FEMS Pathogens and Disease, 73, 2015, ftv011 doi: 10.1093/femspd/ftv011 Advance Access Publication Date: 6 February 2015 Research Article
RESEARCH ARTICLE
Activation of the NLRP3 inflammasome in Porphyromonas gingivalis-accelerated atherosclerosis Yohei Yamaguchi1 , Tomoko Kurita-Ochiai2,∗ , Ryoki Kobayashi2 , Toshihiko Suzuki3 and Tomohiro Ando1 1
Department of Oral and Maxillofacial Surgery, Tokyo Women’s Medical University, School of Medicine, Tokyo 162-8666, Japan, 2 Department of Microbiology and Immunology, Nihon University School of Dentistry at Matsudo, Chiba 271-8587, Japan and 3 Department of Molecular Bacteriology and Immunology, Graduate School of Medicine, University of the Ryukyus, Okinawa 903-0215, Japan ∗ Corresponding author: Department of Microbiology and Immunology, Nihon University School of Dentistry at Matsudo, 2-870-1, Sakaecho-nishi Matsudo-shi, Chiba 271-8587, Japan. Tel: +81-47-360-9432 Fax: +81-47-360-9601; E-mail: [email protected] One sentence summary: The NLRP3 inflammasome, followed by a response from the IL-1 family, may play a critical role in periodontal disease and atherosclerosis induced by Porphyromonas gingivalis challenge through sustained inflammation. Editor: Richard T. Marconi
ABSTRACT Porphyromonas gingivalis has been shown to accelerate atherosclerotic lesion development in hyperlipidemic animals. Atherosclerosis is a disease characterized by inflammation of the arterial wall. Recent studies have suggested that the NLRP3 inflammasome plays an important role in the development of vascular inflammation and atherosclerosis. Herein, we investigated a possible association between the inflammasome in atherosclerosis and periodontal disease induced by P. gingivalis infection using apolipoprotein E-deficient, spontaneously hyperlipidemic (Apoeshl ) mice. Oral infection with wild-type (WT) P. gingivalis significantly increased the area of aortic sinus covered with atherosclerotic plaque and alveolar bone loss, compared with KDP136 (gingipain-null mutant) or KDP150 (FimA-deficient mutant) challenge. WT challenge also increased IL-1β, IL-18 and TNF-α production in peritoneal macrophages, and gingival or aortic gene expression of Nod-like receptor family, pyrin domain containing 3 (NLRP3), pro-IL-1β, pro-IL-18 and pro-caspase-1. Porphyromonas gingivalis genomic DNA was detected more in the aorta, gingival tissue, liver and spleen of WT-challenged mice than those in KDP136- or KDP150-challenged mice. We conclude that WT P. gingivalis activates innate immune cells through the NLRP3 inflammasome compared with KDP136 or KDP150. The NLRP3 inflammasome may play a critical role in periodontal disease and atherosclerosis induced by P. gingivalis challenge through sustained inflammation. Keywords: Porphyromonas gingivalis; atherosclerosis; NLRP3 inflammasome
INTRODUCTION Atherosclerosis is a chronic, low-grade inflammatory disease in which lipoproteins accumulate, eliciting an inflammatory response in the arterial wall (Libby, Ridker and Maseri 2002). Although the inflammatory nature of atherosclerosis is well established, the biological agents that trigger arterial wall in-
flammation remain largely unknown. In particular, the release of proinflammatory cytokines by atherosclerotic plaqueinfiltrating macrophages is believed to be critical. Interleukin (IL)-1β is a proinflammatory cytokine synthesized by many cells, including monocytes and tissue macrophages, as a 31kDa proform, which is cleaved by IL-1β-converting enzyme or caspase-1 to generate the mature 17-kDa protein (Braddock
Received: 29 September 2014; Accepted: 25 January 2015 C FEMS 2015. All rights reserved. For permissions, please e-mail: [email protected]
1
2
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
and Quinn 2004). The bioactivation of atherogenic cytokines such as IL-1β and IL-18 is NOD-like receptor family, pyrin domain containing 3 (NLRP3) inflammasome dependent (De Nardo and Latz 2011). Activation of the NLRP3 inflammasome by microbial and environmental stimuli enables the caspase-1dependent processing and secretion of IL-1β (Ather et al. 2011). Furthermore, there are reports which suggest that the link between increase in NLRP3 inflammasome and atherosclerosis. For instance, when mice deficient in low-density lipoprotein receptor were bone-marrow transplanted with NLRP3-deficient bone marrow, they had markedly decreased early atherosclerosis and inflammasome-dependent IL-18 levels (Duewell et al. 2010). Recent report also indicated that silence of NLRP3 suppresses atherosclerosis and stablizes plaques in apolipoprotein E-deficient mice (Zheng et al. 2014). Inflammatory and immune mechanisms activated by infectious agents are also important in the development of atherosclerosis (Epstein, Zhou and Zhu 1999). Several epidemiological studies have revealed that host immune reactions against persistent infectious pathogens, including Porphyromonas gingivalis, may promote the development of atherosclerosis (Taniguchi et al. 2003; Wada and Kamisaki 2010). In this respect, the NLRP3 inflammasome may play an important role in IL-1β production in response to several bacterial ligands such as lipopolysaccharide (LPS), peptidoglycan and bacterial RNA (Martinon et al. 2004; Kanneganti et al. 2006; Mariathasan et al. 2006; Becker and O’Neill 2007). Peripheral blood mononuclear cell-derived macrophages reportedly express NLRP3 mRNA (Kummer et al. 2007) to release proinflammatory IL-1β, which is highly induced by bacterial LPS (Pontillo et al. 2013). In contrast, NLRP3-deficient macrophages do not produce active IL-1β in response to bacterial infection (Mariathasan et al. 2006; Kanneganti et al. 2006). Porphyromonas gingivalis is a Gram-negative asaccharolytic bacterium that has long been implicated in human periodontitis (Socransky et al. 1998). Recent evidence suggests that this bacterium contributes to periodontitis by functioning as a keystone pathogen (Hajishengallis et al. 2011; Darveau, Hajishengallis and Curtis 2012). Virulence factors of P. gingivalis, including LPS, hemagglutinins, gingipains and fimbriae, are impor-
tant in the induction of immune responses, including the production of inflammatory cytokines such as IL-1 and activation of inflammation-related signaling pathways (Bostanci and Belibasakis 2012). IL-1 also mediates periodontal tissue destruction by stimulating alveolar bone resorption. However, how P. gingivalis participates in the inflammatory response through IL1 is unknown. Therefore, we examined the effects of the NLRP3 inflammasome on atherosclerosis accelerated by P. gingivalis infection.
MATERIALS AND METHODS Bacterial strain Wild-type (WT) P. gingivalis (ATCC 33277), KDP136 (gingipain-null mutant) and KDP150 (FimA-deficient mutant) (the mutants were gifts from K. Nakayama, Nagasaki University, Nagasaki, Japan) were cultured anaerobically as described previously (Koizumi et al. 2008). The bacteria were resuspended in 5% carboxymethyl cellulose (CMC) for oral infection.
Mice and oral infection Ten-week-old male (C. KOR-Apoeshl ) mice (Matsushima et al. 2001) obtained from Japan SLC Inc. (Hamamatsu, Japan) were fed a regular diet and water ad libitum. The mice received antibiotics as described previously (Momoi et al. 2008) and were randomly divided into four groups (n = 14 per group; Fig. 1). The first group was orally challenged with 0.1 mL of 5% CMC via gavage needle five times a week for 3 weeks; the second, third and fourth groups were similarly challenged with 109 CFU/mouse in 0.1 mL of live WT, KDP136 and KDP150, respectively. At 2 days and 4 weeks after the final infection, the mice were sacrificed and blood and tissue samples were collected. All mice were housed in temperature- and humidity-controlled clean racks with a 12h light/dark cycle. The Institutional Animal Care and Use Committee of Nihon University (Tokyo, Japan) approved all animal protocols.
Figure 1. Experimental procedure. Eleven-week-old male Apoeshl mice were randomly divided into four groups: group 1 was challenged with 100 μL of CMC (arrow), group 2 was challenged with 100 μL (109 CFU) of WT P. gingivalis (arrow), group 3 was challenged with 100 μL (109 CFU) of KDP136 (arrow)and group 4 was challenged with 100 μL (109 CFU) of KDP150 (arrow). The animals were challenged orally with CMC or P. gingivalis five times per week for 3 weeks and sacrificed 2 days and 4 weeks after the final challenge.
Yamaguchi et al.
3
Quantification of the atherosclerotic lesion area
Quantification of alveolar bone loss
Frozen sections of the proximal aorta were prepared as described previously (Koizumi et al. 2008). Sections (6 μm thick) from each mouse were stained with Oil Red O to visualize neutral lipids and counterstained with hematoxylin. The total lesion area per slide and percentage of the aortic lumen occupied by lesions per section were calculated using Lumina Vision image analysis software (Mitani Co., Fukui, Japan). The values of 15 sections per animal were averaged and expressed as the mean lesion area and percentage of the lumen of the proximal aorta occupied by lesions per section per animal.
Horizontal bone loss around the maxillary molars was assessed by the morphometric method, as described previously (Momoi et al. 2008). Briefly, skulls were unfleshed after 10 min of treatment in boiling water under pressure of 15 lb/in2 , immersed overnight in 3% hydrogen peroxide, pulsed for 1 min in bleach and stained with 1% methylene blue. The distance from the cementoenamel junction (CEJ) to the alveolar bone crest (ABC) was measured at a total of 14 buccal sites per mouse. Measurements were taken under a dissecting microscope (50× magnification) fitted with a video image marker measurement system (VHX100; KEYENCE, Osaka, Japan) and standardized to give measurements in micrometers. All bone measurements were performed in triplicate by two evaluators using a random and blinded protocol.
Peritoneal infection and cytokine assays After an oral challenge over 3 weeks, the mice were infected intraperitoneally with live WT P. gingivalis, KDP136 or KDP150 (5 × 107 CFU/mouse), respectively, and peritoneal exudate cells were harvested 2 h later. The peritoneal exudate cells were washed with RPMI 1640, resuspended at a density of 1 × 106 cells/mL in RPMI 1640 containing penicillin and 5% fetal bovine serum (Gibco supplied by Invitrogen Co., Carlsbad, CA, USA), and stimulated with live WT P. gingivalis, KDP136 or KDP150 at a multiplicity of infection (MOI) of 10:1 for 16 h. Cytokines released into the culture supernatants were subjected to assays for IL-1β (Thermo Scientific Co., Rockford, IL, USA), IL-18 (MBL, Nagoya, Japan) and tumor necrosis factor (TNF)-α (R&D Systems Inc., Minneapolis, MN, USA).
Statistical analysis The data are presented as means ± standard deviation (SD). Differences in total atherosclerotic plaque accumulation were assessed by a one-way analysis of variance followed by the Tukey– Kramer multiple comparison test. A p-value < 0.05 was considered to indicate statistical significance.
RESULTS Atherosclerotic plaque formation in the aortic sinus
Analysis of gene expression by quantitative real-time RT-PCR Total RNA purified from gingival tissue and aorta (n = 7 per group) was reverse transcribed with oligo(dT) primers using R reverse transcriptase (Invitrogen Co.) to generate SuperScript cDNA. Quantitative real-time RT-PCR analyses were performed using a Thermal Cycler Dice real-time PCR system (Takara Bio Inc., Otsu, Japan) as described previously (Zhang et al. 2010). Specific primers for NLRP3 and GAPDH were supplied by Takara Shuzo (Kyoto, Japan). Specific primers for Pro-IL-1β, Pro-IL18 Procaspase-1 were synthesized as previously published (Petrasek et al. 2012). The primer sequences are listed in Table 1. PCR was performed with the following cycle conditions: 95◦ C for 15 min, followed by 40 cycles at 95◦ C for 15 s, 60◦ C for 10 s and 72◦ C for 30 s. The amplification of each gene was performed in triplicate. Target mRNA levels were normalized to that of GAPDH mRNA.
Detection of P. gingivalis by PCR DNA was isolated from aorta, gingival tissue, liver, spleen and whole blood with the use of a QIAamp kit (Qiagen, Tokyo, Japan). The P. gingivalis 16S gene was then amplified by PCR as described previously (Zhang et al. 2010).
A histomorphometric analysis revealed a significant increase in atherosclerotic plaque accumulation in WT- (p < 0.01), KDP136(P < 0.05) and KDP150 (P < 0.05)-challenged mice compared with sham-treated mice, with the percentage of the total lumen of the proximal aorta occupied by lesions showing a similar pattern except for KDP150 (Fig. 2). The order of extent of atherosclerosis was WT > KDP136 > KDP150 > CMC. There was a significant difference between the WT- and KDP136-challenged mice (Figs 2A and B, P < 0.05), and between the WT- and KDP150-challenged mice (Figs 2A and B, P < 0.01). In contrast, there was no significant difference between KDP150 and CMC groups (Fig. 2B).
The WT challenge increased alveolar bone loss in Apoeshl mice Oral infection with WT P. gingivalis induced significantly greater bone loss compared with control mice treated with vehicle alone (Figs 3A and B, P < 0.05). In contrast, bone loss was reduced significantly in KDP136- and KDP150-challenged mice compared with WT-challenged mice (P < 0.05). Further, there was no significant difference between KDP150-challenged mice and control mice. These results suggest that fimbriae and gingipain are virulence factors involved in periodontitis caused by P. gingivalis.
Table 1. Primers sequences used for the real-time RT-PCR. Primers
Forward
Reverse
GAPDH NLRP3 Pro-IL-1β Pro-IL-18 Pro-caspase-1
TATGTCCGTCGTGGATCTGA ACTGAAGCACCTGCTCTGCAAC TCTTTGAAGTTGACGGACCC CAGGCCTACATCTTCTGCAA AGATGGCACATTTCCAGGAC
TTGCTGTTGAAGTCGCAGGAG AACCAATGCGAGATCCTGACAAC TGAGTGATACTGCCTGCCTG TCTGACATGGCAGCCATTGT GATCCTCCAGCAGCAACTTC
4
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Figure 2. Atherosclerotic plaque formation in the aortic sinuses of Apoeshl mice challenged orally with P. gingivalis (WT, KDP136 or KDP150). The results of a histomorphometric analysis of the mean lesion area (A) and percentage of the aortic sinus occupied by lesions (B) at 18 weeks are shown. The values represent means ± SD (n = 7). ∗ ∗ P < 0.01, ∗ P < 0.05 compared to CMC-treated control mice. ## P < 0.01, # P < 0.05 compared to WT P. gingivalis-challenged mice. (C) Oil Red O-stained proximal aorta cryosections. Arrow: a typical lipid-rich atherosclerotic area stained with Oil Red O. Pg, P. gingivalis.
When compared with CMC-treated mice, peritoneal macrophages from WT P. gingivalis-, KDP136- and KDP150challenged mice exhibited increased secretion of IL-1β (Fig. 4; 321.4 ± 27.2 pg/mL for WT P. gingivalis, 126.4 ± 4.1 pg/mL for KDP136 and 135.4 ± 1.8 pg/mL for KDP150 vs 0.1 ± 0.1 pg/mL for CMC; P < 0.01), IL-18 (Fig. 4; 28.5 ± 0.5 pg/mL for WT, 10.6 ± 1.1 pg/mL for KDP136, 8.0 ± 0.8 pg/mL for KDP150 vs 0.3 ± 0.2 pg/mL for CMC; P < 0.01) and TNF-α (Fig. 4; 98.3 ± 1.5 pg/mL for WT P. gingivalis, 17.0 ± 2.5 pg/mL for KDP136 and 35.8 ± 6.3 pg/mL for KDP150 vs 0.1 ± 0.1 pg/mL for CMC; P < 0.01). In contrast, KDP136- and KDP150-challenged mice exhibited markedly decreased IL-1β, IL-18 and TNF-α production compared with WT P. gingivalis-challenged mice (P < 0.01; Fig. 4).
with sham-treated mice in gingival tissue (P < 0.05; Table 2). In contrast, while the KDP136 challenge increased NLRP3 and pro-IL-18 mRNA expression significantly, and the KDP150 challenge resulted in a significant increase in the NLRP3 mRNA level compared with sham-treated mice, both deficient strains exhibited significantly decreased inflammasome-related NLRP3 molecule expression compared with the WT-challenged mice (P < 0.01). WT P. gingivalis also significantly enhanced NLRP3, pro-IL-1β, pro-IL-18 and procaspase-1 mRNA levels in the aorta (P < 0.01; Table 2). Meanwhile, although the KDP136 challenge significantly increased the NLRP3 mRNA level, and the KDP150 challenge resulted in a significant increase in the procaspase1 mRNA level, both deficient strains significantly decreased inflammasome-related NLRP3, pro-IL-1β, pro-IL-18 and procaspase-1 mRNA levels compared with the WT P. gingivalischallenged mice (P < 0.05).
The WT challenge upregulated the expression of inflammasome-related factors in the gingival tissue and the aorta
Detection of the P. gingivalis ribosomal 16S gene by PCR
Cytokine production in peritoneal macrophages
The WT P. gingivalis challenge enhanced NLRP3, pro-IL-1β, proIL-18 and procaspase-1 mRNA levels significantly compared
Porphyromonas gingivalis was detected in the aorta, gingival tissue, liver and spleen of WT P. gingivalis-challenged mice by PCR (Fig. 5). Porphyromonas gingivalis was detected in the aorta and
Yamaguchi et al.
5
Figure 3. P. gingivalis-induced alveolar bone loss. Apoeshl mice were treated with CMC or 109 CFU of P. gingivalis (WT, KDP136 or KDP150) as described in the section ‘Materials and Methods’. The distance from the CEJ to the ABC at 14 predetermined sites in the unfleshed maxilla was measured and totaled for each mouse. The results are expressed as means ± SD (n = 7). ∗ ∗ P < 0.01, ∗ P < 0.05 compared to CMC-treated mice. ## P < 0.01 compared to WT P. gingivalis-challenged mice. Pg, P. gingivalis.
Figure 4. IL-1β, IL-18 and TNF-α production in Apoeshl mouse macrophages following a challenge with P. gingivalis (WT, KDP136 or KDP150). Macrophages from P. gingivalis-challenged Apoeshl mice were exposed to live P. gingivalis (WT, KDP136 or KDP150; MOI, 10:1). The IL-1β, IL-18 and TNF-α levels in the culture supernatants were analyzed by ELISAs. The data are expressed as the mean ± SD (n = 7). ∗ ∗ P < 0.01 compared to CMC-treated mice. ## P < 0.01 compared to WT Pg-challenged mice. Pg, P. gingivalis.
gingival tissue of all seven mice. Six of seven mice proved positive for P. gingivalis in the spleen. One mouse was positive for P. gingivalis genomic DNA in the liver. In contrast, the detection rate in all organs was lower in KDP136- and KDP150-challenged mice compared with WT P. gingivalis-challenged mice. Further, none of the sham-inoculated mice tested positive for P. gingivalis DNA in the aorta, gingival tissue, liver, spleen and blood, suggesting that P. gingivalis may be retained in the blood circulation and may invade atherosclerotic and gingival lesions of Apoeshl mice.
DISCUSSION The oral challenge of atherosclerosis-prone hyperlipidemic Apoeshl mice with WT P. gingivalis, KDP136 and KDP150 accelerated atherosclerosis and alveolar bone resorption. However, the order of extent of atherosclerosis was as follows: WT > KDP136 > KDP150 > CMC. The extent of the atherosclerotic lesions and bone resorption in the WT-challenged mice was significantly greater than that in the KDP136- and KDP150-challenged mice.
Furthermore, the WT-challenged mice showed significantly increased gingival and aortic NLRP3, pro-IL-1β, pro-IL-18 and procaspase-1 mRNA levels and IL-1β, IL-18 and TNF-α protein levels in peritoneal macrophages compared with CMC-treated controls. In contrast, in KDP136- or KDP150-challenged mice, those NLRP3-related mRNA and protein levels were considerably decreased in gingival tissue, the aorta and macrophages compared with WT P. gingivalis-challenged mice. These results suggest that gingipains and fimbriae are involved in tissue adherence followed by inflammasome activation in the gingiva and aorta. Adherence to and the invasion of vascular tissue by P. gingivalis are likely to play key roles in processes leading to the stimulation of accelerated atheroma development. Our results indicated that the fimbriae-deficient mutant formed the arteriosclerosis lesions comparable as a control group as compared with the gingipain-deficient mutant. These results suggest that cellular adherence and invasion by bacterial fimbriae are an essential step in the pathological process. Previous studies have also indicated that the oral challenge of ApoE−/− mice with a P. gingivalis
6
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Table 2. Gingival and aortic expression of inflammasome-related molecules in Apoeshl mice following a challenge with P. gingivalis WT, KDP136 and KDP150. NLRP3
Pg KDP136 KDP150
51.2±6.4∗ ∗ 4.1±0.4∗ ,## 7.9±1.0∗ ,##
Pg KDP136 KDP150
23.7±1.7∗ ∗ 6.8±0.1∗ ∗ ,## 2.8±0.2##
Pro-IL-1β [Gingival tissue] 3.8±3.7∗ 2.4±3.9 1.4±2.7 [Aorta] 3.5±1.4∗ ∗ 1.1±0.7## 1.6±0.8#
Pro-IL-18
Pro-caspase-1
2.6±1.1∗ 2.0±0.9∗ 1.1±0.5#
3.1±0.9∗ 1.9±0.8 1.9±0.7
2.8±0.3∗ ∗ 1.3±0.3## 1.4±0.5##
17.3±3.7∗ ∗ 2.0±0.3## 3.6±3.2∗ ,##
The relative mRNA levels (normalized to GAPDH) were determined by real-time RT-PCR. The data are expressed as fold-increases in the mRNA level compared to CMC-inoculated negative controls. The values represent means ± SD (n = 7). Pg, P. gingivalis. ∗∗ P < 0.01, ∗ P < 0.05 compared to CMC-treated controls. ## P < 0.01, # P < 0.05 compared to WT Pg-challenged mice.
Figure 5. Detection of P. gingivalis in the aorta, gingival tissue, liver, spleen and blood of Apoeshl mice. Mice were killed 2 days after P. gingivalis challenge, and total DNA was isolated from the aorta, gingival tissue, liver, spleen and blood. Porphyromonas gingivalis DNA was detected by PCR using P. gingivalis 16S-specific primers. Genomic DNA extracted from P. gingivalis was also subjected to PCR as a positive control (PC). Pg, P. gingivalis.
fimA mutant failed to accelerate atherosclerosis (Gibson et al. 2004; Miyamoto et al. 2006). Although their data support the hypothesis that both the WT strain and fimA mutant can gain access to the vasculature and aorta, the fimA mutant failed to elicit the induction of inflammatory molecules by the endothelium. Our data also demonstrate the existence of P. gingivalis DNA in the aorta, gingival tissues and spleen of the WT-challenged mice, suggesting that P. gingivalis gained access to the systemic circulation and remote organs, including the aorta, from gingival tissues, and may have induced vascular lesions followed by the formation of early atheromatous plaque in the aortic arch. In contrast, the rate of P. gingivalis detection in each organ was decreased in KDP136- and KDP150-challenged mice. These re-
sults suggest that virulence factors (e.g. fimbriae > gingipain) are important for bacterial dissemination, cell invasion and bacterial survival within blood vessels. Indeed, as gingipains are responsible for FimA maturation (Kato et al. 2007), gingipain mutants are likely to have fewer fimbriae. Porphyromonas gingivalis has been found in human atherosclerotic plaques (Chiu 1999; Sambri et al. 2004), indicating dissemination of the pathogen via the circulation, with an ability to interact with and activate platelets via Toll-like receptors (TLRs) and protease-activated receptors (PARs). A previous study showed that gingipains activate platelets via PARs (Lourbakos et al. 2001). Porphyromonas gingivalis surface molecules such as fimbriae and LPS also bind TLR2 on platelets, further strengthening platelets as bacterial sensors in
Yamaguchi et al.
the circulation (Blair et al. 2009; Jain et al. 2013). The degradation of immunoglobulins is also an effective immune-evasion strategy of bacteria. Gingipains degrade collagen and fibronectin, inactivate the complement system and degrade immunoglobulins. Therefore, these factors may sustain bacterial viability during bacteremia, which can occur as a result of surgery, tooth brushing and other dental procedures. The NLRP3 inflammasome, the best-characterized member of the inflammasome family, is a multi-protein complex that induces maturation of the inflammatory cytokines IL-1β and IL-18 through the activation of caspase-1 (Latz, Xiao and Stutz 2013). Specifically, NLRP3 proteins are upregulated in gingival tissues from periodontitis patients (Park et al. 2014) and in the aorta of coronary atherosclerosis patients (Zheng et al. 2013). A challenge with KDP136 or KDP150 could not activate all NLRP3related molecules in gingival tissue and the aorta, and it induced less IL-1β and TNF-α production compared with WT P. gingivalis, suggesting that gingipains and fimbriae are important virulence factors in NLRP3-inflammasome activation, followed by inflammatory cytokine production. Indeed, major fimbriae from P. gingivalis induced inflammatory cytokine production by murine peritoneal macrophages and monocytes (Hajishengallis et al. 2004). Furthermore, gingipains from P. gingivalis induced proinflammatory cytokine production in macrophages (Fitzpatrick et al. 2009). On the other hand, a previous report indicated that NLRP3-related proteins were not secreted into the culture medium due to degradation of the proteins by P. gingivalis protease, even if their expression was elevated (Huck et al. 2015). However, in our experiment, sufficient levels of IL-1β and TNF-α were produced in cultured macrophages by repeated infection with P. gingivalis in vivo. Since the in vitro culture of macrophages is performed using a closing system and an extended culture period, the direct effect of proteases may not reflect in vivo competence. Actually, elevated levels of IL-1β can be found in diseased periodontal tissue and gingival crevicular fluid, as well as in saliva (Kaushik, Yeltiwar and Pushpanshu 2011; Konopka, Pietrzak and Brzezinska-Blaszczyk 2012; Park et al. 2014). In this study, an oral challenge with WT P. gingivalis in Apoeshl mice induced significantly greater alveolar bone loss compared with CMC-treated controls. In contrast, a challenge with KDP136 or KDP150 resulted in a significantly lower bone resorption titer than a challenge with WT P. gingivalis. Further, KDP150challenge induced periodontal bone resorption comparable as control. A previous study showed that type I fimbriated Pg 33277 caused significantly more bone loss than its isogenic FimA(-) mutant (Wang et al. 2009). These results suggest that fimbriae indeed endow P. gingivalis with increased invasive and proinflammatory capacity, leading to periodontal destruction. Our results also suggest that the bone resorption pattern of each group is correlated with the arteriosclerotic plaque formation pattern. In summary, this study demonstrates that P. gingivalis induce NLRP3 inflammasome activation that results in a sustained inflammation and promotes atherosclerosis and periodontal disease. Furthermore, our data suggest that bacterial surface proteins such as fimbriae and gingipain are involved in cell adherence, invasion and survival followed by the induction and sustained of aortic or gingival inflammation.
ACKNOWLEDGEMENTS The authors are grateful to Drs Tomomi Hashizume-Takizawa and Mio Hagiwara for their technical assistance.
7
FUNDING This study was supported by Grants-in-Aid for Scientific Research (26463145) from the Japan Society for the Promotion of Science, ‘Strategic Research Base Development’ Program (Japan [MEXT], 2010–2014 [S1001024]) for Private Universities of the Ministry of Education, Culture, Sports, Science and Technology, Japan (3107), and through the Nihon University Multidisciplinary Research Grant for 2014. Conflict of interest statement. None declared.
REFERENCES Ather JL, Ckless K, Martin R, et al. Serum amyloid A activates the NLRP3 inflammasome and promotes Th17 allergic asthma in mice. J Immunol 2011;187:64–73. Becker CE, O’Neill LA. Inflammasomes in inflammatory disorders: the role of TLRs and their interactions with NLRs. Semiin Immunopathol 2007;29:239–48. Blair P, Rex S, Vitseva O, et al. Stimulation of Toll-like receptor 2 in human platelets induces a thromboinflammatory response through activation of phosphoinositide 3-kinase. Circ Res 2009;104:346–54. Bostanci N, Belibasakis GN. Porphyromonas gingivalis: an invasive and evasive opportunistic oral pathogen. FEMS Microbiol Lett 2012;333:1–9. Braddock M, Quinn A. Targeting IL-1 in inflammatory disease: new opportunities for therapeutic intervention. Nat Rev Drug discov 2004;3:330–9. Chiu B. Multiple infections in carotid atherosclerotic plaques. Am Heart J 1999;138:S534–6. Darveau RP, Hajishengallis G, Curtis MA. Porphyromonas gingivalis as a potential community activist for disease. J Dent Res 2012;91:816–20. De Nardo D, Latz E. NLRP3 inflammasomes link inflammation and metabolic disease. Trends Immunol 2011;32:373–9. Duewell P, Kono H, Rayner KJ, et al. NLRP3 inflammasomes are required for atherosclerosis and activated by cholesterol crystals. Nature 2010;464:1357–61. Epstein SE, Zhou YF, Zhu J. Infection and atherosclerosis: emerging mechanistic paradigms. Circulation 1999;100:e20–8. Fitzpatrick RE, Aprico A, Wijeyewickrema LC, et al. High molecular weight gingipains from Porphyromonas gingivalis induce cytokine responses from human macrophage-like cells via a nonproteolytic mechanism. J Innate Immun 2009;1:109–17. Gibson FC III,Hong C, Chou HH, et al. Innate immune recognition of invasive bacteria accelerates atherosclerosis in apolipoprotein E-deficient mice. Circulation 2004;109:2801–6. Hajishengallis G, Liang S, Payne MA, et al. Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and complement. Cell Host Microbe 2011;10:497–506. Hajishengallis G, Sojar H, Genco RJ, et al. Intracellular signaling and cytokine induction upon interactions of Porphyromonas gingivalis fimbriae with pattern-recognition receptors. Immunol Invest 2004;33:157–72. Huck O, Elkaim R, Davideau JL, et al. Porphyromonas gingivalisimpaired innate immune response via NLRP3 proteolysis in endothelial cells. Innate Immun 2015;21:65–72. Jain S, Coats SR, Chang AM, et al. A novel class of lipoprotein lipase-sensitive molecules mediates Toll-like receptor 2 activation by Porphyromonas gingivalis. Infect Immun 2013;81:1277– 86.
8
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Kanneganti TD, Ozoren N, Body-Malapel M, et al. Bacterial RNA and small antiviral compounds activate caspase-1 through cryopyrin/Nalp3. Nature 2006;440:233–6. Kato T, Tsuda T, Omori H, et al. Maturation of fimbria precursor protein by exogenous gingipains in Porphyromonas gingivalis gingipain-null mutant. FEMS Microbiol Lett 2007;273:96–102. Kaushik R, Yeltiwar RK, Pushpanshu K. Salivary interleukin1beta levels in patients with chronic periodontitis before and after periodontal phase I therapy and healthy controls: a case-control study. J Periodontol 2011;82:1353–9. Koizumi Y, Kurita-Ochiai T, Oguchi S, et al. Nasal immunization with Porphyromonas gingivalis outer membrane protein decreases P. gingivalis-induced atherosclerosis and inflammation in spontaneously hyperlipidemic mice. Infect Immun 2008;76:2958–65. Konopka L, Pietrzak A, Brzezinska-Blaszczyk E. Effect of scaling and root planing on interleukin-1beta, interleukin-8 and MMP-8 levels in gingival crevicular fluid from chronic periodontitis patients. J Periodontal Res 2012;47:681–8. Kummer JA, Broekhuizen R, Everett H, et al. Inflammasome components NALP 1 and 3 show distinct but separate expression profiles in human tissues suggesting a site-specific role in the inflammatory response. J Histochem Cytochem 2007;55:443–52. Latz E, Xiao TS, Stutz A. Activation and regulation of the inflammasomes. Nat Rev Immunol 2013;13:397–411. Libby P, Ridker PM, Maseri A. Inflammation and atherosclerosis. Circulation 2002;105:1135–43. Lourbakos A, Yuan YP, Jenkins AL, et al. Activation of proteaseactivated receptors by gingipains from Porphyromonas gingivalis leads to platelet aggregation: a new trait in microbial pathogenicity. Blood 2001;97:3790–7. Mariathasan S, Weiss DS, Newton K, et al. Cryopyrin activates the inflammasome in response to toxins and ATP. Nature 2006;440:228–32. Martinon F, Agostini L, Meylan E, et al. Identification of bacterial muramyl dipeptide as activator of the NALP3/cryopyrin inflammasome. Curr Biol 2004;14:1929–134. Matsushima Y, Sakurai T, Ohoka A, et al. Four strains of spontaneously hyperlipidemic (SHL) mice: phenotypic distinctions determined by genetic backgrounds. J Atheroscler Thromb 2001;8:71–9. Miyamoto T, Yumoto H, Takahashi Y, et al. Pathogen-accelerated atherosclerosis occurs early after exposure and can be prevented via immunization. Infect Immun 2006;74: 1376–80.
Momoi F, Hashizume T, Kurita-Ochiai T, et al. Nasal vaccination with the 40-kilodalton outer membrane protein of Porphyromonas gingivalis and a nontoxic chimeric enterotoxin adjuvant induces long-term protective immunity with reduced levels of immunoglobulin E antibodies. Infect Immun 2008;76:2777–84. Park E, Na HS, Song YR, et al. Activation of NLRP3 and AIM2 inflammasomes by Porphyromonas gingivalis infection. Infect Immun 2014;82:112–23. Petrasek J, Bala S, Csak T, et al. IL-1 receptor antagonist ameliorates inflammasome-dependent alcoholic steatohepatitis in mice. J Clin Invest 2012;122:3476–89. Pontillo A, Girardelli M, Agostinis C, et al. Bacterial LPS differently modulates inflammasome gene expression and IL-1beta secretion in trophoblast cells, decidual stromal cells, and decidual endothelial cells. Reprod Sci 2013;20:563–6. Sambri V, Marangoni A, Cavrini F, et al. Need for procedural details in detection of periodontopathic bacterial DNA in the atheromatous plaque by PCR. J Clin Microbiol 2004;42: 4914–5. Socransky SS, Haffajee AD, Cugini MA, et al. Microbial complexes in subgingival plaque. J Clin Periodontol 1998;25: 134–44. Taniguchi A, Nishimura F, Murayama Y, et al. Porphyromonas gingivalis infection is associated with carotid atherosclerosis in non-obese Japanese type 2 diabetic patients. Metabolism 2003;52:142–5. Wada K, Kamisaki Y. Roles of oral bacteria in cardiovascular diseases—from molecular mechanisms to clinical cases: Involvement of Porphyromonas gingivalis in the development of human aortic aneurysm. J Pharmacol Sci 2010;113:115–9. Wang M, Liang S, Hosur KB, et al. Differential virulence and innate immune interactions of Type I and II fimbrial genotypes of Porphyromonas gingivalis. Oral Microbiol Immunol 2009;24:478–84. Zhang T, Kurita-Ochiai T, Hashizume T, et al. Aggregatibacter actinomycetemcomitans accelerates atherosclerosis with an increase in atherogenic factors in spontaneously hyperlipidemic mice. FEMS Immunol Med Microbiol 2010;59:143–51. Zheng F, Xing S, Gong Z, et al. NLRP3 inflammasomes show high expression in aorta of patients with atherosclerosis. Heart Lung Circ 2013;22:746–50. Zheng F, Xing S, Gong Z, et al. Silence of NLRP3 suppresses atherosclerosis and stabilizeds plaques in apolipoprotein E-deficient mice. Mediat Inflamm 2014;507208, doi: 10.1155/ 2014/507208.
RESEARCH ARTICLE
Activation of the NLRP3 inflammasome in Porphyromonas gingivalis-accelerated atherosclerosis Yohei Yamaguchi1 , Tomoko Kurita-Ochiai2,∗ , Ryoki Kobayashi2 , Toshihiko Suzuki3 and Tomohiro Ando1 1
Department of Oral and Maxillofacial Surgery, Tokyo Women’s Medical University, School of Medicine, Tokyo 162-8666, Japan, 2 Department of Microbiology and Immunology, Nihon University School of Dentistry at Matsudo, Chiba 271-8587, Japan and 3 Department of Molecular Bacteriology and Immunology, Graduate School of Medicine, University of the Ryukyus, Okinawa 903-0215, Japan ∗ Corresponding author: Department of Microbiology and Immunology, Nihon University School of Dentistry at Matsudo, 2-870-1, Sakaecho-nishi Matsudo-shi, Chiba 271-8587, Japan. Tel: +81-47-360-9432 Fax: +81-47-360-9601; E-mail: [email protected] One sentence summary: The NLRP3 inflammasome, followed by a response from the IL-1 family, may play a critical role in periodontal disease and atherosclerosis induced by Porphyromonas gingivalis challenge through sustained inflammation. Editor: Richard T. Marconi
ABSTRACT Porphyromonas gingivalis has been shown to accelerate atherosclerotic lesion development in hyperlipidemic animals. Atherosclerosis is a disease characterized by inflammation of the arterial wall. Recent studies have suggested that the NLRP3 inflammasome plays an important role in the development of vascular inflammation and atherosclerosis. Herein, we investigated a possible association between the inflammasome in atherosclerosis and periodontal disease induced by P. gingivalis infection using apolipoprotein E-deficient, spontaneously hyperlipidemic (Apoeshl ) mice. Oral infection with wild-type (WT) P. gingivalis significantly increased the area of aortic sinus covered with atherosclerotic plaque and alveolar bone loss, compared with KDP136 (gingipain-null mutant) or KDP150 (FimA-deficient mutant) challenge. WT challenge also increased IL-1β, IL-18 and TNF-α production in peritoneal macrophages, and gingival or aortic gene expression of Nod-like receptor family, pyrin domain containing 3 (NLRP3), pro-IL-1β, pro-IL-18 and pro-caspase-1. Porphyromonas gingivalis genomic DNA was detected more in the aorta, gingival tissue, liver and spleen of WT-challenged mice than those in KDP136- or KDP150-challenged mice. We conclude that WT P. gingivalis activates innate immune cells through the NLRP3 inflammasome compared with KDP136 or KDP150. The NLRP3 inflammasome may play a critical role in periodontal disease and atherosclerosis induced by P. gingivalis challenge through sustained inflammation. Keywords: Porphyromonas gingivalis; atherosclerosis; NLRP3 inflammasome
INTRODUCTION Atherosclerosis is a chronic, low-grade inflammatory disease in which lipoproteins accumulate, eliciting an inflammatory response in the arterial wall (Libby, Ridker and Maseri 2002). Although the inflammatory nature of atherosclerosis is well established, the biological agents that trigger arterial wall in-
flammation remain largely unknown. In particular, the release of proinflammatory cytokines by atherosclerotic plaqueinfiltrating macrophages is believed to be critical. Interleukin (IL)-1β is a proinflammatory cytokine synthesized by many cells, including monocytes and tissue macrophages, as a 31kDa proform, which is cleaved by IL-1β-converting enzyme or caspase-1 to generate the mature 17-kDa protein (Braddock
Received: 29 September 2014; Accepted: 25 January 2015 C FEMS 2015. All rights reserved. For permissions, please e-mail: [email protected]
1
2
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
and Quinn 2004). The bioactivation of atherogenic cytokines such as IL-1β and IL-18 is NOD-like receptor family, pyrin domain containing 3 (NLRP3) inflammasome dependent (De Nardo and Latz 2011). Activation of the NLRP3 inflammasome by microbial and environmental stimuli enables the caspase-1dependent processing and secretion of IL-1β (Ather et al. 2011). Furthermore, there are reports which suggest that the link between increase in NLRP3 inflammasome and atherosclerosis. For instance, when mice deficient in low-density lipoprotein receptor were bone-marrow transplanted with NLRP3-deficient bone marrow, they had markedly decreased early atherosclerosis and inflammasome-dependent IL-18 levels (Duewell et al. 2010). Recent report also indicated that silence of NLRP3 suppresses atherosclerosis and stablizes plaques in apolipoprotein E-deficient mice (Zheng et al. 2014). Inflammatory and immune mechanisms activated by infectious agents are also important in the development of atherosclerosis (Epstein, Zhou and Zhu 1999). Several epidemiological studies have revealed that host immune reactions against persistent infectious pathogens, including Porphyromonas gingivalis, may promote the development of atherosclerosis (Taniguchi et al. 2003; Wada and Kamisaki 2010). In this respect, the NLRP3 inflammasome may play an important role in IL-1β production in response to several bacterial ligands such as lipopolysaccharide (LPS), peptidoglycan and bacterial RNA (Martinon et al. 2004; Kanneganti et al. 2006; Mariathasan et al. 2006; Becker and O’Neill 2007). Peripheral blood mononuclear cell-derived macrophages reportedly express NLRP3 mRNA (Kummer et al. 2007) to release proinflammatory IL-1β, which is highly induced by bacterial LPS (Pontillo et al. 2013). In contrast, NLRP3-deficient macrophages do not produce active IL-1β in response to bacterial infection (Mariathasan et al. 2006; Kanneganti et al. 2006). Porphyromonas gingivalis is a Gram-negative asaccharolytic bacterium that has long been implicated in human periodontitis (Socransky et al. 1998). Recent evidence suggests that this bacterium contributes to periodontitis by functioning as a keystone pathogen (Hajishengallis et al. 2011; Darveau, Hajishengallis and Curtis 2012). Virulence factors of P. gingivalis, including LPS, hemagglutinins, gingipains and fimbriae, are impor-
tant in the induction of immune responses, including the production of inflammatory cytokines such as IL-1 and activation of inflammation-related signaling pathways (Bostanci and Belibasakis 2012). IL-1 also mediates periodontal tissue destruction by stimulating alveolar bone resorption. However, how P. gingivalis participates in the inflammatory response through IL1 is unknown. Therefore, we examined the effects of the NLRP3 inflammasome on atherosclerosis accelerated by P. gingivalis infection.
MATERIALS AND METHODS Bacterial strain Wild-type (WT) P. gingivalis (ATCC 33277), KDP136 (gingipain-null mutant) and KDP150 (FimA-deficient mutant) (the mutants were gifts from K. Nakayama, Nagasaki University, Nagasaki, Japan) were cultured anaerobically as described previously (Koizumi et al. 2008). The bacteria were resuspended in 5% carboxymethyl cellulose (CMC) for oral infection.
Mice and oral infection Ten-week-old male (C. KOR-Apoeshl ) mice (Matsushima et al. 2001) obtained from Japan SLC Inc. (Hamamatsu, Japan) were fed a regular diet and water ad libitum. The mice received antibiotics as described previously (Momoi et al. 2008) and were randomly divided into four groups (n = 14 per group; Fig. 1). The first group was orally challenged with 0.1 mL of 5% CMC via gavage needle five times a week for 3 weeks; the second, third and fourth groups were similarly challenged with 109 CFU/mouse in 0.1 mL of live WT, KDP136 and KDP150, respectively. At 2 days and 4 weeks after the final infection, the mice were sacrificed and blood and tissue samples were collected. All mice were housed in temperature- and humidity-controlled clean racks with a 12h light/dark cycle. The Institutional Animal Care and Use Committee of Nihon University (Tokyo, Japan) approved all animal protocols.
Figure 1. Experimental procedure. Eleven-week-old male Apoeshl mice were randomly divided into four groups: group 1 was challenged with 100 μL of CMC (arrow), group 2 was challenged with 100 μL (109 CFU) of WT P. gingivalis (arrow), group 3 was challenged with 100 μL (109 CFU) of KDP136 (arrow)and group 4 was challenged with 100 μL (109 CFU) of KDP150 (arrow). The animals were challenged orally with CMC or P. gingivalis five times per week for 3 weeks and sacrificed 2 days and 4 weeks after the final challenge.
Yamaguchi et al.
3
Quantification of the atherosclerotic lesion area
Quantification of alveolar bone loss
Frozen sections of the proximal aorta were prepared as described previously (Koizumi et al. 2008). Sections (6 μm thick) from each mouse were stained with Oil Red O to visualize neutral lipids and counterstained with hematoxylin. The total lesion area per slide and percentage of the aortic lumen occupied by lesions per section were calculated using Lumina Vision image analysis software (Mitani Co., Fukui, Japan). The values of 15 sections per animal were averaged and expressed as the mean lesion area and percentage of the lumen of the proximal aorta occupied by lesions per section per animal.
Horizontal bone loss around the maxillary molars was assessed by the morphometric method, as described previously (Momoi et al. 2008). Briefly, skulls were unfleshed after 10 min of treatment in boiling water under pressure of 15 lb/in2 , immersed overnight in 3% hydrogen peroxide, pulsed for 1 min in bleach and stained with 1% methylene blue. The distance from the cementoenamel junction (CEJ) to the alveolar bone crest (ABC) was measured at a total of 14 buccal sites per mouse. Measurements were taken under a dissecting microscope (50× magnification) fitted with a video image marker measurement system (VHX100; KEYENCE, Osaka, Japan) and standardized to give measurements in micrometers. All bone measurements were performed in triplicate by two evaluators using a random and blinded protocol.
Peritoneal infection and cytokine assays After an oral challenge over 3 weeks, the mice were infected intraperitoneally with live WT P. gingivalis, KDP136 or KDP150 (5 × 107 CFU/mouse), respectively, and peritoneal exudate cells were harvested 2 h later. The peritoneal exudate cells were washed with RPMI 1640, resuspended at a density of 1 × 106 cells/mL in RPMI 1640 containing penicillin and 5% fetal bovine serum (Gibco supplied by Invitrogen Co., Carlsbad, CA, USA), and stimulated with live WT P. gingivalis, KDP136 or KDP150 at a multiplicity of infection (MOI) of 10:1 for 16 h. Cytokines released into the culture supernatants were subjected to assays for IL-1β (Thermo Scientific Co., Rockford, IL, USA), IL-18 (MBL, Nagoya, Japan) and tumor necrosis factor (TNF)-α (R&D Systems Inc., Minneapolis, MN, USA).
Statistical analysis The data are presented as means ± standard deviation (SD). Differences in total atherosclerotic plaque accumulation were assessed by a one-way analysis of variance followed by the Tukey– Kramer multiple comparison test. A p-value < 0.05 was considered to indicate statistical significance.
RESULTS Atherosclerotic plaque formation in the aortic sinus
Analysis of gene expression by quantitative real-time RT-PCR Total RNA purified from gingival tissue and aorta (n = 7 per group) was reverse transcribed with oligo(dT) primers using R reverse transcriptase (Invitrogen Co.) to generate SuperScript cDNA. Quantitative real-time RT-PCR analyses were performed using a Thermal Cycler Dice real-time PCR system (Takara Bio Inc., Otsu, Japan) as described previously (Zhang et al. 2010). Specific primers for NLRP3 and GAPDH were supplied by Takara Shuzo (Kyoto, Japan). Specific primers for Pro-IL-1β, Pro-IL18 Procaspase-1 were synthesized as previously published (Petrasek et al. 2012). The primer sequences are listed in Table 1. PCR was performed with the following cycle conditions: 95◦ C for 15 min, followed by 40 cycles at 95◦ C for 15 s, 60◦ C for 10 s and 72◦ C for 30 s. The amplification of each gene was performed in triplicate. Target mRNA levels were normalized to that of GAPDH mRNA.
Detection of P. gingivalis by PCR DNA was isolated from aorta, gingival tissue, liver, spleen and whole blood with the use of a QIAamp kit (Qiagen, Tokyo, Japan). The P. gingivalis 16S gene was then amplified by PCR as described previously (Zhang et al. 2010).
A histomorphometric analysis revealed a significant increase in atherosclerotic plaque accumulation in WT- (p < 0.01), KDP136(P < 0.05) and KDP150 (P < 0.05)-challenged mice compared with sham-treated mice, with the percentage of the total lumen of the proximal aorta occupied by lesions showing a similar pattern except for KDP150 (Fig. 2). The order of extent of atherosclerosis was WT > KDP136 > KDP150 > CMC. There was a significant difference between the WT- and KDP136-challenged mice (Figs 2A and B, P < 0.05), and between the WT- and KDP150-challenged mice (Figs 2A and B, P < 0.01). In contrast, there was no significant difference between KDP150 and CMC groups (Fig. 2B).
The WT challenge increased alveolar bone loss in Apoeshl mice Oral infection with WT P. gingivalis induced significantly greater bone loss compared with control mice treated with vehicle alone (Figs 3A and B, P < 0.05). In contrast, bone loss was reduced significantly in KDP136- and KDP150-challenged mice compared with WT-challenged mice (P < 0.05). Further, there was no significant difference between KDP150-challenged mice and control mice. These results suggest that fimbriae and gingipain are virulence factors involved in periodontitis caused by P. gingivalis.
Table 1. Primers sequences used for the real-time RT-PCR. Primers
Forward
Reverse
GAPDH NLRP3 Pro-IL-1β Pro-IL-18 Pro-caspase-1
TATGTCCGTCGTGGATCTGA ACTGAAGCACCTGCTCTGCAAC TCTTTGAAGTTGACGGACCC CAGGCCTACATCTTCTGCAA AGATGGCACATTTCCAGGAC
TTGCTGTTGAAGTCGCAGGAG AACCAATGCGAGATCCTGACAAC TGAGTGATACTGCCTGCCTG TCTGACATGGCAGCCATTGT GATCCTCCAGCAGCAACTTC
4
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Figure 2. Atherosclerotic plaque formation in the aortic sinuses of Apoeshl mice challenged orally with P. gingivalis (WT, KDP136 or KDP150). The results of a histomorphometric analysis of the mean lesion area (A) and percentage of the aortic sinus occupied by lesions (B) at 18 weeks are shown. The values represent means ± SD (n = 7). ∗ ∗ P < 0.01, ∗ P < 0.05 compared to CMC-treated control mice. ## P < 0.01, # P < 0.05 compared to WT P. gingivalis-challenged mice. (C) Oil Red O-stained proximal aorta cryosections. Arrow: a typical lipid-rich atherosclerotic area stained with Oil Red O. Pg, P. gingivalis.
When compared with CMC-treated mice, peritoneal macrophages from WT P. gingivalis-, KDP136- and KDP150challenged mice exhibited increased secretion of IL-1β (Fig. 4; 321.4 ± 27.2 pg/mL for WT P. gingivalis, 126.4 ± 4.1 pg/mL for KDP136 and 135.4 ± 1.8 pg/mL for KDP150 vs 0.1 ± 0.1 pg/mL for CMC; P < 0.01), IL-18 (Fig. 4; 28.5 ± 0.5 pg/mL for WT, 10.6 ± 1.1 pg/mL for KDP136, 8.0 ± 0.8 pg/mL for KDP150 vs 0.3 ± 0.2 pg/mL for CMC; P < 0.01) and TNF-α (Fig. 4; 98.3 ± 1.5 pg/mL for WT P. gingivalis, 17.0 ± 2.5 pg/mL for KDP136 and 35.8 ± 6.3 pg/mL for KDP150 vs 0.1 ± 0.1 pg/mL for CMC; P < 0.01). In contrast, KDP136- and KDP150-challenged mice exhibited markedly decreased IL-1β, IL-18 and TNF-α production compared with WT P. gingivalis-challenged mice (P < 0.01; Fig. 4).
with sham-treated mice in gingival tissue (P < 0.05; Table 2). In contrast, while the KDP136 challenge increased NLRP3 and pro-IL-18 mRNA expression significantly, and the KDP150 challenge resulted in a significant increase in the NLRP3 mRNA level compared with sham-treated mice, both deficient strains exhibited significantly decreased inflammasome-related NLRP3 molecule expression compared with the WT-challenged mice (P < 0.01). WT P. gingivalis also significantly enhanced NLRP3, pro-IL-1β, pro-IL-18 and procaspase-1 mRNA levels in the aorta (P < 0.01; Table 2). Meanwhile, although the KDP136 challenge significantly increased the NLRP3 mRNA level, and the KDP150 challenge resulted in a significant increase in the procaspase1 mRNA level, both deficient strains significantly decreased inflammasome-related NLRP3, pro-IL-1β, pro-IL-18 and procaspase-1 mRNA levels compared with the WT P. gingivalischallenged mice (P < 0.05).
The WT challenge upregulated the expression of inflammasome-related factors in the gingival tissue and the aorta
Detection of the P. gingivalis ribosomal 16S gene by PCR
Cytokine production in peritoneal macrophages
The WT P. gingivalis challenge enhanced NLRP3, pro-IL-1β, proIL-18 and procaspase-1 mRNA levels significantly compared
Porphyromonas gingivalis was detected in the aorta, gingival tissue, liver and spleen of WT P. gingivalis-challenged mice by PCR (Fig. 5). Porphyromonas gingivalis was detected in the aorta and
Yamaguchi et al.
5
Figure 3. P. gingivalis-induced alveolar bone loss. Apoeshl mice were treated with CMC or 109 CFU of P. gingivalis (WT, KDP136 or KDP150) as described in the section ‘Materials and Methods’. The distance from the CEJ to the ABC at 14 predetermined sites in the unfleshed maxilla was measured and totaled for each mouse. The results are expressed as means ± SD (n = 7). ∗ ∗ P < 0.01, ∗ P < 0.05 compared to CMC-treated mice. ## P < 0.01 compared to WT P. gingivalis-challenged mice. Pg, P. gingivalis.
Figure 4. IL-1β, IL-18 and TNF-α production in Apoeshl mouse macrophages following a challenge with P. gingivalis (WT, KDP136 or KDP150). Macrophages from P. gingivalis-challenged Apoeshl mice were exposed to live P. gingivalis (WT, KDP136 or KDP150; MOI, 10:1). The IL-1β, IL-18 and TNF-α levels in the culture supernatants were analyzed by ELISAs. The data are expressed as the mean ± SD (n = 7). ∗ ∗ P < 0.01 compared to CMC-treated mice. ## P < 0.01 compared to WT Pg-challenged mice. Pg, P. gingivalis.
gingival tissue of all seven mice. Six of seven mice proved positive for P. gingivalis in the spleen. One mouse was positive for P. gingivalis genomic DNA in the liver. In contrast, the detection rate in all organs was lower in KDP136- and KDP150-challenged mice compared with WT P. gingivalis-challenged mice. Further, none of the sham-inoculated mice tested positive for P. gingivalis DNA in the aorta, gingival tissue, liver, spleen and blood, suggesting that P. gingivalis may be retained in the blood circulation and may invade atherosclerotic and gingival lesions of Apoeshl mice.
DISCUSSION The oral challenge of atherosclerosis-prone hyperlipidemic Apoeshl mice with WT P. gingivalis, KDP136 and KDP150 accelerated atherosclerosis and alveolar bone resorption. However, the order of extent of atherosclerosis was as follows: WT > KDP136 > KDP150 > CMC. The extent of the atherosclerotic lesions and bone resorption in the WT-challenged mice was significantly greater than that in the KDP136- and KDP150-challenged mice.
Furthermore, the WT-challenged mice showed significantly increased gingival and aortic NLRP3, pro-IL-1β, pro-IL-18 and procaspase-1 mRNA levels and IL-1β, IL-18 and TNF-α protein levels in peritoneal macrophages compared with CMC-treated controls. In contrast, in KDP136- or KDP150-challenged mice, those NLRP3-related mRNA and protein levels were considerably decreased in gingival tissue, the aorta and macrophages compared with WT P. gingivalis-challenged mice. These results suggest that gingipains and fimbriae are involved in tissue adherence followed by inflammasome activation in the gingiva and aorta. Adherence to and the invasion of vascular tissue by P. gingivalis are likely to play key roles in processes leading to the stimulation of accelerated atheroma development. Our results indicated that the fimbriae-deficient mutant formed the arteriosclerosis lesions comparable as a control group as compared with the gingipain-deficient mutant. These results suggest that cellular adherence and invasion by bacterial fimbriae are an essential step in the pathological process. Previous studies have also indicated that the oral challenge of ApoE−/− mice with a P. gingivalis
6
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Table 2. Gingival and aortic expression of inflammasome-related molecules in Apoeshl mice following a challenge with P. gingivalis WT, KDP136 and KDP150. NLRP3
Pg KDP136 KDP150
51.2±6.4∗ ∗ 4.1±0.4∗ ,## 7.9±1.0∗ ,##
Pg KDP136 KDP150
23.7±1.7∗ ∗ 6.8±0.1∗ ∗ ,## 2.8±0.2##
Pro-IL-1β [Gingival tissue] 3.8±3.7∗ 2.4±3.9 1.4±2.7 [Aorta] 3.5±1.4∗ ∗ 1.1±0.7## 1.6±0.8#
Pro-IL-18
Pro-caspase-1
2.6±1.1∗ 2.0±0.9∗ 1.1±0.5#
3.1±0.9∗ 1.9±0.8 1.9±0.7
2.8±0.3∗ ∗ 1.3±0.3## 1.4±0.5##
17.3±3.7∗ ∗ 2.0±0.3## 3.6±3.2∗ ,##
The relative mRNA levels (normalized to GAPDH) were determined by real-time RT-PCR. The data are expressed as fold-increases in the mRNA level compared to CMC-inoculated negative controls. The values represent means ± SD (n = 7). Pg, P. gingivalis. ∗∗ P < 0.01, ∗ P < 0.05 compared to CMC-treated controls. ## P < 0.01, # P < 0.05 compared to WT Pg-challenged mice.
Figure 5. Detection of P. gingivalis in the aorta, gingival tissue, liver, spleen and blood of Apoeshl mice. Mice were killed 2 days after P. gingivalis challenge, and total DNA was isolated from the aorta, gingival tissue, liver, spleen and blood. Porphyromonas gingivalis DNA was detected by PCR using P. gingivalis 16S-specific primers. Genomic DNA extracted from P. gingivalis was also subjected to PCR as a positive control (PC). Pg, P. gingivalis.
fimA mutant failed to accelerate atherosclerosis (Gibson et al. 2004; Miyamoto et al. 2006). Although their data support the hypothesis that both the WT strain and fimA mutant can gain access to the vasculature and aorta, the fimA mutant failed to elicit the induction of inflammatory molecules by the endothelium. Our data also demonstrate the existence of P. gingivalis DNA in the aorta, gingival tissues and spleen of the WT-challenged mice, suggesting that P. gingivalis gained access to the systemic circulation and remote organs, including the aorta, from gingival tissues, and may have induced vascular lesions followed by the formation of early atheromatous plaque in the aortic arch. In contrast, the rate of P. gingivalis detection in each organ was decreased in KDP136- and KDP150-challenged mice. These re-
sults suggest that virulence factors (e.g. fimbriae > gingipain) are important for bacterial dissemination, cell invasion and bacterial survival within blood vessels. Indeed, as gingipains are responsible for FimA maturation (Kato et al. 2007), gingipain mutants are likely to have fewer fimbriae. Porphyromonas gingivalis has been found in human atherosclerotic plaques (Chiu 1999; Sambri et al. 2004), indicating dissemination of the pathogen via the circulation, with an ability to interact with and activate platelets via Toll-like receptors (TLRs) and protease-activated receptors (PARs). A previous study showed that gingipains activate platelets via PARs (Lourbakos et al. 2001). Porphyromonas gingivalis surface molecules such as fimbriae and LPS also bind TLR2 on platelets, further strengthening platelets as bacterial sensors in
Yamaguchi et al.
the circulation (Blair et al. 2009; Jain et al. 2013). The degradation of immunoglobulins is also an effective immune-evasion strategy of bacteria. Gingipains degrade collagen and fibronectin, inactivate the complement system and degrade immunoglobulins. Therefore, these factors may sustain bacterial viability during bacteremia, which can occur as a result of surgery, tooth brushing and other dental procedures. The NLRP3 inflammasome, the best-characterized member of the inflammasome family, is a multi-protein complex that induces maturation of the inflammatory cytokines IL-1β and IL-18 through the activation of caspase-1 (Latz, Xiao and Stutz 2013). Specifically, NLRP3 proteins are upregulated in gingival tissues from periodontitis patients (Park et al. 2014) and in the aorta of coronary atherosclerosis patients (Zheng et al. 2013). A challenge with KDP136 or KDP150 could not activate all NLRP3related molecules in gingival tissue and the aorta, and it induced less IL-1β and TNF-α production compared with WT P. gingivalis, suggesting that gingipains and fimbriae are important virulence factors in NLRP3-inflammasome activation, followed by inflammatory cytokine production. Indeed, major fimbriae from P. gingivalis induced inflammatory cytokine production by murine peritoneal macrophages and monocytes (Hajishengallis et al. 2004). Furthermore, gingipains from P. gingivalis induced proinflammatory cytokine production in macrophages (Fitzpatrick et al. 2009). On the other hand, a previous report indicated that NLRP3-related proteins were not secreted into the culture medium due to degradation of the proteins by P. gingivalis protease, even if their expression was elevated (Huck et al. 2015). However, in our experiment, sufficient levels of IL-1β and TNF-α were produced in cultured macrophages by repeated infection with P. gingivalis in vivo. Since the in vitro culture of macrophages is performed using a closing system and an extended culture period, the direct effect of proteases may not reflect in vivo competence. Actually, elevated levels of IL-1β can be found in diseased periodontal tissue and gingival crevicular fluid, as well as in saliva (Kaushik, Yeltiwar and Pushpanshu 2011; Konopka, Pietrzak and Brzezinska-Blaszczyk 2012; Park et al. 2014). In this study, an oral challenge with WT P. gingivalis in Apoeshl mice induced significantly greater alveolar bone loss compared with CMC-treated controls. In contrast, a challenge with KDP136 or KDP150 resulted in a significantly lower bone resorption titer than a challenge with WT P. gingivalis. Further, KDP150challenge induced periodontal bone resorption comparable as control. A previous study showed that type I fimbriated Pg 33277 caused significantly more bone loss than its isogenic FimA(-) mutant (Wang et al. 2009). These results suggest that fimbriae indeed endow P. gingivalis with increased invasive and proinflammatory capacity, leading to periodontal destruction. Our results also suggest that the bone resorption pattern of each group is correlated with the arteriosclerotic plaque formation pattern. In summary, this study demonstrates that P. gingivalis induce NLRP3 inflammasome activation that results in a sustained inflammation and promotes atherosclerosis and periodontal disease. Furthermore, our data suggest that bacterial surface proteins such as fimbriae and gingipain are involved in cell adherence, invasion and survival followed by the induction and sustained of aortic or gingival inflammation.
ACKNOWLEDGEMENTS The authors are grateful to Drs Tomomi Hashizume-Takizawa and Mio Hagiwara for their technical assistance.
7
FUNDING This study was supported by Grants-in-Aid for Scientific Research (26463145) from the Japan Society for the Promotion of Science, ‘Strategic Research Base Development’ Program (Japan [MEXT], 2010–2014 [S1001024]) for Private Universities of the Ministry of Education, Culture, Sports, Science and Technology, Japan (3107), and through the Nihon University Multidisciplinary Research Grant for 2014. Conflict of interest statement. None declared.
REFERENCES Ather JL, Ckless K, Martin R, et al. Serum amyloid A activates the NLRP3 inflammasome and promotes Th17 allergic asthma in mice. J Immunol 2011;187:64–73. Becker CE, O’Neill LA. Inflammasomes in inflammatory disorders: the role of TLRs and their interactions with NLRs. Semiin Immunopathol 2007;29:239–48. Blair P, Rex S, Vitseva O, et al. Stimulation of Toll-like receptor 2 in human platelets induces a thromboinflammatory response through activation of phosphoinositide 3-kinase. Circ Res 2009;104:346–54. Bostanci N, Belibasakis GN. Porphyromonas gingivalis: an invasive and evasive opportunistic oral pathogen. FEMS Microbiol Lett 2012;333:1–9. Braddock M, Quinn A. Targeting IL-1 in inflammatory disease: new opportunities for therapeutic intervention. Nat Rev Drug discov 2004;3:330–9. Chiu B. Multiple infections in carotid atherosclerotic plaques. Am Heart J 1999;138:S534–6. Darveau RP, Hajishengallis G, Curtis MA. Porphyromonas gingivalis as a potential community activist for disease. J Dent Res 2012;91:816–20. De Nardo D, Latz E. NLRP3 inflammasomes link inflammation and metabolic disease. Trends Immunol 2011;32:373–9. Duewell P, Kono H, Rayner KJ, et al. NLRP3 inflammasomes are required for atherosclerosis and activated by cholesterol crystals. Nature 2010;464:1357–61. Epstein SE, Zhou YF, Zhu J. Infection and atherosclerosis: emerging mechanistic paradigms. Circulation 1999;100:e20–8. Fitzpatrick RE, Aprico A, Wijeyewickrema LC, et al. High molecular weight gingipains from Porphyromonas gingivalis induce cytokine responses from human macrophage-like cells via a nonproteolytic mechanism. J Innate Immun 2009;1:109–17. Gibson FC III,Hong C, Chou HH, et al. Innate immune recognition of invasive bacteria accelerates atherosclerosis in apolipoprotein E-deficient mice. Circulation 2004;109:2801–6. Hajishengallis G, Liang S, Payne MA, et al. Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and complement. Cell Host Microbe 2011;10:497–506. Hajishengallis G, Sojar H, Genco RJ, et al. Intracellular signaling and cytokine induction upon interactions of Porphyromonas gingivalis fimbriae with pattern-recognition receptors. Immunol Invest 2004;33:157–72. Huck O, Elkaim R, Davideau JL, et al. Porphyromonas gingivalisimpaired innate immune response via NLRP3 proteolysis in endothelial cells. Innate Immun 2015;21:65–72. Jain S, Coats SR, Chang AM, et al. A novel class of lipoprotein lipase-sensitive molecules mediates Toll-like receptor 2 activation by Porphyromonas gingivalis. Infect Immun 2013;81:1277– 86.
8
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Kanneganti TD, Ozoren N, Body-Malapel M, et al. Bacterial RNA and small antiviral compounds activate caspase-1 through cryopyrin/Nalp3. Nature 2006;440:233–6. Kato T, Tsuda T, Omori H, et al. Maturation of fimbria precursor protein by exogenous gingipains in Porphyromonas gingivalis gingipain-null mutant. FEMS Microbiol Lett 2007;273:96–102. Kaushik R, Yeltiwar RK, Pushpanshu K. Salivary interleukin1beta levels in patients with chronic periodontitis before and after periodontal phase I therapy and healthy controls: a case-control study. J Periodontol 2011;82:1353–9. Koizumi Y, Kurita-Ochiai T, Oguchi S, et al. Nasal immunization with Porphyromonas gingivalis outer membrane protein decreases P. gingivalis-induced atherosclerosis and inflammation in spontaneously hyperlipidemic mice. Infect Immun 2008;76:2958–65. Konopka L, Pietrzak A, Brzezinska-Blaszczyk E. Effect of scaling and root planing on interleukin-1beta, interleukin-8 and MMP-8 levels in gingival crevicular fluid from chronic periodontitis patients. J Periodontal Res 2012;47:681–8. Kummer JA, Broekhuizen R, Everett H, et al. Inflammasome components NALP 1 and 3 show distinct but separate expression profiles in human tissues suggesting a site-specific role in the inflammatory response. J Histochem Cytochem 2007;55:443–52. Latz E, Xiao TS, Stutz A. Activation and regulation of the inflammasomes. Nat Rev Immunol 2013;13:397–411. Libby P, Ridker PM, Maseri A. Inflammation and atherosclerosis. Circulation 2002;105:1135–43. Lourbakos A, Yuan YP, Jenkins AL, et al. Activation of proteaseactivated receptors by gingipains from Porphyromonas gingivalis leads to platelet aggregation: a new trait in microbial pathogenicity. Blood 2001;97:3790–7. Mariathasan S, Weiss DS, Newton K, et al. Cryopyrin activates the inflammasome in response to toxins and ATP. Nature 2006;440:228–32. Martinon F, Agostini L, Meylan E, et al. Identification of bacterial muramyl dipeptide as activator of the NALP3/cryopyrin inflammasome. Curr Biol 2004;14:1929–134. Matsushima Y, Sakurai T, Ohoka A, et al. Four strains of spontaneously hyperlipidemic (SHL) mice: phenotypic distinctions determined by genetic backgrounds. J Atheroscler Thromb 2001;8:71–9. Miyamoto T, Yumoto H, Takahashi Y, et al. Pathogen-accelerated atherosclerosis occurs early after exposure and can be prevented via immunization. Infect Immun 2006;74: 1376–80.
Momoi F, Hashizume T, Kurita-Ochiai T, et al. Nasal vaccination with the 40-kilodalton outer membrane protein of Porphyromonas gingivalis and a nontoxic chimeric enterotoxin adjuvant induces long-term protective immunity with reduced levels of immunoglobulin E antibodies. Infect Immun 2008;76:2777–84. Park E, Na HS, Song YR, et al. Activation of NLRP3 and AIM2 inflammasomes by Porphyromonas gingivalis infection. Infect Immun 2014;82:112–23. Petrasek J, Bala S, Csak T, et al. IL-1 receptor antagonist ameliorates inflammasome-dependent alcoholic steatohepatitis in mice. J Clin Invest 2012;122:3476–89. Pontillo A, Girardelli M, Agostinis C, et al. Bacterial LPS differently modulates inflammasome gene expression and IL-1beta secretion in trophoblast cells, decidual stromal cells, and decidual endothelial cells. Reprod Sci 2013;20:563–6. Sambri V, Marangoni A, Cavrini F, et al. Need for procedural details in detection of periodontopathic bacterial DNA in the atheromatous plaque by PCR. J Clin Microbiol 2004;42: 4914–5. Socransky SS, Haffajee AD, Cugini MA, et al. Microbial complexes in subgingival plaque. J Clin Periodontol 1998;25: 134–44. Taniguchi A, Nishimura F, Murayama Y, et al. Porphyromonas gingivalis infection is associated with carotid atherosclerosis in non-obese Japanese type 2 diabetic patients. Metabolism 2003;52:142–5. Wada K, Kamisaki Y. Roles of oral bacteria in cardiovascular diseases—from molecular mechanisms to clinical cases: Involvement of Porphyromonas gingivalis in the development of human aortic aneurysm. J Pharmacol Sci 2010;113:115–9. Wang M, Liang S, Hosur KB, et al. Differential virulence and innate immune interactions of Type I and II fimbrial genotypes of Porphyromonas gingivalis. Oral Microbiol Immunol 2009;24:478–84. Zhang T, Kurita-Ochiai T, Hashizume T, et al. Aggregatibacter actinomycetemcomitans accelerates atherosclerosis with an increase in atherogenic factors in spontaneously hyperlipidemic mice. FEMS Immunol Med Microbiol 2010;59:143–51. Zheng F, Xing S, Gong Z, et al. NLRP3 inflammasomes show high expression in aorta of patients with atherosclerosis. Heart Lung Circ 2013;22:746–50. Zheng F, Xing S, Gong Z, et al. Silence of NLRP3 suppresses atherosclerosis and stabilizeds plaques in apolipoprotein E-deficient mice. Mediat Inflamm 2014;507208, doi: 10.1155/ 2014/507208.
