Proc. Natl. Acad. Sci. USA Vol. 89, pp. 2091-2095, March 1992 Developmental Biology
Activation of the cytotactin promoter by the homeobox-containing gene Evx-1 (morphogenesis/extracellular matrix/phorbol 12-O-tetradecanoate 13-acetate response element/homeodomain/growth factors)
FREDERICK S. JONES*, GEORGES CHALEPAKISt, PETER GRUSSt,
AND
GERALD M. EDELMAN*
*Laboratory of Developmental and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10021; and tDepartment of Molecular Cell Biology, Max Planck Institute of Biophysical Chemistry, 3400 Gottingen, Federal Republic of Germany
Contributed by Gerald M. Edelman, December 17, 1991
during development in place-dependent patterns that correspond to morphologically significant boundaries (3-6). Cytotactin has been shown to affect a variety of processes including cell spreading or rounding, adhesion and repulsion, and neurite retraction; it can also modulate mitogenesis (4, 7-14). The multifunctionality of the molecule may reside in its modular structure (10, 15-19) that contains many independent binding domains. A key question is how the siterestricted expression of cytotactin is genetically controlled in a fashion sufficient to assure normal morphogenesis. Homeobox-containing genes appear to be excellent candidates for the control of such morphoregulatory molecules, given the evidence that they affect neighborhood-specific developmental patterns in various embryonic axes (20-24). We have described (25) modulation of the expression of N-CAM, the neural cell adhesion molecule, by Hox genes. The presence of sequence motifs resembling homeodomain binding sites in the 5' flanking sequence of the cytotactin gene prompted us to examine cytotactin in a similar fashion. We report here that Evx-J, a mouse homeobox gene most related to the pair-rule gene even-skipped (eve) from Drosophila melanogaster (26), induces the expression in NIH 3T3 cells of a chloramphenicol acetyltransferase (CAT) reporter gene driven by the chicken cytotactin promoter. Deletion analysis performed on the cytotactin promoter region localized the sequences that contributed to the activation to an 89-base-pair (bp) segment containing a phorbol 12-O-tetradecanoate 13-acetate response element (TRE)/ AP-1 element. This control element has been shown to be a target for transcription factors encoded by the fos and jun gene families (27-29). Mutation of the TRE/AP-1 sequence abolished the ability of Evx-J to activate the promoter. The TRE/AP-1 element was also required to drive expression of the CAT reporter gene in chicken embryo fibroblasts, cells known to synthesize cytotactin. Furthermore, transfection with Evx-J obviated the requirement for the higher concentration of serum otherwise necessary to activate cytotactin promoter constructs containing the TRE/AP-1 site. These results, along with those obtained with the N-CAM promoter (25), provide support for the hypothesis that the expression of morphoregulatory molecules may be controlled by homeobox gene products. In addition, they raise the possibility that the cytotactin promoter modulation by Evx-J may involve a growth-factor signal transduction pathway.
Cytotactin is a morphoregulatory molecule of ABSTRACT the extracellular matrix affecting cell shape, division, and migration that appears in a characteristic and complex siterestricted pattern during embryogenesis. The promoter region of the gene that encodes chicken cytotactin contains a variety of potential regulatory sequences. These include putative binding sites for homeodomain proteins and a phorbol 12-0tetradecanoate 13-acetate response element (TRE)/AP-1 element, a potential target for transcription factors thought to be involved in growth-factor signal transduction. To determine the effects of homeobox-containing genes on cytotactin promoter activity, we conducted a series of cotransfection experiments on NIH 3T3 cells using cytotactin promoterchloramphenicol acetyltransferase (CAT) reporter gene constructs and plasmids driving the expression of mouse homeobox genes Evx-1 and Hox-1.3. Cotransfection with Evx-1 stimulated cytotactin promoter activity whereas cotransfection in control experiments with Hox-1.3 had no effect. To localize the sequences required for Evx-1 activation, we tested a series of deletions in the cytotactin promoter. An 89-base-pair region containing a consensus TRE/AP-1 element was found to be required for activation. An oligonucleotide segment containing this TRE/AP-1 site was found to confer Evx-l inducibility on a simian virus 40 minimal promoter; mutation of the TRE/AP-1 site abolished this activity. To explore the potential role of growth factors in cytotactin promoter activation, chicken embryo fibroblasts, which are known to synthesize cytotactin, were frnst transfected with cytotactin promoter constructs and cultured under minimal conditions in 1% fetal bovine serum. Although the cells exhibited only low levels of CAT activity under these conditions, cells exposed for 12 h to 10% (vol/vol) fetal bovine serum showed a marked increase in CAT activity. Cotransfection with Evx-1 and cytotactin promoter constructs of cells cultured in 1% fetal bovine serum was sufficient, however, to produce high levels of CAT activity. These findings are consistent with the hypothesis that Evx-1, a homeobox-containing gene, may activate the cytotactin promoter by a mechanism involving a growth-factor signal transduction pathway. More generally, the results support the hypothesis that the place-dependent expression of morphoregulatory molecules may depend upon local cues provided by homeobox genes and their encoded proteins.
During development, metamorphosis, and regeneration, a number of different morphoregulatory molecules mediating cell and substrate adhesion and junction formation are expressed in defined sequences (1). These molecules act to regulate primary cellular processes such as movement, division, and cell-cell communication in a place-dependent fashion (2). A remarkable example of such a molecule is cytotactin/tenascin, an extracellular matrix protein that appears
MATERIALS AND METHODS CAT gene reporter plasmids were constructed in BSCAT, a Bluescript vector (Stratagene) containing a 1.8-kilobase CAT gene, and also in commercially available pCAT-Basic and pCAT-Promoter vectors (Promega). Restriction fragments
The publication costs of this article were defrayed in part by page charge
Abbreviations: CAT, chloramphenicol acetyltransferase; SV40, simian virus 40; CMV, cytomegalovirus; TRE, phorbol 12-0tetradecanoate 13-acetate response element.
payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
2091
Developmental Biology: Jones et al.
2092 1
2
3
4
5
6
7
8
9 10 11 12
0
S.0 *.. -*
*
Proc. Natl. Acad. Sci. USA 89 (1992)
f
@[email protected].
FIG. 1. Activation of cytotactin promoter activity in NIH 3T3 cells after cotransfection with Evx-1. NIH 3T3 cells were cotransfected with 10 ,ug of reporter gene plasmid and with various amounts of homeobox gene expression plasmids. Cells were harvested 72 h after transfection and assayed for CAT activity. Reporter plasmids for cotransfections were added as follows: CTP7-CAT (lanes 1-9), BSCAT (lanes 10 and 11), and SV40 promoter/enhancer-BSCAT (lane 12). Homeobox gene expression plasmids were transfected in the following concentrations. CMV-Evx-1, 1 jg (lane 2), 2 ,ug (lane
3), 5 ,ug (lane 4), and 10 ,ug (lanes 5 and 10); ,BA-Hox-1.3, 1 ,ug (lane
6), 2 ,ug (lane 7), 5 ug (lane 8), and 10 ,ug (lanes 9 and 11).
from the 5' end and upstream flanking region of the chicken cytotactin gene that were used to prepare reporter constructs were derived from plasmids as described (30). Reporter constructs were designated according to the cytotactin promoter segments used; the numbers in parentheses refer to positions either upstream (-) or downstream (+) from the site of transcription initiation. Reporters used in this study were as follows: CTP7-CAT (-3986 to +374), CTP12-CAT (-1477 to -201), CTP4-CAT (-1312 to +270), CTP3-CAT (-936 to +121), CTP2-CAT (-289 to +374), and CTP14CAT (-201 to +121). In addition, one or two copies of a segment (positions -329 to -263) containing the TRE/AP-1 site from the cytotactin promoter region were inserted into the pCAT-Promoter vector. These reporters were designated CT-TRE1-CAT and CT-TRE2-CAT, respectively. Mutations were made in the TRE/AP-1 site within this 67-bp segment. The variant of the oligonucleotide was inserted into the pCAT-Promoter vector, giving rise to the reporter CTTREm-CAT. All oligonucleotides were synthesized, annealed, and ligated as described (25).
Mouse homeobox genes Evx-J and Hox-1.3 were inserted into cytomegalovirus (CMV) and 83-actin promoter vectors, respectively. In cotransfection experiments, these plasmids, designated CMV-Evx-1 and fBA-Hox-1.3, were used as producers of the homeodomain proteins in situ. Test DNAs were transfected into cells with Bluescript carrier DNA, as described (25). NIH 3T3 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10%o (vol/vol) calf serum. Chicken embryo fibroblasts were prepared from 11-day body walls as described (31). Transfectants were harvested 36-72 h after transfection and assayed for CAT activity. Cells were cotransfected with 5 jg of RSV-f3galactosidase plasmid DNA and extracts were normalized for internal fB-galactosidase activity as described (25). DNase I footprinting was performed using the fushi tarazu (ftz) homeodomain protein as described (32).
RESULTS Activation of the Cytotactin Promoter by Evx-1. To test whether Evx-1 or Hox-1.3 genes could affect the activity of the cytotactin promoter, NIH 3T3 cells were cotransfected with the cytotactin promoter-CAT reporter gene plasmid CTP7-CAT and either the CMV-Evx-l or the /BA-Hox-1.3 expression plasmids and were then assayed for CAT activity. Cells transfected with CMV-Evx-l had significant CAT activity driven by the cytotactin promoter (Fig. 1, compare lanes 2-5 to lane 1) but controls transfected with Hox-1.3 showed no detectable CAT activity (Fig. 1, compare lanes 6-9 to lane 1). Analysis of the Cis Sequences Required for Evx-1 Activation. To define further the regions of the cytotactin promoter that were critical for Evx-1 activation, cytotactin promoter deletion constructs (Fig. 2) were tested for their ability to be activated by CMV-Evx-l after cotransfection in NIH 3T3 cells. NIH 3T3 cells transfected with each of five cytotactin promoter deletion constructs (CTP12-CAT, CTP4-CAT, CTP3-CAT, CTP2-CAT, and CTP14-CAT) showed no detectable CAT activity (Fig. 3A, lanes 1-5). When cotransfected with CMV-Evx-1, however, cells showed significant CAT activity in four out of the five cytotactin promoter constructs tested. The CTP12-CAT, CTP4-CAT, CTP3CAT, and CTP2-CAT constructs all drove high levels of CAT activity (Fig. 3B, lanes 1-4, respectively). Cells transfected with CTP14-CAT (positions -201 to + 121), however, -201
-1477
+270
-1312
-936
+121
+374
-289 .i +121 -201
SsU
ECoRl
Psti
Sspl
SPI
Sphl
Pstl
i
/ Sstl Clal I
gaTCCTGATAATGCACTCTGCTGATGCTGTAAGGAAAATATTCCTClITTCTGAGTCAT TGCCCTGAG GACTAGGACGTGAGACGACTACGACATTCCTTTTATAAGGAGAAAGACTCAGTAAACGGGACTC cag TRE/AP-1
FIG. 2. Partial restriction map of the 5' flanking sequence, the first exon (solid box), and part of the first intron of the chicken cytotactin gene. Drawn above the map are five segments of DNA tested in CAT reporter constructs for activation by Evx-1. From top to bottom, they are designated CTP12-CAT, CTP4-CAT, CTP3-CAT, CTP2-CAT, and CTP14-CAT. Map numbers refer to the relative position 5' (-) or 3' (+) of the transcriptional start site. An open box drawn below the map demarcates the 67-bp segment of DNA (positions -329 to -263) from which oligonucleotides were made. DNA sequence of the region is shown highlighting the TRE/AP-1 site (shaded box) and mutations made within the site (individual base-pair substitutions are circled).
Developmental Biology: Jones et al.
Proc. Natl. Acad. Sci. USA 89 (1992)
A 1
2093
B 2
3
4
5
6
7
8
9 10
1
2
3
4
5
6
7
8
9 10
*.
*
.@ @,.
- Evx-1
+ Evx-1
FIG. 3. Cis sequences required in the cytotactin gene 5' flanking sequence required for activation by Evx-J. NIH 3T3 cells were transfected with 10 Ag of the following reporter plasmids: CTP12-CAT (lanes 1), CTP4-CAT (lanes 2), CTP3-CAT (lanes 3), CTP2-CAT (lanes 4), CTP14-CAT (lanes 5), CT-TRE1-CAT (lanes 6), CT-TRE2-CAT (lanes 7), CT-TREM-CAT (lanes 8), pCAT-Basic (lanes 9), and pCATPromoter (lanes 10). Cells either received no CMV-Evx-1 (A) or were cotransfected with 10 Ag of CMV-Evx-1 (B). Cells were harvested 60 h after transfection and assayed for CAT activity.
showed no CAT activity when transfected with CMV-Evx-J (Fig. 3B, lane 5). These results suggest that cis sequence elements between positions -289 and -201 are required for activation of cytotactin promoter activity by Evx-J. This small segment of DNA was scanned for sequence motifs known to regulate gene expression in other systems. As shown in Fig. 2, one prominent sequence, a TRE/AP-1 element (27-29) was found within the region of positions -289 to -201, centered at position -277. An oligonucleotide segment of 67 bp (positions -329 to -263 in the cytotactin promoter region) containing the TRE/AP-1 element (Fig. 2) was cloned upstream of a minimal simian virus 40 (SV40) early promoter and CAT reporter gene. Plasmids containing one or two copies of this sequence (CT-TRE1-CAT and CT-TRE2-CAT) were tested for their ability to confer Evx-J inducibility on an SV40 early minimal promoter. Cells transfected alone with the CTTRE1-CAT and CT-TRE2-CAT constructs showed no detectable CAT activity (Fig. 3A, lanes 6 and 7, respectively). However, when cotransfected with CMV-Evx-J, cells exhibited high levels of CAT activity using either of the CT-TRECAT constructs (Fig. 3B, lanes 6 and 7). To test whether the TRE/AP-1 site was required for activation by Evx-J, a minimal promoter-CAT gene reporter was constructed containing the 67-bp segment with 4-bp substitutions in the TRE/AP-1 site (see Fig. 2). Cells transfected with this plasmid, CT-TREM-CAT, had no detectable CAT activity either without or with cotransfected CMVEvx-J plasmid (Fig. 3 A and B, lanes 8). Stimulation of Cytotactin Promoter Activity by Serum and by Evx-1 in Chicken Embryo Fibroblasts: Dependence on the TRE/AP-1 Site. The TRE/AP-1 site is known to be the target
A
for transcriptional regulators encoded by thefos and jun gene families (27-29). It mediates responsiveness to a number of external stimuli of a battery of target genes whose promoters contain this element. These stimuli include growth-factor signals (33). The patterns of cytotactin/tenascin synthesis during embryogenesis reflect temporal growth gradients and it appears that local signals secreted by proliferating cells can induce the synthesis of cytotactin in neighboring cells (3, 5-7). Although it has been shown that growth factors present in serum increase the levels of cytotactin produced by chicken embryo fibroblasts (16), it is unknown whether serum stimulates transcription of the gene. We therefore tested the ability of serum to activate the cytotactin promoter and then examined whether the TRE/AP-1 element mediated the response. Cytotactin promoter constructs were transfected into chicken embryo fibroblasts and either cultured in 1% fetal bovine serum for 36 h (Fig. 4A) or cultured in medium with 1% fetal bovine serum for 24 h and then stimulated with 10o fetal bovine serum for an additional 12 h (Fig. 4B). Transfectants cultured in 1% fetal bovine serum (Fig. 4A, lanes 1-9) showed low levels of CAT activity. Cells transfected with CTP12CAT, CTP4-CAT, CTP3-CAT, CTP2-CAT, and CT-TRECAT reporter constructs and stimulated with 10%o fetal bovine serum showed a 5- to 10-fold increase in CAT activity as compared to cells transfected with the same constructs that were cultured in 1% fetal bovine serum (Fig. 4, compare lanes 1-4 and 6 in B and A). Cells transfected with CTP14-CAT and CT-TREm-CAT (constructs that do not contain the TRE/ AP-1 site) showed no CAT activity above background levels when cultured either in 1% fetal bovine serum or when
C
B
1 2 3 4 5 6 7 8 9
1 2 3 4 5 6 7 8 9
1 2 3 4 5 6
7 8 9
dboAb
gpsqp .i4
*O
0 *
40
a
*
S
a*
0 o0
0
o
a
*
o
*
*.&
4
0
FIG. 4. Serum and Evx-J stimulation of cytotactin promoter activity in chicken embryo fibroblasts. CAT activity assay of extracts from cells transfected with 10 .g of the following constructs: CTP12-CAT (lanes 1), CTP4-CAT (lanes 2), CTP3-CAT (lanes 3), CTP2-CAT (lanes 4), CTP14-CAT (lanes 5), CT-TRE1-CAT (lanes 6), CT-TREM-CAT (lanes 7), pCAT-Basic (lanes 8), and pCAT-Promoter (lanes 9). Cells were cultured in medium with 1% fetal bovine serum for 36 h and harvested (A); cultured in medium with 1% fetal bovine serum for 24 h, switched to medium with 1o fetal bovine serum for another 12 h, and harvested (B); or cotransfected with 10 ,g of CMV-Evx-1, cultured with 1% fetal bovine serum for 36 h, and harvested (C).
2094
_
Developmental Biology: Jones et al.
stimulated with 10% fetal bovine serum (Fig. 4 A and B, compare lanes 5 and 7 to lanes 8 and 9). Only those constructs that were driven by cytotactin segments that had a TRE/AP-1 element were found to have CAT activity (Fig. 4A) or to be inducible by serum (Fig. 4B). Induction by high doses of serum was not required, however, when cells were transfected with Evx-1. Thus, chicken embryo fibroblasts cotransfected with reporter constructs plus CMV-Evx-1 and cultured in 1% fetal bovine serum for 36 h (Fig. 4C) produced levels of CAT activity comparable to those from cells that were stimulated with fetal bovine serum (Fig. 4, compare CAT activity levels in C and B). As above, only those reporter constructs that contained the TRE/AP-1 site were activated by Evx-1. These results suggest that the presence of Evx-J can substitute for high doses of serum and confirm that responses by the cytotactin promoter are mediated by the TRE/AP-1 site. An Antennapedia-Type Homeodomain Binds to Cis Sequences Located Upstream of the First Exon of the Cytotactin Gene. Although activation of the cytotactin promoter in some cells occurs through a TRE/AP-1 element, sequence analysis of the 5' flanking region of the chicken cytotactin gene (30) has uncovered putative sites for the binding of homeodomain proteins. Two motifs, each having a consensus sequence characteristic of antennapedia-type homeodomain binding sites (34, 35), appeared to be arranged in tandem at positions -1362 and -1356 bp upstream of the transcription initiation site (Fig. SC). To test whether these sites could bind homeodomain proteins, they were assayed for binding to the fushi tarazu homeodomain by DNase I footprinting. As shown in Fig. 5, the homeodomain protects the tandem homeodomain binding sites on both the upper (Fig. 5A) and lower (Fig. 5B) strands. Maximal protection and enhancement were obB
2 3 4
1 _
1 2 3 4 ____LAm
owl.. I_ 64.O.
WI
-1-
_&
__MOV
asmo
AI
77"' -I7-
_
wi :S
C
o
wow......
Activation of the cytotactin promoter by the homeobox-containing gene Evx-1 (morphogenesis/extracellular matrix/phorbol 12-O-tetradecanoate 13-acetate response element/homeodomain/growth factors)
FREDERICK S. JONES*, GEORGES CHALEPAKISt, PETER GRUSSt,
AND
GERALD M. EDELMAN*
*Laboratory of Developmental and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10021; and tDepartment of Molecular Cell Biology, Max Planck Institute of Biophysical Chemistry, 3400 Gottingen, Federal Republic of Germany
Contributed by Gerald M. Edelman, December 17, 1991
during development in place-dependent patterns that correspond to morphologically significant boundaries (3-6). Cytotactin has been shown to affect a variety of processes including cell spreading or rounding, adhesion and repulsion, and neurite retraction; it can also modulate mitogenesis (4, 7-14). The multifunctionality of the molecule may reside in its modular structure (10, 15-19) that contains many independent binding domains. A key question is how the siterestricted expression of cytotactin is genetically controlled in a fashion sufficient to assure normal morphogenesis. Homeobox-containing genes appear to be excellent candidates for the control of such morphoregulatory molecules, given the evidence that they affect neighborhood-specific developmental patterns in various embryonic axes (20-24). We have described (25) modulation of the expression of N-CAM, the neural cell adhesion molecule, by Hox genes. The presence of sequence motifs resembling homeodomain binding sites in the 5' flanking sequence of the cytotactin gene prompted us to examine cytotactin in a similar fashion. We report here that Evx-J, a mouse homeobox gene most related to the pair-rule gene even-skipped (eve) from Drosophila melanogaster (26), induces the expression in NIH 3T3 cells of a chloramphenicol acetyltransferase (CAT) reporter gene driven by the chicken cytotactin promoter. Deletion analysis performed on the cytotactin promoter region localized the sequences that contributed to the activation to an 89-base-pair (bp) segment containing a phorbol 12-O-tetradecanoate 13-acetate response element (TRE)/ AP-1 element. This control element has been shown to be a target for transcription factors encoded by the fos and jun gene families (27-29). Mutation of the TRE/AP-1 sequence abolished the ability of Evx-J to activate the promoter. The TRE/AP-1 element was also required to drive expression of the CAT reporter gene in chicken embryo fibroblasts, cells known to synthesize cytotactin. Furthermore, transfection with Evx-J obviated the requirement for the higher concentration of serum otherwise necessary to activate cytotactin promoter constructs containing the TRE/AP-1 site. These results, along with those obtained with the N-CAM promoter (25), provide support for the hypothesis that the expression of morphoregulatory molecules may be controlled by homeobox gene products. In addition, they raise the possibility that the cytotactin promoter modulation by Evx-J may involve a growth-factor signal transduction pathway.
Cytotactin is a morphoregulatory molecule of ABSTRACT the extracellular matrix affecting cell shape, division, and migration that appears in a characteristic and complex siterestricted pattern during embryogenesis. The promoter region of the gene that encodes chicken cytotactin contains a variety of potential regulatory sequences. These include putative binding sites for homeodomain proteins and a phorbol 12-0tetradecanoate 13-acetate response element (TRE)/AP-1 element, a potential target for transcription factors thought to be involved in growth-factor signal transduction. To determine the effects of homeobox-containing genes on cytotactin promoter activity, we conducted a series of cotransfection experiments on NIH 3T3 cells using cytotactin promoterchloramphenicol acetyltransferase (CAT) reporter gene constructs and plasmids driving the expression of mouse homeobox genes Evx-1 and Hox-1.3. Cotransfection with Evx-1 stimulated cytotactin promoter activity whereas cotransfection in control experiments with Hox-1.3 had no effect. To localize the sequences required for Evx-1 activation, we tested a series of deletions in the cytotactin promoter. An 89-base-pair region containing a consensus TRE/AP-1 element was found to be required for activation. An oligonucleotide segment containing this TRE/AP-1 site was found to confer Evx-l inducibility on a simian virus 40 minimal promoter; mutation of the TRE/AP-1 site abolished this activity. To explore the potential role of growth factors in cytotactin promoter activation, chicken embryo fibroblasts, which are known to synthesize cytotactin, were frnst transfected with cytotactin promoter constructs and cultured under minimal conditions in 1% fetal bovine serum. Although the cells exhibited only low levels of CAT activity under these conditions, cells exposed for 12 h to 10% (vol/vol) fetal bovine serum showed a marked increase in CAT activity. Cotransfection with Evx-1 and cytotactin promoter constructs of cells cultured in 1% fetal bovine serum was sufficient, however, to produce high levels of CAT activity. These findings are consistent with the hypothesis that Evx-1, a homeobox-containing gene, may activate the cytotactin promoter by a mechanism involving a growth-factor signal transduction pathway. More generally, the results support the hypothesis that the place-dependent expression of morphoregulatory molecules may depend upon local cues provided by homeobox genes and their encoded proteins.
During development, metamorphosis, and regeneration, a number of different morphoregulatory molecules mediating cell and substrate adhesion and junction formation are expressed in defined sequences (1). These molecules act to regulate primary cellular processes such as movement, division, and cell-cell communication in a place-dependent fashion (2). A remarkable example of such a molecule is cytotactin/tenascin, an extracellular matrix protein that appears
MATERIALS AND METHODS CAT gene reporter plasmids were constructed in BSCAT, a Bluescript vector (Stratagene) containing a 1.8-kilobase CAT gene, and also in commercially available pCAT-Basic and pCAT-Promoter vectors (Promega). Restriction fragments
The publication costs of this article were defrayed in part by page charge
Abbreviations: CAT, chloramphenicol acetyltransferase; SV40, simian virus 40; CMV, cytomegalovirus; TRE, phorbol 12-0tetradecanoate 13-acetate response element.
payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
2091
Developmental Biology: Jones et al.
2092 1
2
3
4
5
6
7
8
9 10 11 12
0
S.0 *.. -*
*
Proc. Natl. Acad. Sci. USA 89 (1992)
f
@[email protected].
FIG. 1. Activation of cytotactin promoter activity in NIH 3T3 cells after cotransfection with Evx-1. NIH 3T3 cells were cotransfected with 10 ,ug of reporter gene plasmid and with various amounts of homeobox gene expression plasmids. Cells were harvested 72 h after transfection and assayed for CAT activity. Reporter plasmids for cotransfections were added as follows: CTP7-CAT (lanes 1-9), BSCAT (lanes 10 and 11), and SV40 promoter/enhancer-BSCAT (lane 12). Homeobox gene expression plasmids were transfected in the following concentrations. CMV-Evx-1, 1 jg (lane 2), 2 ,ug (lane
3), 5 ,ug (lane 4), and 10 ,ug (lanes 5 and 10); ,BA-Hox-1.3, 1 ,ug (lane
6), 2 ,ug (lane 7), 5 ug (lane 8), and 10 ,ug (lanes 9 and 11).
from the 5' end and upstream flanking region of the chicken cytotactin gene that were used to prepare reporter constructs were derived from plasmids as described (30). Reporter constructs were designated according to the cytotactin promoter segments used; the numbers in parentheses refer to positions either upstream (-) or downstream (+) from the site of transcription initiation. Reporters used in this study were as follows: CTP7-CAT (-3986 to +374), CTP12-CAT (-1477 to -201), CTP4-CAT (-1312 to +270), CTP3-CAT (-936 to +121), CTP2-CAT (-289 to +374), and CTP14CAT (-201 to +121). In addition, one or two copies of a segment (positions -329 to -263) containing the TRE/AP-1 site from the cytotactin promoter region were inserted into the pCAT-Promoter vector. These reporters were designated CT-TRE1-CAT and CT-TRE2-CAT, respectively. Mutations were made in the TRE/AP-1 site within this 67-bp segment. The variant of the oligonucleotide was inserted into the pCAT-Promoter vector, giving rise to the reporter CTTREm-CAT. All oligonucleotides were synthesized, annealed, and ligated as described (25).
Mouse homeobox genes Evx-J and Hox-1.3 were inserted into cytomegalovirus (CMV) and 83-actin promoter vectors, respectively. In cotransfection experiments, these plasmids, designated CMV-Evx-1 and fBA-Hox-1.3, were used as producers of the homeodomain proteins in situ. Test DNAs were transfected into cells with Bluescript carrier DNA, as described (25). NIH 3T3 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10%o (vol/vol) calf serum. Chicken embryo fibroblasts were prepared from 11-day body walls as described (31). Transfectants were harvested 36-72 h after transfection and assayed for CAT activity. Cells were cotransfected with 5 jg of RSV-f3galactosidase plasmid DNA and extracts were normalized for internal fB-galactosidase activity as described (25). DNase I footprinting was performed using the fushi tarazu (ftz) homeodomain protein as described (32).
RESULTS Activation of the Cytotactin Promoter by Evx-1. To test whether Evx-1 or Hox-1.3 genes could affect the activity of the cytotactin promoter, NIH 3T3 cells were cotransfected with the cytotactin promoter-CAT reporter gene plasmid CTP7-CAT and either the CMV-Evx-l or the /BA-Hox-1.3 expression plasmids and were then assayed for CAT activity. Cells transfected with CMV-Evx-l had significant CAT activity driven by the cytotactin promoter (Fig. 1, compare lanes 2-5 to lane 1) but controls transfected with Hox-1.3 showed no detectable CAT activity (Fig. 1, compare lanes 6-9 to lane 1). Analysis of the Cis Sequences Required for Evx-1 Activation. To define further the regions of the cytotactin promoter that were critical for Evx-1 activation, cytotactin promoter deletion constructs (Fig. 2) were tested for their ability to be activated by CMV-Evx-l after cotransfection in NIH 3T3 cells. NIH 3T3 cells transfected with each of five cytotactin promoter deletion constructs (CTP12-CAT, CTP4-CAT, CTP3-CAT, CTP2-CAT, and CTP14-CAT) showed no detectable CAT activity (Fig. 3A, lanes 1-5). When cotransfected with CMV-Evx-1, however, cells showed significant CAT activity in four out of the five cytotactin promoter constructs tested. The CTP12-CAT, CTP4-CAT, CTP3CAT, and CTP2-CAT constructs all drove high levels of CAT activity (Fig. 3B, lanes 1-4, respectively). Cells transfected with CTP14-CAT (positions -201 to + 121), however, -201
-1477
+270
-1312
-936
+121
+374
-289 .i +121 -201
SsU
ECoRl
Psti
Sspl
SPI
Sphl
Pstl
i
/ Sstl Clal I
gaTCCTGATAATGCACTCTGCTGATGCTGTAAGGAAAATATTCCTClITTCTGAGTCAT TGCCCTGAG GACTAGGACGTGAGACGACTACGACATTCCTTTTATAAGGAGAAAGACTCAGTAAACGGGACTC cag TRE/AP-1
FIG. 2. Partial restriction map of the 5' flanking sequence, the first exon (solid box), and part of the first intron of the chicken cytotactin gene. Drawn above the map are five segments of DNA tested in CAT reporter constructs for activation by Evx-1. From top to bottom, they are designated CTP12-CAT, CTP4-CAT, CTP3-CAT, CTP2-CAT, and CTP14-CAT. Map numbers refer to the relative position 5' (-) or 3' (+) of the transcriptional start site. An open box drawn below the map demarcates the 67-bp segment of DNA (positions -329 to -263) from which oligonucleotides were made. DNA sequence of the region is shown highlighting the TRE/AP-1 site (shaded box) and mutations made within the site (individual base-pair substitutions are circled).
Developmental Biology: Jones et al.
Proc. Natl. Acad. Sci. USA 89 (1992)
A 1
2093
B 2
3
4
5
6
7
8
9 10
1
2
3
4
5
6
7
8
9 10
*.
*
.@ @,.
- Evx-1
+ Evx-1
FIG. 3. Cis sequences required in the cytotactin gene 5' flanking sequence required for activation by Evx-J. NIH 3T3 cells were transfected with 10 Ag of the following reporter plasmids: CTP12-CAT (lanes 1), CTP4-CAT (lanes 2), CTP3-CAT (lanes 3), CTP2-CAT (lanes 4), CTP14-CAT (lanes 5), CT-TRE1-CAT (lanes 6), CT-TRE2-CAT (lanes 7), CT-TREM-CAT (lanes 8), pCAT-Basic (lanes 9), and pCATPromoter (lanes 10). Cells either received no CMV-Evx-1 (A) or were cotransfected with 10 Ag of CMV-Evx-1 (B). Cells were harvested 60 h after transfection and assayed for CAT activity.
showed no CAT activity when transfected with CMV-Evx-J (Fig. 3B, lane 5). These results suggest that cis sequence elements between positions -289 and -201 are required for activation of cytotactin promoter activity by Evx-J. This small segment of DNA was scanned for sequence motifs known to regulate gene expression in other systems. As shown in Fig. 2, one prominent sequence, a TRE/AP-1 element (27-29) was found within the region of positions -289 to -201, centered at position -277. An oligonucleotide segment of 67 bp (positions -329 to -263 in the cytotactin promoter region) containing the TRE/AP-1 element (Fig. 2) was cloned upstream of a minimal simian virus 40 (SV40) early promoter and CAT reporter gene. Plasmids containing one or two copies of this sequence (CT-TRE1-CAT and CT-TRE2-CAT) were tested for their ability to confer Evx-J inducibility on an SV40 early minimal promoter. Cells transfected alone with the CTTRE1-CAT and CT-TRE2-CAT constructs showed no detectable CAT activity (Fig. 3A, lanes 6 and 7, respectively). However, when cotransfected with CMV-Evx-J, cells exhibited high levels of CAT activity using either of the CT-TRECAT constructs (Fig. 3B, lanes 6 and 7). To test whether the TRE/AP-1 site was required for activation by Evx-J, a minimal promoter-CAT gene reporter was constructed containing the 67-bp segment with 4-bp substitutions in the TRE/AP-1 site (see Fig. 2). Cells transfected with this plasmid, CT-TREM-CAT, had no detectable CAT activity either without or with cotransfected CMVEvx-J plasmid (Fig. 3 A and B, lanes 8). Stimulation of Cytotactin Promoter Activity by Serum and by Evx-1 in Chicken Embryo Fibroblasts: Dependence on the TRE/AP-1 Site. The TRE/AP-1 site is known to be the target
A
for transcriptional regulators encoded by thefos and jun gene families (27-29). It mediates responsiveness to a number of external stimuli of a battery of target genes whose promoters contain this element. These stimuli include growth-factor signals (33). The patterns of cytotactin/tenascin synthesis during embryogenesis reflect temporal growth gradients and it appears that local signals secreted by proliferating cells can induce the synthesis of cytotactin in neighboring cells (3, 5-7). Although it has been shown that growth factors present in serum increase the levels of cytotactin produced by chicken embryo fibroblasts (16), it is unknown whether serum stimulates transcription of the gene. We therefore tested the ability of serum to activate the cytotactin promoter and then examined whether the TRE/AP-1 element mediated the response. Cytotactin promoter constructs were transfected into chicken embryo fibroblasts and either cultured in 1% fetal bovine serum for 36 h (Fig. 4A) or cultured in medium with 1% fetal bovine serum for 24 h and then stimulated with 10o fetal bovine serum for an additional 12 h (Fig. 4B). Transfectants cultured in 1% fetal bovine serum (Fig. 4A, lanes 1-9) showed low levels of CAT activity. Cells transfected with CTP12CAT, CTP4-CAT, CTP3-CAT, CTP2-CAT, and CT-TRECAT reporter constructs and stimulated with 10%o fetal bovine serum showed a 5- to 10-fold increase in CAT activity as compared to cells transfected with the same constructs that were cultured in 1% fetal bovine serum (Fig. 4, compare lanes 1-4 and 6 in B and A). Cells transfected with CTP14-CAT and CT-TREm-CAT (constructs that do not contain the TRE/ AP-1 site) showed no CAT activity above background levels when cultured either in 1% fetal bovine serum or when
C
B
1 2 3 4 5 6 7 8 9
1 2 3 4 5 6 7 8 9
1 2 3 4 5 6
7 8 9
dboAb
gpsqp .i4
*O
0 *
40
a
*
S
a*
0 o0
0
o
a
*
o
*
*.&
4
0
FIG. 4. Serum and Evx-J stimulation of cytotactin promoter activity in chicken embryo fibroblasts. CAT activity assay of extracts from cells transfected with 10 .g of the following constructs: CTP12-CAT (lanes 1), CTP4-CAT (lanes 2), CTP3-CAT (lanes 3), CTP2-CAT (lanes 4), CTP14-CAT (lanes 5), CT-TRE1-CAT (lanes 6), CT-TREM-CAT (lanes 7), pCAT-Basic (lanes 8), and pCAT-Promoter (lanes 9). Cells were cultured in medium with 1% fetal bovine serum for 36 h and harvested (A); cultured in medium with 1% fetal bovine serum for 24 h, switched to medium with 1o fetal bovine serum for another 12 h, and harvested (B); or cotransfected with 10 ,g of CMV-Evx-1, cultured with 1% fetal bovine serum for 36 h, and harvested (C).
2094
_
Developmental Biology: Jones et al.
stimulated with 10% fetal bovine serum (Fig. 4 A and B, compare lanes 5 and 7 to lanes 8 and 9). Only those constructs that were driven by cytotactin segments that had a TRE/AP-1 element were found to have CAT activity (Fig. 4A) or to be inducible by serum (Fig. 4B). Induction by high doses of serum was not required, however, when cells were transfected with Evx-1. Thus, chicken embryo fibroblasts cotransfected with reporter constructs plus CMV-Evx-1 and cultured in 1% fetal bovine serum for 36 h (Fig. 4C) produced levels of CAT activity comparable to those from cells that were stimulated with fetal bovine serum (Fig. 4, compare CAT activity levels in C and B). As above, only those reporter constructs that contained the TRE/AP-1 site were activated by Evx-1. These results suggest that the presence of Evx-J can substitute for high doses of serum and confirm that responses by the cytotactin promoter are mediated by the TRE/AP-1 site. An Antennapedia-Type Homeodomain Binds to Cis Sequences Located Upstream of the First Exon of the Cytotactin Gene. Although activation of the cytotactin promoter in some cells occurs through a TRE/AP-1 element, sequence analysis of the 5' flanking region of the chicken cytotactin gene (30) has uncovered putative sites for the binding of homeodomain proteins. Two motifs, each having a consensus sequence characteristic of antennapedia-type homeodomain binding sites (34, 35), appeared to be arranged in tandem at positions -1362 and -1356 bp upstream of the transcription initiation site (Fig. SC). To test whether these sites could bind homeodomain proteins, they were assayed for binding to the fushi tarazu homeodomain by DNase I footprinting. As shown in Fig. 5, the homeodomain protects the tandem homeodomain binding sites on both the upper (Fig. 5A) and lower (Fig. 5B) strands. Maximal protection and enhancement were obB
2 3 4
1 _
1 2 3 4 ____LAm
owl.. I_ 64.O.
WI
-1-
_&
__MOV
asmo
AI
77"' -I7-
_
wi :S
C
o
wow......
