein/total protein (B and D) in nontarget (lanes 1, 2, 3, and 4) or ADN siRNA transfected 3T3-L1 adipocytes (lanes 5, 6, 7, and 8). Insulin (lanes 3, 4, 7 and 8) was administered for 24 h to induce insulin resistance, and then cells were stimulated with 30 min insulin treatment (lanes 2, 4, 6, and 8). Representative blots of phospho-p38MAPK (upper panel) and p38MAPK (lower panel) in left side (A), and phospho-AMPK (upper panel) and AMPK (lower panel) in right side (C) are shown. Results are expressed as mean ± SEM. Statistical differences are represented as different letters (a, b) (p b 0.05).
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392
Insulin sensitizing effects of adiponectin were mostly elucidated in peripheral tissues such as muscle and liver. However, autocrine effects of adiponectin on adipocyte glucose uptake and insulin signaling have not been fully elucidated. In the present study, adiponectin deletion impairs insulin signaling, concurrently with reduced AMPK activation in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes. There was no further impact of insulin resistance on insulin signaling in adiponectin-deleted adipocytes. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.lfs.2015.02.013.
403
Conflict of interest statement
413
O
F
402
R O
346 347
5. Conclusion
P
344 345
393 394
The authors declare that there is no conflict of interest.
D
342 343
regulated by adiponectin deletion, and that result in the improvement of adipocyte insulin signaling and whole body glucose metabolism are needed. For the first time, this study indicated that adiponectin deficiency reduced insulin-stimulated glucose uptake, IRS-1 abundance, and total and plasma membrane GLUT4 protein expression accompanied with reduced AMPK activation only in insulin-responsive adipocytes. Taken together, decreased adipocyte adiponectin caused by insulin resistance may be a therapeutic target for the treatment of type 2 diabetes.
395 396 397 398 399 400 401
404 405 406 407 408 409 410 411 412
414
Acknowledgments
415
This work was supported by a grant from the Korea Institute of Medicine (http://www.kiom.org). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
416 Q5 417
References
420
[1] A.H. Berg, T.P. Combs, X. Du, M. Brownlee, P.E. Scherer, The adipocyte-secreted protein Acrp30 enhances hepatic insulin action, Nat. Med. 7 (8) (2001) 947–953. [2] E. Carvalho, P.A. Jansson, I. Nagaev, A.-M. Wenthzel, U. Smith, Insulin resistance with low cellular IRS-1 expression is also associated with low GLUT4 expression and impaired insulin-stimulated glucose transport, FASEB J. 15 (6) (2001) 1101–1103. [3] T.P. Combs, A.H. Berg, S. Obici, P.E. Scherer, L. Rossetti, Endogenous glucose production is inhibited by the adipose-derived protein Acrp30, J. Clin. Invest. 108 (12) (2001) 1875–1881. [4] T.P. Combs, U.B. Pajvani, A.H. Berg, Y. Lin, L.A. Jelicks, M. Laplante, et al., A transgenic mouse with a deletion in the collagenous domain of adiponectin displays elevated circulating adiponectin and improved insulin sensitivity, Endocrinology 145 (1) (2004) 367–383. [5] K. Cusi, K. Maezono, A. Osman, M. Pendergrass, M.E. Patti, T. Pratipanawatr, et al., Insulin resistance differentially affects the PI 3-kinase- and MAP kinase-mediated signaling in human muscle, J. Clin. Invest. 105 (3) (2000) 311–320. [6] A. Danielsson, A. Ost, E. Lystedt, P. Kjolhede, J. Gustavsson, F.H. Nystrom, et al., Insulin resistance in human adipocytes occurs downstream of IRS1 after surgical cell isolation but at the level of phosphorylation of IRS1 in type 2 diabetes, FEBS J 272 (2005) 141–151. [7] M. Fasshauer, J. Klein, S. Neumann, M. Eszlinger, R. Paschke, Hormonal regulation of adiponectin gene expression in 3T3-L1 adipocytes, Biochem. Biophys. Res. Commun. 290 (2002) 1084–1089. [8] J.M. Friedman, Obesity in the new millennium, Nature 404 (6778) (2000) 632–634. [9] J. Fruebis, T.S. Tsao, S. Javorschi, D. Ebbets-Reed, M.R.S. Erickson, F.T. Yen, et al., Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice, Proc. Natl. Acad. Sci. U. S. A. 98 (4) (2001) 2005–2010. [10] Y. Fu, N. Luo, R.L. Klein, W.T. Garvey, Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation, J. Lipid Res. 46 (7) (2005) 1369–1379. [11] A. Hammarstedt, T.E. Graham, B.B. Kahn, Adipose tissue dysregulation and reduced insulin sensitivity in non-obese individuals with enlarged abdominal adipose cells, Diabetol. Metab. Syndr. 4 (1) (2012) 42. [12] K. Hotta, T. Funahashi, Y. Arita, M. Takahashi, M. Matsuda, Y. Okamoto, et al., Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients, Arterioscler. Thromb. Vasc. Biol. 20 (6) (2000) 1595–1599. [13] P.A. Kern, G.B. Di Gregorio, T. Lu, N. Rassouli, G. Ranganathan, Adiponectin expression from human adipose tissue: relation to obesity, insulin resistance, and tumor necrosis factor-alpha expression, Diabetes 52 (2003) 1779–1785.
421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459
E
340 341
T
338 339
C
336 337
E
334 335
R
333
R
331 332
N C O
329 330
phosphorylation of IRS-1 by the IR and following insulin signaling [29]. In the present study, chronic insulin treatment (24 h, 100 nM) increased IRS-1 serine phosphorylation despite of small sample size (n = 1). Moreover, IRS-1 serine phosphorylation at serine636/639 was increased in adiponectin deletion. No further influence of insulin resistance on IRS-1 serine phosphorylation was observed in adiponectin deficient adipocytes (Supplementary Fig. 1). Insulin resistance further altered GLUT4 expression in plasma membrane and intracellular compartments in adiponectin-deleted adipocytes there was no further impact of insulin resistance on AMPK activation in adiponectin-deleted adipocytes. AKT, another major downstream target of insulin signaling, also elicits several insulin-mediated metabolic actions [21]. Phosphorylation of AKT substrates and AKT activity is remarkably decreased in type 2 diabetes [16]. This study's in vitro cell culture model revealed that chronic insulin treatment decreased insulin-stimulated glucose uptake accompanied by AKT activation, representing insulin resistant state in adipocytes. However, adiponectin deletion did not result in further AKT activation compared to non-target siRNA transfected controls (Fig. 3). These results suggest that AKT signaling is not involved in adiponectin ablation-induced reduction in insulin-stimulated glucose transport. Maintenance of glucose homeostasis is mediated by insulin-stimulated glucose transport. In this process, GLUT4 has a prominent role in glucose clearance, and GLUT1 plays a minor role, mostly for glucose uptake during non-insulin stimulation [21]. In insulin resistant states including obesity and type 2 diabetes, GLUT4 expression in adipocytes is reduced [2,11]. Overexpression of GLUT4 in adipose tissue results in improved glucose tolerance [26]. In our study, ADN siRNA-transfected adipocytes in the state of insulin sensitivity significantly decreased not only GLUT4 mRNA and protein abundance (Fig. 4), but also insulin-induced translocation of GLUT4 to the plasma membrane; however, there was no statistical change in GLUT1 expression (Fig. 5). Taken together, changes in IRS-1 and GLUT4 expression and GLUT4 translocation to the plasma membrane may play a role in glucose transport in adiponectin-lacking adipocytes. With respect to the molecular mechanisms underlying the insulinsensitizing effects of adiponectin, a growing body of evidence suggests adiponectin activates intracellular signaling pathways via activation of AMPK and p38MAPK in skeletal muscle cells [32,33,36]. Stimulation of glucose utilization and fatty acid oxidation by adiponectin is mediated by AMPK and p38MAPK [28,34,36]. Overexpression of dominantnegative AMPK, but not p38MAPK in C2C12 myotubes reduced the insulin-sensitizing effects of adiponectin [29]. Moreover, dominantnegative AMPK blocking of AMPK activation inhibits adiponectininduced insulin-sensitizing effects; therefore the actions of adiponectin occur through an AMPK-dependent mechanism [33,34]. In not only muscle cells, but also rat primary adipocytes, enhanced glucose uptake due to treatment with globular adiponectin was dependent on AMPK activation [31]. Our results demonstrate that adiponectin deletion significantly reduced AMPK activation, but not p38MAPK in insulinresponsive 3T3-L1 adipocytes. Moreover, insulin resistance decreased AMPK activation, which was not altered by adiponectin ablation (Fig. 6). Our current study has limitations. First, adiponectin deletion, per se decreases insulin sensitivity. ADN-siRNA transfection might be not appropriate especially in insulin resistant adipocyte, suggesting a method of adiponectin overexpression needs to be considered in following studies. Second, molecular mechanisms by which decreased IRS-1 level but no alteration of AKT activation in ADN knockout adipocytes have not been fully determined. With low physiological level of insulin (10 nM), IRS-1 tyrosine and serine phosphorylation and its-associated docking proteins and downstream signaling including phosphorylation of AKT at both sites of serine473 and threonine308 needs to be elucidated in ADN-ablated adipocytes. In addition, more sensitive methodology to measure insulin-induced GLUT4 translocation in plasma membrane needs to be taken into consideration, since there is discrepancy between glucose uptake and GLUT4 level in plasma membrane. In addition, further studies investigating AMPK subunits and/or adiponectin receptors
U
327 328
7
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
418 419
P
R O
O
F
[26] P.R. Shepherd, L. Gnudi, E. Tozzo, H. Yang, F. Leach, B.B. Kahn, Adipose cell hyperplasia and enhanced glucose disposal in transgenic mice overexpressing GLUT4 selectively in adipose tissue, J Biol Chem 268 (30) (1993) 22243–22246. [27] H. Storgaard, X.M. Song, C.B. Jensen, S. Madsbad, M. Björnholm, A. Vaag, et al., Insulin signal transduction in skeletal muscle from glucose-intolerant relatives with type 2 diabetes, Diabetes 50 (12) (2001) 2770–2778. [28] E. Tomas, T.S. Tsao, A.K. Saha, H.E. Murrey, C.C. Zhang, S.I. Itani, et al., Enhanced muscle fat oxidation and glucose transport by ACRP30 globular domain: acetyl– CoA carboxylase inhibition and AMP-activated protein kinase activation, Proc. Natl. Acad. Sci. U. S. A. 99 (25) (2002) 16309–16313. [29] C. Wang, X. Mao, L. Wang, M. Liu, M.D. Wetzel, K.L. Guan, et al., Adiponectin sensitizes insulin signaling by reducing p70 S6 kinase-mediated serine phosphorylation of IRS-1, J Biol Chem 282 (11) (2007) 7991–7996. [30] C. Weyer, T. Funahashi, S. Tanaka, K. Hotta, Y. Matsuzawa, R.E. Pratley, et al., Hypoadiponectinemia in obesity and type 2 diabetes: close association with insulin resistance and hyperinsulinemia, J Clin Endocrinol Metab 86 (5) (2001) 1930–1935. [31] X. Wu, H. Motoshima, K. Mahadev, T.J. Stalker, R. Scalia, B.J. Goldstein, Involvement of AMP-activated protein kinase in glucose uptake stimulated by the globular domain of adiponectin in primary rat adipocytes, Diabetes 52 (6) (2003) 1355–1363. [32] X. Xin, L. Zhou, C.M. Reyes, F. Liu, L.Q. Dong, APPL1 mediates adiponectin-stimulated p38 MAPK activation by scaffolding the TAK1-MKK3-p38 MAPK pathway, Am J Physiol Endocrinol Metab 300 (1) (2011) (E103-E10). [33] T. Yamauchi, J. Kamon, Y. Ito, A. Tsuchida, T. Yokomizo, S. Kita, et al., Cloning of adiponectin receptors that mediate antidiabetic metabolic effects, Nature 423 (6941) (2003) 762–769. [34] T. Yamauchi, J. Kamon, Y. Minokoshi, Y. Ito, H. Waki, S. Uchida, et al., Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase, Nat. Med. 8 (11) (2002) 1288–1295. [35] T. Yamauchi, J. Kamon, H. Waki, Y. Terauchi, N. Kubota, K. Hara, et al., The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity, Nat. Med. 7 (8) (2001) 941–946. [36] M.J. Yoon, G.Y. Lee, J.J. Chung, Y.H. Ahn, S.H. Hong, J.B. Kim, Adiponectin increases fatty acid oxidation in skeletal muscle cells by sequential activation of AMPactivated protein kinase, p38 mitogen-activated protein kinase, and peroxisome proliferator-activated receptor α, Diabetes 55 (9) (2006) 2562–2570.
N
C
O
R
R
E
C
T
E
[14] E.E. Kershaw, J.S. Flier, Adipose tissue as an endocrine organ, J Clin Endocrinol Metab 89 (6) (2004) 2548–2556. [15] P. Kovacs, R.L. Hanson, Y.H. Lee, X. Yang, S. Kobes, P.A. Permana, et al., The role of insulin receptor substrate-1 gene (IRS1) in type 2 diabetes in Pima Indians, Diabetes 52 (2003) 3005–3009. [16] A. Krook, R.A. Roth, X.J. Jiang, J.R. Zierath, H. Wallberg-Henriksson, Insulinstimulated Akt kinase activity is reduced in skeletal muscle from NIDDM subjects, Diabetes 47 (8) (1998) 1281–1286. [17] K. Li, L. Li, G. Yang, H. Liu, S. Li, G. Boden, Effect of short hairpin RNA-mediated adiponectin/Acrp30 down-regulation on insulin signaling and glucose uptake in the 3T3-L1 adipocytes, J. Endocrinol. Investig. 33 (2) (2010) 96–102. [18] S. Nishiumi, H. Ashida, Rapid preparation of a plasma membrane fraction from adipocytes and muscle cells: application to detection of translocated glucose transporter 4 on the plasma membrane, Biosci. Biotechnol. Biochem. 71 (9) (2007) 2343–2346. [19] K. Ohashi, J.L. Parker, N. Ouchi, A. Higuchi, J.A. Vita, N. Gokce, et al., Adiponectin promotes macrophage polarization toward an anti-inflammatory phenotype, J Biol Chem 285 (9) (2010) 6153–6160. [20] N. Ouchi, S. Kihara, Y. Arita, M. Nishida, A. Matsuyama, Y. Okamoto, et al., Adipocytederived plasma protein, adiponectin, suppresses lipid accumulation and class A scavenger receptor expression in human monocyte-derived macrophages, Circulation 103 (8) (2001) 1057–1063. [21] J.E. Pessin, A.R. Saltiel, Signaling pathways in insulin action: molecular targets of insulin resistance, J. Clin. Invest. 106 (2) (2000) 165–169. [22] E. Ravussin, S.R. Smith, Increased fat intake, impaired fat oxidation, and failure of fat cell proliferation result in ectopic fat storage, insulin resistance, and type 2 diabetes mellitus, Ann. N. Y. Acad. Sci. 967 (2002) 363–378. [23] C.M. Rondinone, L.M. Wang, P. Lonnroth, C. Wesslau, J.H. Pierce, U. Smith, Insulin receptor substrate (IRS) 1 is reduced and IRS-2 is the main docking protein for phosphatidylinositol 3-kinase in adipocytes from subjects with non-insulin-dependent diabetes mellitus, Proc. Natl. Acad. Sci. U. S. A. 94 (8) (1997) 4171–4175. [24] A.R. Saltiel, J.E. Pessin, Insulin signaling pathways in time and space, Trends Cell Biol. 12 (2) (2002) 65–71. [25] P.E. Schwarz, G.W. Towers, S. Fischer, S. Govindarajalu, J. Schulze, S.R. Bornstein, et al., Hypoadiponectinemia is associated with progression toward type 2 diabetes and genetic variation in the ADIPOQ gene promoter, Diabetes Care 29 (7) (2006) 1645–1650.
U
460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 532
E. Chang et al. / Life Sciences xxx (2015) xxx–xxx
D
8
Please cite this article as: E. Chang, et al., Adiponectin deletion impairs insulin signaling in insulin-sensitive but not insulin-resistant 3T3-L1 adipocytes, Life Sci (2015), http://dx.doi.org/10.1016/j.lfs.2015.02.013
497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531
