Copyright 0 1991 by the Genetics Societyof America
Ac Induces Homologous Recombination at the MaizeP Locus Prasanna Athma and Thomas Peterson Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Manuscript received September 12, 1990 Accepted for publication January 12, 1991 ABSTRACT The maize P gene conditions red phlobaphene pigmentation to thepericarp and cob. Starting from two unstable P alleles which carry insertions of the transposable element Ac, we have derived 51 P null alleles; 47 of the 51 null alleles have a 17-kb deletion which removes the 4.5-kb Ac element and 12.5 kb of P sequences flanking both sidesof Ac. The deletion endpoints lie within two 5.2-kb homologous direct repeats which flank the P gene. A P allele which contains the direct repeats, but does not have an Ac insertion between the direct repeats,shows verylittle sporophytic or gametophytic instability. The apparent frequency of sporophytic mutations was not increased when Ac was introduced in trans. Southern analysis of DNA prepared from the pericarp tissue demonstrates that the deletions can occur premeiotically, in the somatic cells during development of the pericarp. Evidence is presented that the deletions occurred by homologous recombination between the two direct repeats, and that the presence of an Ac element at the P locus is associated with the recombination/deletion. These results add another aspect to the spectrum of activities of Ac: the destabilization of flanking direct repeat sequences.
T
RANSPOSABLE elements can induce genome reorganization by causing alterations such as deletions, duplications andotherrearrangements. One means by which transposons effect such rearrangements isby serving as dispersed sites of sequence homology for asymmetrical synapsis and homologous recombination. In Saccharomyces cerevisiae, homologous recombination between Ty elements producesdeletions, inversions and translocations (reviewed by BOEKE1989). In Drosophila, homologous recombination between transposons inserted in the same chromosome can lead to specific chromosomal rearrangements. For example, asymmetrical synapsis between roo transposons in and near the white locus results in duplications and deficiencies (DAVIS, SHEN andJuDD 1987). Additionally, recombination between copies of Drosophila I elements inserted in opposite orientations within and near theyellow gene can result in inversion of the intervening DNA (BUSSEAU, PELISSON and BUCHETON 1989). In Antirrhinummajus, the Tam3 transposable element has been shown to induce a variety of chromosomal rearrangements includingdeletions of various types, dispersions and inverted duplications (MARTIN, MACKAY and CARPENTER 1988). In the rearrangements described above, the transposons most likelyprovide homologous sequence substrates for thehost recombination enzymes. However, transposons can also induce deletions of various types by mechanism(s) which probably do not involve homologous recombination betweendispersed elements. In prokaryotes,deletions associated with insertion (kwticb
128: 163-173 (May, 1991)
sequences and transposons commonly extendfrom one end of the element to asite in the flanking DNA (reviewed in CALOSand MILLER 1980). A similar case of a large deletion flanking the Tam3 element at the nivea locusin Antirhinnum majus has recently been described (LISTERand MARTIN 1989). In maize, MCCLINTOCK (1953, 1954) found that cytologically detectabledeletions of the chromosomal regions flanking a Ds element could occur at low frequency. Flanking deletions associated with the maize transposons Ds,Mu and Ac have also been reported (DORING, GEISERand STARLINGER, 1198 ; TAYLOR and WALBOT 1985; DOONER, ENGLISHand RALSTON 1988). In this paper, we present evidence that the maize transposable element Ac is involved in the formation of large (17 kb) deletions at the P locus. The P gene, located on the short armof chromosome 1,is required for synthesis of a red flavonoid pigment in the pericarp, cob and other floral tissues (STYLES and CESKA 1977, 1989).We have studied a series of P null alleles derived from two unstable P alleles (P-vv and P-ovov) carrying insertions of Ac. Of 5 1 independently derived P null alleles examined,47 have large and similar deletions. Possible mechanisms whereby these deletions are generated arediscussed. MATERIALS AND METHODS
Terminology, maize stocks and generation of mutants: The maize P gene affects phlobaphene pigmentation of the pericarp, cob glumes, and otherfloral organs. The pericarp is the outer covering of the kernel; being the remnant of the ovary wall, the pericarp is of maternal origin. P alleles are conventionally identified by a suffix whichindicates their
P. Athma and T. Peterson
164 P-ovov-
x
P-ww
1
P-wr
p-Wr P-wr
P-ovov
"+
P-rr
selected white pericarp kernels
p-n
P-wr
P-w,
P-wr
1I
self pollinated kernels sown from light red cob
kernels sown from red ears
1
self pollinated
self pollinated
r.Sc :m 3
x
"w "P
,P * P-wr
self pollinated
1 R-S~:124varianI4 or
p-wr P-W,
p-wwp-w
1I
x
P-wr
R-Sc 3 2 4 variant 4 or
r-Sc :m 3
x p-n P-rr
FIGURE1 .-Diagram of the crosses used to isolate P-ww and P-rr nlutilnts from P-ovov. The P alleles are designated as follows:P-ovov = orange variegated pericarp and cob; P-ww = white pericarp and white cob; P-rr = redpericarp and red cob and P-wr = white pericarp and red cob. In the top line, the horizontal arrow indicates the mutation of P-ovov to P-ww or P-rr. The vertical arrows indicate the source of kernels for the succeeding generation.
expression in pericarp and cob. P-rr specifies red pericarp and red cob, P-wr specifies white (colorless) pericarp and red cob, and P-ww gives white (colorless) pericarp and cob. The P-vu allele, which conditions variegated pericarp and cob, contains the transposable element Ac inserted into a Prr allele (EMERSON 1917; BRINKand NILAN 1952; LECHELT et al. 1989). P - w mutated spontaneously to P-ouov, which specifies orange variegated pericarp and cob (PETERSON 1990). P-rr-4026 is a P-rr allele derived from P-ovov by excision of Ac. Inbred line W23 (genotype P-wr) was obtained from the Maize Genetics Cooperation Stock Center, Urbana, Illinois. Inbred line 4Co63 (genotype P-ww) was obtained from the National Seed Storage Laboratory, Fort Collins, Colorado. Stocks carrying P-vu were obtainedfrom TONYPRYOR, CSIRO, Canberra, Australia. P-ovov was derived from P-vu by intragenic transposition of Ac (PETERSON 1990). P-ww11 12 was derived as a spontaneous mutation from P-vu. All other P-ww mutants described here were derived from P ovov. The class ofP-ww mutants derived fromeither P-vu or P-ouou by a common 17-kb deletion (see below) are designated P-ww-d. The P-ww allele in 4Co63 is designated Pww[4Co63] to distinguish it from P-ww-d. P-ww-d mutants were derived from P-ovov as follows (Figure 1). M1 plants of the genotype P-ouou/P-wr were pollinated with pollen from plants homozygous for P-wr. The progeny ears were screenedfor kernels with sectors of altered pericarppigmentation. Because the pericarp and the egg cell are related by cell lineage, the mutant alleles can be recovered by growing kernels within mutant sectors. For sectors less than full kernel insize, kernels with mutant pericarp sectors overlying the embryo were selected, because these are known to have a high heritability relative to sectors over other parts of the kernel (ANDERSON and BRINK 1952). One kernel with altered pericarp pigmentation from each ear was grown and the M2 plants were self pollinated. Owing to Mendelian segregation at the meiotic divisions producing the egg cell, the genotypes of the M2 plants would be expected to be either P-ww*/P-wr (where P-ww* indicates a new P-ww allele of unknown structure derived from P-ovou) or P-wr/P-wr. In most cases the M2 plants of P-ww*/P-wr genotype could be recognized among the plants of P-wr/P-wr genotype by the intensity of cob pigmentation (BRINK1958). Kernels from the self-pollinated ears of M2 plants with lighter colored cobs (inferred genotype P-ww*/ P-wr) were sown. P-wr specifies dominant brown pigmenta-
tion in the hyaline margins of the tassel glumes, while P-ww givesrecessive colorless tassel glumes [E. COE, personal communication (Maize Genetics Cooperation Newsletter57: 3 3 , 58: 75, and59: 4 0 ) ;T. PETERSON (Maize Genetics Cooperation Newsletter 60: 3 6 ) ] . Thus, in the M 3 families, plants of Pww*/P-ww* genotype could often be identified among their P-ww*/P-wr and P-wr/P-wr siblings by the presence of colorless tassel glumes. M 3 plants with colorless tassel glumes were self-pollinated, and the resulting ears with colorless pericarp and cob were a source of homozygous P-ww* seed. However, in some M3 families (especiallythose derived from crosses with inbred B73) the identification of P-ww*/P-ww* plants was confounded by additional tassel pigmentation not specified by P . In these familiesall the plants were self pollinated and theears with colorless pericarp and cob were selected for further studies. Most cases ofP - m * mutants were derived from P-ovou as described above. However, in other cases the M I plants were of P-ovou/P-ww or P-ovov/P-wr genotype and were pollinated with pollen of either P-ww or P-wr genotype. Kernels with altered pericarp pigmentation were selected as above, and P-ww* mutations were made homozygous by selfing. These P-ww* mutations were distinguished from the parental P-ww[4Co63]or P-wr alleles by Southern blot analysis using P locus hybridization probes, since the Southern blot patterns of each allele are distinctive. Plants carrying new P-ww* and P-rr alleles were tested for the presence of Ac by crossing to one or both of the Ac tester stocks R-sc:124 variant 4 and r-sc:m? (kindly supplied by J. KERMICLE,University of Wisconsin). The plants to be tested were either r-g (colorless aleurone, green plant) or rr (colorless aleurone, colored plant parts). R-sc:124, the progenitor of R-sc:l24 variant 4 , conditions purple pigmentation to the aleurone layer of maize kernels. R-sc:124 variant 4 contains a chromosome-breaking Ds element located in chromosome 10 between R-sc and thecentromere. In the absence of Ac, chromosomes carrying the Ds insertion are stable and full aleurone pigmentation results. When the stock is crossed with a line carrying Ac, chromosome 10 frequently breaks at the site of Ds insertion. This breakage results in the loss of R-sc on an acentric fragment, and production of a colorless aleurone sector (J. KERMICLE, personal communication). r-sc:m? carries a Ds insertion within the R-sc locus; in the absence of Ac, r-sc:m3 specifies colorless aleurone, whilein the presence of Ac, r-sc:m3 produces a variegated colored aleurone due to theexcision of Ds from R-sc (KERMICLE1980). A stock homozygous for r-nj:ml and P-ww was obtained from S. BRIGGS.r-nj:ml contains Ac inserted into the R-navajo allele (DELLAPORTA et al. 1987). Frequency of somatic mutation of P-ovov and P - m TO test the stability of the P-ovou and P-rr alleles, ears from plants carrying P-ovov or P-rr heterozygous with a P allele giving colorless pericarp (either Z"ww[4C063]or P-wr) were screened for colorless or light pericarp sectors. Sectors counted ranged in size from approximately 0.5 mm in width to sectors covering one or more kernels. The frequency of sectors was calculated as the percentage of kernels with sectors regardless of the size of the sectors. The numberof kernels screened was estimated by dividing the total weight of kernels by the weight per 1000 kernels. Chi-square analysis was done to test the null hypothesis that the observed differences in frequencies of pericarp sectors between Povov and P-rr alleles (data in Table 2) could occur by chance. DNA isolation, mapping, Southern blot analysis and isolated from young sequencing: Genomic leafDNAwas leaves of individual plants in the 8-1 0 leaf stage by a previously described method (SHURE, WESSLER and FEDO-
Recombination at Maize P Locus
165
8.2 kb of DNA. The transcribed region of theP gene occupies most of the 8.2 kb between the direct repeats (LECHELTet al. 1989). P-vu carriesan Ac element inserted in the DNA between the 5.2-kb direct repeats. In the P-ovov allele, Ac has excised from its site in P-vu, transposed161-bp, and reinserted in the opposite orientation with respect to P - w (PETERSON 1990). Below the restriction map in Figure 2 are the locations of DNA fragments used as hybridization probes. Southern blot analysis of the progenitoi- P-ovov allele and seven P-ww-d mutant alleles is shown in Figure 3. Genomic DNA was prepared from leaves of homoRESULTS zygous plants, digested with EcoRI, and hybridized P-ovov conditions thepericarptoadeeporange with P locus fragment 15. As shown in lane 1, the color broken by red, colorless, and variegated sectors progenitor P-ovov allele gives bands at 14.5, 13.0 and (PETERSON 1990). In addition to thesomatic instability 5.0 kb; these three bands arise from the right,middle indicated by pericarp variegation, P-ovov produces a and left EcoRI fragments, respectively, as shown in significant number of germinalmutations.Among Figure 4.Fragment 15hybridizes to these three bands 23,201 progenyearsproducedfrom the cross of because it carries a 250-bp repeated sequence motif homozygous P-ovov by P-ww, 1,122 (4.8%) had red (black boxes in Figure 2). Lanes 2 through 8 contain pericarp andcob (P-rr), 131 (0.6%) hadwhite pericarp DNA from seven independent P-ww-d alleles. Each of and cob (P-ww)and 65 (0.3%) had variegated pericarp these alleles give a novel 10.0-kb band; the 14.5- and unlike the parental P-ovov allele. These latter varie13-kb bands are missing, and the 5.0-kb band is ungated types had a lighter pericarp color (ranging from changed. As shown in Figure 4, EcoRI cuts at sites medium orange to colorless) and varying numbers of outside the left and right direct repeats; the appeardarker red sectors; these new variegated types are ance of the same 10.0-kb band suggests that a deletion under further investigation. of the same type has occurred in each mutant. Some of the P-ww mutants obtained from the exWhen the blot in Figure 3 was rehybridized with periment above may berelated due to premeiotic the internal 1.6-kb Hind111 fragment of Ac, approximutations. Therefore, we selected for molecular mately 8-10 hybridizing bands were detected in each analysis anumber of P-ww mutantsindependently lane. In DNA from the P-ovov allele, the 14.5- and derived fromP-ovov. The selection scheme is outlined 13.0-kb bands hybridized with the Ac probe, as exin Figure 1 and described in detail in MATERIALS AND pected. However, in the P-ww-d alleles, the 10.0-kb METHODS. Briefly, earsfrom plants carrying P-ovov band did not hybridize with the Ac probe (data not heterozygous with a colorless pericarp allele (either Pshown). These results are consistent with the absence ww[4Co63] or P-wr) were screened for sectors of muof Ac from the 10.0-kb EcoRI fragment as shown in tant pericarp which covered one or morekernels. To Figure 4. be certain that the mutations studied were of indeIn order to furthermap the structures of the P-wwpendent origin, a single mutant kernel was selected d alleles, restriction fragments to the right andleft of from each ear. The mutant kernels were sown, and the Ac insertion site in P-ovov were used as probes. P-ww mutant alleles were made homozygous by selfEach probe was hybridized to Sal1 digests of genomic pollination. Fifty P-ww mutants derived from P-ovov DNA from plants homozygous for P-ovov and P-ww-d. were selected in this way. A single P-ww mutant (Pshows the location of the hybridization w w - I 1 1 2 ) was obtained from a large mutant sector on Figure2 probes used, and a restriction map showing the fraga P - w ear. A list of the P-ww alleles is presented in ment sizes obtained by Sal1 digestion; it should be Table 1. Of the 5 1P-ww mutants obtained, 47 had a notedthat Sal1 doesnotcut within the 4.5-kb Ac similar structure involving a large deletion (see below); element. Figure 5 shows the pattern observed with mutants of this type are designated P-ww-d. Four of the allele P-ww-7A24; essentially the same results were the P-ww mutants derived from P-ovov had smaller obtained from seven other P-ww-d alleles. deletions or other rearrangements unlike that charFragment 6, located to the left of the Ac insertion acteristic of P-ww-d alleles. These otherP-ww mutants site in P-ovov, hybridizes to 9.0-, 8.0-, 7.0-, 3.0- and will not be considered further here. Structures of the P-ovov progenitor and P-ww-d 1.2-kb bands in P-ovov; the 9.0- and 8.0-kb fragments are absent in the P-ww-d mutants. (Hybridization of mutant alleles: A restriction map of the P-ovov allele is presented in Figure 2. The fully functional P-rr fragment 6 to the 8.0-, 3.0- and 1.2-kb bands is due allele contains two 5.2-kb direct repeats, separatedby to a 174-bp overlap of fragment 6 with the repeated
ROFF 1983). PericarpDNA was prepared by soaking mature dried seeds in water for several hours, peeling off the pericarps, andthen isolating DNA as above. Genomic DNA (2.5 rg) was digested with restriction enzymes, electrophoresed through 0.6% agarose gels, and transferred to nitrocellulose according to the method of SOUTHERN (1975). Filters were prehybridized for 4-6 hr and hybridizations were carried o u t overnight at 42" in 50% formamide, 5 X SSC, 1 X Denhardt's solution, 15 mM NaH2P04,10% dextran sulfate and 250 rg/ml heat-denatured salmon sperm DNA. Sequencing of dsDNA templates was done using synthetic oligonucleotides to prime sequencing reactions using a Sequenase kit.
166
P. Athma and T. Peterson TABLE 1 P-ww mutant alleles derived from P-ovov and P - w Originat mutant sector Allele No.
1 P-Ww-l112 2 P*-7A8 3 P*-7A24 4 P*-7B2 5 P*-7B3 6 P*-7B4 7 P*-7B5 8 P*-7B8 9 P*-YA7-1 10 P*-YA35-5 1 1 P*-YA3Y-3 12 P*-YA56-1 13 P*-YA89-4 14 P*-YAY2-3 I 5 P*-YA99-4 16 P*-YA 125-2 17 P*-YA127-3 18 P*-YA144-Y 19 P*-YA144-10 20 P*-YA144-11 2 1 P*-YA 145-6 22 P*-9A146-I 23 P*-YA146-2 24 P*-YA146-3 25 P*-YA146-4 26 P*-9A146-7 27 P*-YA146-9 28 P*-YAI46-11 29 P*-YA147-1 30 P*-YA147-3 3 1 P*-YA 147-4 32 P*-YA147-5 33 P*-9A147-6 34 P*-YA147-11 35 P*-YA148-5 36 P*-YA 148-6 37 P*-YD15Ae 38 P*-YD18A 39 P*-YD59Af 40 P*-YD95A 41 P*-9D127A 42 P*-YD16B 43 P*-YD24B 44 P*-YD4YB 45 P*-9D58B 46 P*-YD63Bp 47 P*-YD67B 48 P*-9D68B 49 P*-YD70Bh 50 P*-YD8YB 51 P*-YD327D
Genotype of origin ear
P - w / P - w r x P-wr P-ovovlp-wr x P-wr P-ovou/P-wr x P-wr P-ovovlp-wr x P-wr P-ovov/P-wr x P-wr P-ouou/P-wr x P-wr P-ovou/P-wr x P-wr P-ovov/P-wr x P-wr P-ouov/P-ww x P-ww P-ovov/P-ww x P-ww P-ouov/P-ww x P-ww P-ovov/P-ww x P-ww P - o v o v / P - w x P-ww P-ouov/P-ww x P-rnl P-ovou/P-ww x P-wr P-OVOVlP-ww x P-ww P-OVOVlP-ww x P-ww P-ovov/P-wr x P-wr P-ouov/P-wr x P-wr P-ouou/P-wr x P-wr P-ovovlP-wr x P-wr P-ovov/P-ww x P-wr P-ouov/P-ww x P-wr P-ouou/P-ww X P-wr P-ovou/P-ww X P-wr P-ovou/P-ww x P-wr P-ovou/P-ww X P-wr P-ouov/P-ww x P-wr P-ouov/P-ww X P-wr P-ouov/P-ww x P-wr P-ovovlP-ww x P-wr P-ouov/P-ww x P-wr P-ouou~P-wwX P-wr P-ovov/P-ww x P-wr P-ouov/P-ww X P-wr P-ovov/P-ww x P-wr P-ouou/P-ww x P-ww P-ouov/P-ww x P-ww P-ouovl- X P-wr P-ovoul- x P-wr P-ovov/P-wr x P-wr P-ovou/P-ww x P-ww P-ovou/P-ww x P-ww P-ovov/P-ww x P-ww P-ovov/P-wr x P-wr P-ovou/- X P-wr P-ovov/P-wr x P-wr P-ououl- X P-wr P-ovov/- x P-wr P-ouov/P-wr x P-wr P-ovou/P-ww x P-ww
Size"
"2 ear 69 k l k Ik Ik Ik Ik Ik Ik l k Ik Ik l k Ik l k
Phenotypeb dc
+ IC dc
N D ~ ND ND ND ND ND ND ND
Southern pattern Presence EcoRI of Ac' 16+17 probe 15 probe 15 probe
-
+
-
-
+ + + + + +
ND
-
ND
ND
ND
-
ND
ND
ND
+ +
Ik
ND
l l l l I l l l I I l l l l l
ND
-
ND
-
ND
k k k k k k k k k k k k k k k
I k Ik l k l k Ik 2k 2k Ik 4k Whole ear 2k 3k Whole ear 2k I k 2k 2k 2k 3k 2/3 ear
10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 13, 10, 5 ND
10, 5 10, 5 10, 5 10, 5 10, 5 ND ND
SalI
3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 5, 3, 1.2 3, 1.2
Sal1
7 7 7 7 7 7 7 9, 7 ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
3, 1.2 3, 1.2
ND ND ND
ND
ND
ND
ND
ND
10, 5 10, 5 10, 5
ND
ND
ND
ND
IO, 5
ND
ND
ND
ND
ND
ND
ND
-
15, 3, 1.2, 1.0
ND
ND ND ND ND ND
-
+ + +
-
IO, 5 10, 5 10, 5 10, 5 10,5 10,5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5
ND
10,5
ND
-
ND
ND
ND
-
ND
ND
ND
ND
ND
ND
ND
+
ND
ND
ND
Iv White dc Iv dc Iv Iv dc dc dc dc vlv dc Iv dc
14.5, 13, 5 >23, 14, 10, 5 10, 5 22, 5 10, 5
-
ND ND ND
-
+ ND
ND ND ND ND ND ND
ND
3, 2.3, 1.2
ND ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2
ND
7 7 7 7 7 7 7 7 7 7
7 7 7
7 7
1 k indicates mutant alleles derived from kernels with mutant pericarp sectors less than or equal to one kernelin size. [pigmentation at silk attachment point; see EMERSON(1917) and text fordetails]; IC, Izght crown (no pigmentation at silk attachment point); Iv, light variegated; vlv, very light variegated. ' Presence of Ac was determined by testcrosses to one or both of the Ac tester stocks r-sc:m3 or R-sc:124 variant 4 (MATERIALS AND
' dc, dark crown
METHODS).
Not determined. ' P*-YDI5A original sector had two kernels: one was light variegated and carried P-ww-d; one was medium variegated and had Ac transposed
into the 9.0-kb Sal1 fragment (Figure 2). fP*-YD5YA original sector had two kernels: onewas dark crown and carriedP-ww-d; one was red and hadAc excised from P locus. 8 P*-YD63B original sector had two kernels: onewas dark crown and carriedP-ww-d; one was variegated and carriedAc in the 3.4-kb Sal1 and left-hand 1.2-kb SalI fragments (Figure 2). P*-YD7UB original sector had two dark crown kernels: one carried P-ww-d; one carried Ac transposed into the 9.0-kb SalI fragment (Figure 2).
Recombination at Maize P Locus
-I 5
5
I 1.9 I
5 s 11.21
3.0
-I
7 1
L
167
5
5
9.0
I
8.0
-
R
I1
5
I
S
I
7.0
11.21
4.0
45
I1
L: ACGGTTTTGTARACCGTGCCCAGTGAGTGGTGCCA """-5.2 R: ATCGCCGCTGCAGCAGTGCCCAGTGAGTGGTGCCA """-5.2
kb------kb-------
AGTGCGGCCTGCGGGAGTGCGGCCTGCTCGGTTGT AGTGCGGCCTGCGGGAGTGCCCACACGTCAGCAAC
FIGURE2.-Structure of the f-ouou allele. The hatched boxes indicate the 5.2-kb direct repeats which flank the f gene. The threearrows indicate a I-kb direct repeat sequence. The black boxes represent a repeated sequence motif of 250 bp. The triangle indicates the insertion site of the transposable element Ac. Restriction enzyme sites are indicated as follows: B = BamHI, E = EcoRI, S = Sall. The asterisk above the two Sal1 sites flanking the lefthand direct repeat indicates that these sites are not digested by Sal1 in genomic DNA, possibly due to methylation. Not all the restriction sites are shown. The second line shows the locations of the fragments obtained by Sal1 digestion of genomic DNA, and their sizes in kb. The numbered boxes represent restriction fragments that were used as probes in Southern analysis of P-ouou, f - r r and f-ww-d mutants. The sequences at the bottom show the nucleotide sequences at the termini of the left (L) and right (R) direct repeats, in the regions indicated by the black bars marked I and I1 below the restriction map.
1
2
3 .
.
4
5
6
7
8
+
M
...
E
E
w
E
14.5 13.0 10.0-
5.0-
P-mv
5dkb
I
... ... '*.;'
10.0kb
1
FIGURE4.-Structures of the f-ououand f - w - d alleles. The map at the top shows the f-ouou genomic region with EcoRI sites. The two hatched boxes indicate the two 5.2-kb direct repeats on either side of Ac. The Ac element is indicated as a triangle. The map at the bottom shows the structure of a P - w - d allele with 17.0-kb deletion, including 4.5 kb of Ac and 12.5 kb of the f locus. The dashed lines indicate the hypothetical deletion end points. B = BamHI, E = EcoRI.
FIGURE3.-Southern blot of leaf DNA from homozygous plants digested with EcoRI and hybridized with f locus fragment 15. The lanes are designated as follows: 1 = f-ouou allele; 2 = f - w - 1 1 1 2 derived from P-vu; 3 = f-ww-7A24; 4 = f-ww-7B2; 5 = f-ww-7B3; 6 = f - w - 7 B 4 ; 7 = f-ww7B5; 8 = f - w - 7 A 8 ; M = size markers of lambda DNA digested with Hindlll.
sequence motif indicated by the black boxes in Figure 2.) Fragments 7 and 9 detect 9.0- and 7.0-kb bands in P-ovov; the P-ww-d mutants contain the 7.0-kb band, but are lacking the 9.0-kb band. Fragments 11, 12 and 13 to the right of Ac hybridize to 8.0- and 2. I-kb bands in P-ovov; P-ww-d mutants contain the 2.1-kb hybridizing band but lack the 8.0-kb band. (The 2.1kb band is a cross-hybridizing fragment located somewhere in the genome outside of the 34 kb of the P locus we have mapped.) Fragment 14 detects 8.0- and 1.2-kb bands in P-ovov; in the P-ww-d mutants the 8.0kb band is missing. (Fragment 14 hybridizes to the 1.2-kb band due to the direct repeat sequence indi-
P. Athma and T. Peterson
168
o w
F-
2.1
o w
"
o w ~~
o w
=IW
'. .
FIGURE5.--Southern blots of genomic DNA from progenitor P-ovov and P-ww-d alleles digested with Sal1 and hybridized with the indicated probes from the P locus. The lanes are designated with 0 for P-ovov DNA and W for P-ww-d DNA. The numbers below each autoradiogram indicate the fragment used as probe; numbers in parentheses indicate adjacent probe fragments whichproducedthe same hybridization pattern. The P - w - d allele shown here is P-ww-7A24; essentially the same pattern was obtained from seven other P-ww-d alleles (P-ww-I 112, P-ww-7A8, P - w - ~ B ~ , P - w - ~ B ~ , P - w - 7 B 4 P, ~-7B5, P-ww-~B~).
-*
1.2 -
dmmB
Probe:
#6
#7(#9) (#ll)#12(#13)
#I4
#I5
cated by the arrows in Figure 2.) Fragment 15 detects 8.0-, 3.0- and 1.2-kb bands in P-ovov, while in the Pww-d mutants, only the 3.0- and 1.2-kb bands are present. (Fragment 15 hybridizes to the 3.0- and 1.2kb bands dueto a 250-bp repeat sequence motif indicated by the black boxes in Figure 2.) Fragments 16 and 17, which together cover a 7.0-kb region, detect 9.0- and 7.0-kb bands in P-ovov, while the 9.0kb band is absent in the P-ww-d mutants. Finally, fragment 19 detects a 4.0-kb band in P-ovov as well as inall the P-ww-d mutants. Together, these results indicate that sequences to theleft and right of the Ac insertion site in P-ovov have been deleted. The deletion endpoints lie within the flanking direct repeats, as shown in Figure 4. Sequence of direct repeats Southern hybridizations indicated that the 5.2-kb direct repeats are very highly homologous.T o determine the degree of similarity, we sequenced approximately 1.5 kb from the left and right hand direct repeats; comparison of the sequences indicated that the direct repeats are identical over the regions sequenced (data not shown). The direct repeats do not appear to be transposons, since their termini do not have the inverted repeats or flanking duplicationscharacteristic of most identified plant transposons(Figure 2, lower). Somatic and germinal instabilityof P alleles: T o determine the influence ofAc on somatic instabilityat the P locus, the frequency of colorlesspericarp sectors was determined for P-ovov. Two sibling P-ovov ears were screened for kernels with sectors oflight or colorless pericarp; the frequency ofsuch sectored kernels was found to be approximately 10% (65/627; Table 2). In contrast, the frequency of sectored kernels for P-rr-4026 (a P-rr allele derived by excision of Ac from P-ovov) was only 0.03 1%. When Ac was intro-
#16+17
#I9
duced in trans by crossing plants carrying P-rr-4026 by plants carrying R-nj(ml::Ac), there was no significant effect on somatic instability(Table 2). Chi-square tests (Table 3) indicate that thereis a highly significant difference between the sectoring frequencies in P-ovov and P-rr-4026, with or without Ac in trans. However, there is no significant difference between the sectoring frequenciesof P-rr-4026 lacking Ac, and P-rr-4026 with Ac in trans. These results indicatethat P-rr-4026, which contains the long direct repeats, is relatively stable, andthatthe stabilityis not altered by the presence of Ac on chromosome 10. Detection of deletions in sporophytic tissue: To determine whether the P locus deletions couldoccur premeiotically, DNA was prepared from the isolated pericarps of kernels taken froma large mutant sector whichoccupiedapproximately 2/3 ofan ear. The DNA samples were digested with Sal1 and analyzed on a Southern blotusing P locus fragment 15 as hybridization probe. The results are shown in Figure 6. Forcomparison, DNA samples prepared from leavesofhomozygousplants are showninlanes 1 through 4. In lane 1, the progenitor P-ovov allele gives 8.0-, 3.0- and 1.2-kb bands. In lane 2, the P-rr-4026 allele, derived by excision ofAc from the 8.0-kb band in P-ovov, gives 3.4-, 3.0- and 1.2-kb bands. In lane3, a P-ww-d allele (P-ww-1112)contains 3.0- and 1.2-kb bands. In lane 4, the P-ww[4Co63] allele gives a 1.0kb band. Lane 5 contains DNA made from a seedling grown from a kernel within the original mutant sector. Lane 6 contains DNA prepared from the pericarp of the original mutant kernels. Both seedling and pericarp DNAs in lanes 5 and 6 contain the 3.0- and 1.2kb bands typical of the P-ww-d mutants; the 8.0-kb band of the progenitor P-ovw allele is deleted. Lanes 5 and 6 alsocontain the 1-kb band from the P-
Recombination at Maize P Locus
169
TABLE 2 Sporophytic and germinal instabilities of various P alleles Germinal instabilitf
Allele
Statistical B0"P
Sporophytic instability*
1 65/627 (1 0.4%) P-ovov (0.6%) 131/23,201 23/73,900 (0.031 %) 2 P-rr-4026, no Ac 0/171 (0%) P-rr-4026, Ac in trans 0/4,721 (0%) 3 0/92 (0%) N D ~ 4 P-w' (0.2%) 8/4,575 Germinal instability = frequency of P-ww mutants in the progeny of plants homozygous for the indicated P allele crossed with P-ww or
P-wr plants. Sporophytic instability = frequency of kernels with light or colorless pericarp sectors when the indicated P allele is heterozygous with a colorless pericarp allele. This frequency cannot be determined for P - w because small sectors of colorless pericarp (genotypicallyP-ww) cannot be distinguished from the colorless pericarp background specified by P - w . It should be noted that the colorless pericarp sectors counted to determine sporophytic instability could result from any mutation which abolishes expression of P . For example, intragenic transposition of Ac from the site it occupies in P-ovov to another site in the P locus at which P expression is suppressed could account for a significant number 1984). In the small colorless sectors counted here, it is usually not of the sectors, since Ac tends to transpose to nearby sites (GREENBLATT, possible to determine from the phenotype of the sector whether it arises from a deletion of P , or an intragenic transposition of Ac to reconstitute a P - w allele. When multikernel sectors are considered, the number of sectors with a phenotype typical of P-ww-d mutant sectors is approximately 5-1 0 times the number of sectors with variegated pericarp typical of cases of intragenic transpositions of Ac (T. PETERSON and P. ATHMA,unpublished results). I f the relative frequencies of deletions and intragenic transpositions do not change during development, then roughly 10-20% of the total colorless pericarp sectors on P-ovov ears are due tointragenic transpositions. In a related study, ORTON ( 1 966)determined that the frequency of pericarp sectoring of P-rr alleles with linked Ac elements increases significantly with proximity of Ac to P , reflecting the tendency of Ac for short-range transposition. However, the highest pericarp sectoring frequency observed by ORTON for Ac tightly linked to P was 1.65%, significantly less than the 10.4% seen with P-ouov. ' Data from BRINK (1 958). Not determined.
-
TABLE 3
1
Groups compared
Statistical significance
All 1-2 1-3 2-3
P < 0.005 P < 0.005 P < 0.005 Not significant
ww[4Co63]allele; thisis expected since the earparent was genotypically P-ovov/P-ww[4Co63], and the ear was crossed by pollen from a plant homozygous for Pww[4Co63].These results show that the P-ww-d allele is present in the pericarps of the kernels within the original mutant sector; the deletion which produced this sector occurred premeiotically, at an early stage of ear development.
2
3 .
Chi-square teston the frequencyof pericarp sectors in Psvov and P-rralleles
4
5
- . . .
6
8.0-
3.43.0-
DISCUSSION
Possible mechanismof deletions: We found that a significant cause of instability ofthe P-ovov allele was the formation of P-ww alleles, and that most of these P-ww alleles share a common deletion. The deletion endpoints of eight P-ww-d alleles were mapped and found to lie within the two 5.2-kb homologousdirect repeats on either side of Ac (Figure 4). The same eight P-wu-d alleles produced identical Southern blot patterns after digestion with eight different restriction enzymes and probing with P locus probe #I5 (not shown). Of 44 P-ww-d alleles tested, all produced a 10.0-kb band upon digestion withEcoRI and probing
FIGURE ti.-Southern analysis of'pericarp DNA. Genomic DNA was purified from leaves (lanes 1-5) and pericarps (lane 6). DNA samples were digested with Sal1 and hybridized with P locus fragment 15. Lane 1 = P-ovov; lane 2 = P-rr-4026; lane 3 = P-ww-III2; lane 4 = P-ww[4Co63];lane 5 = P-ww-d[90327D]/P-ww[4Co63]; lane 6 = P-ww-d[90327D]/P-ww[4Co63]. DNA in lane 5 was prepared from a seedling grown from a kernel within a large mutant pericarp sector. DNAin lane 6 was prepared from pericarps of kernels taken from the same mutant sector. See text for details.
with P locus probe #15 (Table 1). Since EcoRI cuts at sites outside the direct repeats flanking the P gene,
170
P. Athrna and T. Peterson
we conclude that these P-ww-d alleles have a similar o r identical structure. Anothernotablefeature of our data is the high frequency of P-ww-d alleles which carry Ac (1 4 out of 30 tested; Table 1). T h e Ac elements present with the P-ww-d alleles must have transposed from the P-ovov allele either before or at the time the deletions occurred. GREENRLATT ( 1 984) showed that although Ac tends to transpose to linked sites, in 39% of the cases inwhich a transposed Ac was mapped,thesite of reinsertion was unlinked to P (GREENRLATT, 1984). Since our tests for the presence of Ac were made two generations after the deletions occurred, there were two intervening meioses during which unlinked or loosely linked Ac elements couldhave segregated from the P-ww-d allele. Therefore, the initial association of P-ww-d alleles and transposed Ac elements was probably much higher. This correlation between deletion formation and Ac transposition suggests that transposition of Ac is somehow involved in the deletion mechanism. It is conceivable thatthe P-ww-d deletion alleles arose from excision and ligation at specific sites within the direct repeats, as for example excision of a transposable element. We consider this possibility unlikely because we found no evidence for reinsertion of the deleted sequences, as might be expected for a transposon. Also, it is not clear why excision of such a hypothetical transposon should be greatly enhanced by insertion of Ac within it, but not by the presence of an Ac element in trans. Finally, the endsof the 5.2kb direct repeat sequences do not have any of the structures characteristic of transposable elements. Therefore, we consider it most likely that the P-wwd alleles arose by homologous recombination between the flanking direct repeats. Homologous recombination at any site within the two repeats would result in a 17-kb deletion which would remove Ac, the transcribed region of the P gene, and one direct repeat sequence. T h e resulting P-ww-d alleles would retain a single copy of the direct repeat sequence.T h e repeat sequence remaining in each P-ww-d mutant would be a hybrid of sequences derived from the left and right repeats, depending upon the site of recombination. T h e site of recombination couldconceivably be determined relative to any sequence differences between the direct repeats. However, no such nucleotide differences have been detected within the 1.5 kb of repeat sequences obtained to date. What recombination mechanism might account for the generation of the observed P-ww-d mutants? It is possible, thatunequal sister chromatidexchange (USCE) between the two directrepeats of P-ovov might give rise to the P-ww-d deletionmutantsas diagrammed in Figure 7A. If unequal crossing over occurred between sister chromatids then one would
" V "
PQVOY
I
I
I
I t
-v-v-
0
Expected phenotype: dark orange with fewer red sectors
L
P-m
A
1
- I
P-m
P-mu
B
C
FIGURE7.--1Molecul;~r modelsfor genesls of f-uml-d mutants. T h e hatched boxes indicate the 5.2-kb direct repeats. The trianglc indicates the Ar e l ~ ~ ~ n e The n t . schematic drawimgs A to C are possiblenwchanismsforthedeletions at the locus. A = unequal sister chrom;ltid exchange; 13 = double strand break recombination n~otlel:
Ac Induces Homologous Recombination at the MaizeP Locus Prasanna Athma and Thomas Peterson Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Manuscript received September 12, 1990 Accepted for publication January 12, 1991 ABSTRACT The maize P gene conditions red phlobaphene pigmentation to thepericarp and cob. Starting from two unstable P alleles which carry insertions of the transposable element Ac, we have derived 51 P null alleles; 47 of the 51 null alleles have a 17-kb deletion which removes the 4.5-kb Ac element and 12.5 kb of P sequences flanking both sidesof Ac. The deletion endpoints lie within two 5.2-kb homologous direct repeats which flank the P gene. A P allele which contains the direct repeats, but does not have an Ac insertion between the direct repeats,shows verylittle sporophytic or gametophytic instability. The apparent frequency of sporophytic mutations was not increased when Ac was introduced in trans. Southern analysis of DNA prepared from the pericarp tissue demonstrates that the deletions can occur premeiotically, in the somatic cells during development of the pericarp. Evidence is presented that the deletions occurred by homologous recombination between the two direct repeats, and that the presence of an Ac element at the P locus is associated with the recombination/deletion. These results add another aspect to the spectrum of activities of Ac: the destabilization of flanking direct repeat sequences.
T
RANSPOSABLE elements can induce genome reorganization by causing alterations such as deletions, duplications andotherrearrangements. One means by which transposons effect such rearrangements isby serving as dispersed sites of sequence homology for asymmetrical synapsis and homologous recombination. In Saccharomyces cerevisiae, homologous recombination between Ty elements producesdeletions, inversions and translocations (reviewed by BOEKE1989). In Drosophila, homologous recombination between transposons inserted in the same chromosome can lead to specific chromosomal rearrangements. For example, asymmetrical synapsis between roo transposons in and near the white locus results in duplications and deficiencies (DAVIS, SHEN andJuDD 1987). Additionally, recombination between copies of Drosophila I elements inserted in opposite orientations within and near theyellow gene can result in inversion of the intervening DNA (BUSSEAU, PELISSON and BUCHETON 1989). In Antirrhinummajus, the Tam3 transposable element has been shown to induce a variety of chromosomal rearrangements includingdeletions of various types, dispersions and inverted duplications (MARTIN, MACKAY and CARPENTER 1988). In the rearrangements described above, the transposons most likelyprovide homologous sequence substrates for thehost recombination enzymes. However, transposons can also induce deletions of various types by mechanism(s) which probably do not involve homologous recombination betweendispersed elements. In prokaryotes,deletions associated with insertion (kwticb
128: 163-173 (May, 1991)
sequences and transposons commonly extendfrom one end of the element to asite in the flanking DNA (reviewed in CALOSand MILLER 1980). A similar case of a large deletion flanking the Tam3 element at the nivea locusin Antirhinnum majus has recently been described (LISTERand MARTIN 1989). In maize, MCCLINTOCK (1953, 1954) found that cytologically detectabledeletions of the chromosomal regions flanking a Ds element could occur at low frequency. Flanking deletions associated with the maize transposons Ds,Mu and Ac have also been reported (DORING, GEISERand STARLINGER, 1198 ; TAYLOR and WALBOT 1985; DOONER, ENGLISHand RALSTON 1988). In this paper, we present evidence that the maize transposable element Ac is involved in the formation of large (17 kb) deletions at the P locus. The P gene, located on the short armof chromosome 1,is required for synthesis of a red flavonoid pigment in the pericarp, cob and other floral tissues (STYLES and CESKA 1977, 1989).We have studied a series of P null alleles derived from two unstable P alleles (P-vv and P-ovov) carrying insertions of Ac. Of 5 1 independently derived P null alleles examined,47 have large and similar deletions. Possible mechanisms whereby these deletions are generated arediscussed. MATERIALS AND METHODS
Terminology, maize stocks and generation of mutants: The maize P gene affects phlobaphene pigmentation of the pericarp, cob glumes, and otherfloral organs. The pericarp is the outer covering of the kernel; being the remnant of the ovary wall, the pericarp is of maternal origin. P alleles are conventionally identified by a suffix whichindicates their
P. Athma and T. Peterson
164 P-ovov-
x
P-ww
1
P-wr
p-Wr P-wr
P-ovov
"+
P-rr
selected white pericarp kernels
p-n
P-wr
P-w,
P-wr
1I
self pollinated kernels sown from light red cob
kernels sown from red ears
1
self pollinated
self pollinated
r.Sc :m 3
x
"w "P
,P * P-wr
self pollinated
1 R-S~:124varianI4 or
p-wr P-W,
p-wwp-w
1I
x
P-wr
R-Sc 3 2 4 variant 4 or
r-Sc :m 3
x p-n P-rr
FIGURE1 .-Diagram of the crosses used to isolate P-ww and P-rr nlutilnts from P-ovov. The P alleles are designated as follows:P-ovov = orange variegated pericarp and cob; P-ww = white pericarp and white cob; P-rr = redpericarp and red cob and P-wr = white pericarp and red cob. In the top line, the horizontal arrow indicates the mutation of P-ovov to P-ww or P-rr. The vertical arrows indicate the source of kernels for the succeeding generation.
expression in pericarp and cob. P-rr specifies red pericarp and red cob, P-wr specifies white (colorless) pericarp and red cob, and P-ww gives white (colorless) pericarp and cob. The P-vu allele, which conditions variegated pericarp and cob, contains the transposable element Ac inserted into a Prr allele (EMERSON 1917; BRINKand NILAN 1952; LECHELT et al. 1989). P - w mutated spontaneously to P-ouov, which specifies orange variegated pericarp and cob (PETERSON 1990). P-rr-4026 is a P-rr allele derived from P-ovov by excision of Ac. Inbred line W23 (genotype P-wr) was obtained from the Maize Genetics Cooperation Stock Center, Urbana, Illinois. Inbred line 4Co63 (genotype P-ww) was obtained from the National Seed Storage Laboratory, Fort Collins, Colorado. Stocks carrying P-vu were obtainedfrom TONYPRYOR, CSIRO, Canberra, Australia. P-ovov was derived from P-vu by intragenic transposition of Ac (PETERSON 1990). P-ww11 12 was derived as a spontaneous mutation from P-vu. All other P-ww mutants described here were derived from P ovov. The class ofP-ww mutants derived fromeither P-vu or P-ouou by a common 17-kb deletion (see below) are designated P-ww-d. The P-ww allele in 4Co63 is designated Pww[4Co63] to distinguish it from P-ww-d. P-ww-d mutants were derived from P-ovov as follows (Figure 1). M1 plants of the genotype P-ouou/P-wr were pollinated with pollen from plants homozygous for P-wr. The progeny ears were screenedfor kernels with sectors of altered pericarppigmentation. Because the pericarp and the egg cell are related by cell lineage, the mutant alleles can be recovered by growing kernels within mutant sectors. For sectors less than full kernel insize, kernels with mutant pericarp sectors overlying the embryo were selected, because these are known to have a high heritability relative to sectors over other parts of the kernel (ANDERSON and BRINK 1952). One kernel with altered pericarp pigmentation from each ear was grown and the M2 plants were self pollinated. Owing to Mendelian segregation at the meiotic divisions producing the egg cell, the genotypes of the M2 plants would be expected to be either P-ww*/P-wr (where P-ww* indicates a new P-ww allele of unknown structure derived from P-ovou) or P-wr/P-wr. In most cases the M2 plants of P-ww*/P-wr genotype could be recognized among the plants of P-wr/P-wr genotype by the intensity of cob pigmentation (BRINK1958). Kernels from the self-pollinated ears of M2 plants with lighter colored cobs (inferred genotype P-ww*/ P-wr) were sown. P-wr specifies dominant brown pigmenta-
tion in the hyaline margins of the tassel glumes, while P-ww givesrecessive colorless tassel glumes [E. COE, personal communication (Maize Genetics Cooperation Newsletter57: 3 3 , 58: 75, and59: 4 0 ) ;T. PETERSON (Maize Genetics Cooperation Newsletter 60: 3 6 ) ] . Thus, in the M 3 families, plants of Pww*/P-ww* genotype could often be identified among their P-ww*/P-wr and P-wr/P-wr siblings by the presence of colorless tassel glumes. M 3 plants with colorless tassel glumes were self-pollinated, and the resulting ears with colorless pericarp and cob were a source of homozygous P-ww* seed. However, in some M3 families (especiallythose derived from crosses with inbred B73) the identification of P-ww*/P-ww* plants was confounded by additional tassel pigmentation not specified by P . In these familiesall the plants were self pollinated and theears with colorless pericarp and cob were selected for further studies. Most cases ofP - m * mutants were derived from P-ovou as described above. However, in other cases the M I plants were of P-ovou/P-ww or P-ovov/P-wr genotype and were pollinated with pollen of either P-ww or P-wr genotype. Kernels with altered pericarp pigmentation were selected as above, and P-ww* mutations were made homozygous by selfing. These P-ww* mutations were distinguished from the parental P-ww[4Co63]or P-wr alleles by Southern blot analysis using P locus hybridization probes, since the Southern blot patterns of each allele are distinctive. Plants carrying new P-ww* and P-rr alleles were tested for the presence of Ac by crossing to one or both of the Ac tester stocks R-sc:124 variant 4 and r-sc:m? (kindly supplied by J. KERMICLE,University of Wisconsin). The plants to be tested were either r-g (colorless aleurone, green plant) or rr (colorless aleurone, colored plant parts). R-sc:124, the progenitor of R-sc:l24 variant 4 , conditions purple pigmentation to the aleurone layer of maize kernels. R-sc:124 variant 4 contains a chromosome-breaking Ds element located in chromosome 10 between R-sc and thecentromere. In the absence of Ac, chromosomes carrying the Ds insertion are stable and full aleurone pigmentation results. When the stock is crossed with a line carrying Ac, chromosome 10 frequently breaks at the site of Ds insertion. This breakage results in the loss of R-sc on an acentric fragment, and production of a colorless aleurone sector (J. KERMICLE, personal communication). r-sc:m? carries a Ds insertion within the R-sc locus; in the absence of Ac, r-sc:m3 specifies colorless aleurone, whilein the presence of Ac, r-sc:m3 produces a variegated colored aleurone due to theexcision of Ds from R-sc (KERMICLE1980). A stock homozygous for r-nj:ml and P-ww was obtained from S. BRIGGS.r-nj:ml contains Ac inserted into the R-navajo allele (DELLAPORTA et al. 1987). Frequency of somatic mutation of P-ovov and P - m TO test the stability of the P-ovou and P-rr alleles, ears from plants carrying P-ovov or P-rr heterozygous with a P allele giving colorless pericarp (either Z"ww[4C063]or P-wr) were screened for colorless or light pericarp sectors. Sectors counted ranged in size from approximately 0.5 mm in width to sectors covering one or more kernels. The frequency of sectors was calculated as the percentage of kernels with sectors regardless of the size of the sectors. The numberof kernels screened was estimated by dividing the total weight of kernels by the weight per 1000 kernels. Chi-square analysis was done to test the null hypothesis that the observed differences in frequencies of pericarp sectors between Povov and P-rr alleles (data in Table 2) could occur by chance. DNA isolation, mapping, Southern blot analysis and isolated from young sequencing: Genomic leafDNAwas leaves of individual plants in the 8-1 0 leaf stage by a previously described method (SHURE, WESSLER and FEDO-
Recombination at Maize P Locus
165
8.2 kb of DNA. The transcribed region of theP gene occupies most of the 8.2 kb between the direct repeats (LECHELTet al. 1989). P-vu carriesan Ac element inserted in the DNA between the 5.2-kb direct repeats. In the P-ovov allele, Ac has excised from its site in P-vu, transposed161-bp, and reinserted in the opposite orientation with respect to P - w (PETERSON 1990). Below the restriction map in Figure 2 are the locations of DNA fragments used as hybridization probes. Southern blot analysis of the progenitoi- P-ovov allele and seven P-ww-d mutant alleles is shown in Figure 3. Genomic DNA was prepared from leaves of homoRESULTS zygous plants, digested with EcoRI, and hybridized P-ovov conditions thepericarptoadeeporange with P locus fragment 15. As shown in lane 1, the color broken by red, colorless, and variegated sectors progenitor P-ovov allele gives bands at 14.5, 13.0 and (PETERSON 1990). In addition to thesomatic instability 5.0 kb; these three bands arise from the right,middle indicated by pericarp variegation, P-ovov produces a and left EcoRI fragments, respectively, as shown in significant number of germinalmutations.Among Figure 4.Fragment 15hybridizes to these three bands 23,201 progenyearsproducedfrom the cross of because it carries a 250-bp repeated sequence motif homozygous P-ovov by P-ww, 1,122 (4.8%) had red (black boxes in Figure 2). Lanes 2 through 8 contain pericarp andcob (P-rr), 131 (0.6%) hadwhite pericarp DNA from seven independent P-ww-d alleles. Each of and cob (P-ww)and 65 (0.3%) had variegated pericarp these alleles give a novel 10.0-kb band; the 14.5- and unlike the parental P-ovov allele. These latter varie13-kb bands are missing, and the 5.0-kb band is ungated types had a lighter pericarp color (ranging from changed. As shown in Figure 4, EcoRI cuts at sites medium orange to colorless) and varying numbers of outside the left and right direct repeats; the appeardarker red sectors; these new variegated types are ance of the same 10.0-kb band suggests that a deletion under further investigation. of the same type has occurred in each mutant. Some of the P-ww mutants obtained from the exWhen the blot in Figure 3 was rehybridized with periment above may berelated due to premeiotic the internal 1.6-kb Hind111 fragment of Ac, approximutations. Therefore, we selected for molecular mately 8-10 hybridizing bands were detected in each analysis anumber of P-ww mutantsindependently lane. In DNA from the P-ovov allele, the 14.5- and derived fromP-ovov. The selection scheme is outlined 13.0-kb bands hybridized with the Ac probe, as exin Figure 1 and described in detail in MATERIALS AND pected. However, in the P-ww-d alleles, the 10.0-kb METHODS. Briefly, earsfrom plants carrying P-ovov band did not hybridize with the Ac probe (data not heterozygous with a colorless pericarp allele (either Pshown). These results are consistent with the absence ww[4Co63] or P-wr) were screened for sectors of muof Ac from the 10.0-kb EcoRI fragment as shown in tant pericarp which covered one or morekernels. To Figure 4. be certain that the mutations studied were of indeIn order to furthermap the structures of the P-wwpendent origin, a single mutant kernel was selected d alleles, restriction fragments to the right andleft of from each ear. The mutant kernels were sown, and the Ac insertion site in P-ovov were used as probes. P-ww mutant alleles were made homozygous by selfEach probe was hybridized to Sal1 digests of genomic pollination. Fifty P-ww mutants derived from P-ovov DNA from plants homozygous for P-ovov and P-ww-d. were selected in this way. A single P-ww mutant (Pshows the location of the hybridization w w - I 1 1 2 ) was obtained from a large mutant sector on Figure2 probes used, and a restriction map showing the fraga P - w ear. A list of the P-ww alleles is presented in ment sizes obtained by Sal1 digestion; it should be Table 1. Of the 5 1P-ww mutants obtained, 47 had a notedthat Sal1 doesnotcut within the 4.5-kb Ac similar structure involving a large deletion (see below); element. Figure 5 shows the pattern observed with mutants of this type are designated P-ww-d. Four of the allele P-ww-7A24; essentially the same results were the P-ww mutants derived from P-ovov had smaller obtained from seven other P-ww-d alleles. deletions or other rearrangements unlike that charFragment 6, located to the left of the Ac insertion acteristic of P-ww-d alleles. These otherP-ww mutants site in P-ovov, hybridizes to 9.0-, 8.0-, 7.0-, 3.0- and will not be considered further here. Structures of the P-ovov progenitor and P-ww-d 1.2-kb bands in P-ovov; the 9.0- and 8.0-kb fragments are absent in the P-ww-d mutants. (Hybridization of mutant alleles: A restriction map of the P-ovov allele is presented in Figure 2. The fully functional P-rr fragment 6 to the 8.0-, 3.0- and 1.2-kb bands is due allele contains two 5.2-kb direct repeats, separatedby to a 174-bp overlap of fragment 6 with the repeated
ROFF 1983). PericarpDNA was prepared by soaking mature dried seeds in water for several hours, peeling off the pericarps, andthen isolating DNA as above. Genomic DNA (2.5 rg) was digested with restriction enzymes, electrophoresed through 0.6% agarose gels, and transferred to nitrocellulose according to the method of SOUTHERN (1975). Filters were prehybridized for 4-6 hr and hybridizations were carried o u t overnight at 42" in 50% formamide, 5 X SSC, 1 X Denhardt's solution, 15 mM NaH2P04,10% dextran sulfate and 250 rg/ml heat-denatured salmon sperm DNA. Sequencing of dsDNA templates was done using synthetic oligonucleotides to prime sequencing reactions using a Sequenase kit.
166
P. Athma and T. Peterson TABLE 1 P-ww mutant alleles derived from P-ovov and P - w Originat mutant sector Allele No.
1 P-Ww-l112 2 P*-7A8 3 P*-7A24 4 P*-7B2 5 P*-7B3 6 P*-7B4 7 P*-7B5 8 P*-7B8 9 P*-YA7-1 10 P*-YA35-5 1 1 P*-YA3Y-3 12 P*-YA56-1 13 P*-YA89-4 14 P*-YAY2-3 I 5 P*-YA99-4 16 P*-YA 125-2 17 P*-YA127-3 18 P*-YA144-Y 19 P*-YA144-10 20 P*-YA144-11 2 1 P*-YA 145-6 22 P*-9A146-I 23 P*-YA146-2 24 P*-YA146-3 25 P*-YA146-4 26 P*-9A146-7 27 P*-YA146-9 28 P*-YAI46-11 29 P*-YA147-1 30 P*-YA147-3 3 1 P*-YA 147-4 32 P*-YA147-5 33 P*-9A147-6 34 P*-YA147-11 35 P*-YA148-5 36 P*-YA 148-6 37 P*-YD15Ae 38 P*-YD18A 39 P*-YD59Af 40 P*-YD95A 41 P*-9D127A 42 P*-YD16B 43 P*-YD24B 44 P*-YD4YB 45 P*-9D58B 46 P*-YD63Bp 47 P*-YD67B 48 P*-9D68B 49 P*-YD70Bh 50 P*-YD8YB 51 P*-YD327D
Genotype of origin ear
P - w / P - w r x P-wr P-ovovlp-wr x P-wr P-ovou/P-wr x P-wr P-ovovlp-wr x P-wr P-ovov/P-wr x P-wr P-ouou/P-wr x P-wr P-ovou/P-wr x P-wr P-ovov/P-wr x P-wr P-ouov/P-ww x P-ww P-ovov/P-ww x P-ww P-ouov/P-ww x P-ww P-ovov/P-ww x P-ww P - o v o v / P - w x P-ww P-ouov/P-ww x P-rnl P-ovou/P-ww x P-wr P-OVOVlP-ww x P-ww P-OVOVlP-ww x P-ww P-ovov/P-wr x P-wr P-ouov/P-wr x P-wr P-ouou/P-wr x P-wr P-ovovlP-wr x P-wr P-ovov/P-ww x P-wr P-ouov/P-ww x P-wr P-ouou/P-ww X P-wr P-ovou/P-ww X P-wr P-ovou/P-ww x P-wr P-ovou/P-ww X P-wr P-ouov/P-ww x P-wr P-ouov/P-ww X P-wr P-ouov/P-ww x P-wr P-ovovlP-ww x P-wr P-ouov/P-ww x P-wr P-ouou~P-wwX P-wr P-ovov/P-ww x P-wr P-ouov/P-ww X P-wr P-ovov/P-ww x P-wr P-ouou/P-ww x P-ww P-ouov/P-ww x P-ww P-ouovl- X P-wr P-ovoul- x P-wr P-ovov/P-wr x P-wr P-ovou/P-ww x P-ww P-ovou/P-ww x P-ww P-ovov/P-ww x P-ww P-ovov/P-wr x P-wr P-ovou/- X P-wr P-ovov/P-wr x P-wr P-ououl- X P-wr P-ovov/- x P-wr P-ouov/P-wr x P-wr P-ovou/P-ww x P-ww
Size"
"2 ear 69 k l k Ik Ik Ik Ik Ik Ik l k Ik Ik l k Ik l k
Phenotypeb dc
+ IC dc
N D ~ ND ND ND ND ND ND ND
Southern pattern Presence EcoRI of Ac' 16+17 probe 15 probe 15 probe
-
+
-
-
+ + + + + +
ND
-
ND
ND
ND
-
ND
ND
ND
+ +
Ik
ND
l l l l I l l l I I l l l l l
ND
-
ND
-
ND
k k k k k k k k k k k k k k k
I k Ik l k l k Ik 2k 2k Ik 4k Whole ear 2k 3k Whole ear 2k I k 2k 2k 2k 3k 2/3 ear
10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 13, 10, 5 ND
10, 5 10, 5 10, 5 10, 5 10, 5 ND ND
SalI
3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 5, 3, 1.2 3, 1.2
Sal1
7 7 7 7 7 7 7 9, 7 ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
3, 1.2 3, 1.2
ND ND ND
ND
ND
ND
ND
ND
10, 5 10, 5 10, 5
ND
ND
ND
ND
IO, 5
ND
ND
ND
ND
ND
ND
ND
-
15, 3, 1.2, 1.0
ND
ND ND ND ND ND
-
+ + +
-
IO, 5 10, 5 10, 5 10, 5 10,5 10,5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5 10, 5
ND
10,5
ND
-
ND
ND
ND
-
ND
ND
ND
ND
ND
ND
ND
+
ND
ND
ND
Iv White dc Iv dc Iv Iv dc dc dc dc vlv dc Iv dc
14.5, 13, 5 >23, 14, 10, 5 10, 5 22, 5 10, 5
-
ND ND ND
-
+ ND
ND ND ND ND ND ND
ND
3, 2.3, 1.2
ND ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2 3, 1.2
ND
7 7 7 7 7 7 7 7 7 7
7 7 7
7 7
1 k indicates mutant alleles derived from kernels with mutant pericarp sectors less than or equal to one kernelin size. [pigmentation at silk attachment point; see EMERSON(1917) and text fordetails]; IC, Izght crown (no pigmentation at silk attachment point); Iv, light variegated; vlv, very light variegated. ' Presence of Ac was determined by testcrosses to one or both of the Ac tester stocks r-sc:m3 or R-sc:124 variant 4 (MATERIALS AND
' dc, dark crown
METHODS).
Not determined. ' P*-YDI5A original sector had two kernels: one was light variegated and carried P-ww-d; one was medium variegated and had Ac transposed
into the 9.0-kb Sal1 fragment (Figure 2). fP*-YD5YA original sector had two kernels: onewas dark crown and carriedP-ww-d; one was red and hadAc excised from P locus. 8 P*-YD63B original sector had two kernels: onewas dark crown and carriedP-ww-d; one was variegated and carriedAc in the 3.4-kb Sal1 and left-hand 1.2-kb SalI fragments (Figure 2). P*-YD7UB original sector had two dark crown kernels: one carried P-ww-d; one carried Ac transposed into the 9.0-kb SalI fragment (Figure 2).
Recombination at Maize P Locus
-I 5
5
I 1.9 I
5 s 11.21
3.0
-I
7 1
L
167
5
5
9.0
I
8.0
-
R
I1
5
I
S
I
7.0
11.21
4.0
45
I1
L: ACGGTTTTGTARACCGTGCCCAGTGAGTGGTGCCA """-5.2 R: ATCGCCGCTGCAGCAGTGCCCAGTGAGTGGTGCCA """-5.2
kb------kb-------
AGTGCGGCCTGCGGGAGTGCGGCCTGCTCGGTTGT AGTGCGGCCTGCGGGAGTGCCCACACGTCAGCAAC
FIGURE2.-Structure of the f-ouou allele. The hatched boxes indicate the 5.2-kb direct repeats which flank the f gene. The threearrows indicate a I-kb direct repeat sequence. The black boxes represent a repeated sequence motif of 250 bp. The triangle indicates the insertion site of the transposable element Ac. Restriction enzyme sites are indicated as follows: B = BamHI, E = EcoRI, S = Sall. The asterisk above the two Sal1 sites flanking the lefthand direct repeat indicates that these sites are not digested by Sal1 in genomic DNA, possibly due to methylation. Not all the restriction sites are shown. The second line shows the locations of the fragments obtained by Sal1 digestion of genomic DNA, and their sizes in kb. The numbered boxes represent restriction fragments that were used as probes in Southern analysis of P-ouou, f - r r and f-ww-d mutants. The sequences at the bottom show the nucleotide sequences at the termini of the left (L) and right (R) direct repeats, in the regions indicated by the black bars marked I and I1 below the restriction map.
1
2
3 .
.
4
5
6
7
8
+
M
...
E
E
w
E
14.5 13.0 10.0-
5.0-
P-mv
5dkb
I
... ... '*.;'
10.0kb
1
FIGURE4.-Structures of the f-ououand f - w - d alleles. The map at the top shows the f-ouou genomic region with EcoRI sites. The two hatched boxes indicate the two 5.2-kb direct repeats on either side of Ac. The Ac element is indicated as a triangle. The map at the bottom shows the structure of a P - w - d allele with 17.0-kb deletion, including 4.5 kb of Ac and 12.5 kb of the f locus. The dashed lines indicate the hypothetical deletion end points. B = BamHI, E = EcoRI.
FIGURE3.-Southern blot of leaf DNA from homozygous plants digested with EcoRI and hybridized with f locus fragment 15. The lanes are designated as follows: 1 = f-ouou allele; 2 = f - w - 1 1 1 2 derived from P-vu; 3 = f-ww-7A24; 4 = f-ww-7B2; 5 = f-ww-7B3; 6 = f - w - 7 B 4 ; 7 = f-ww7B5; 8 = f - w - 7 A 8 ; M = size markers of lambda DNA digested with Hindlll.
sequence motif indicated by the black boxes in Figure 2.) Fragments 7 and 9 detect 9.0- and 7.0-kb bands in P-ovov; the P-ww-d mutants contain the 7.0-kb band, but are lacking the 9.0-kb band. Fragments 11, 12 and 13 to the right of Ac hybridize to 8.0- and 2. I-kb bands in P-ovov; P-ww-d mutants contain the 2.1-kb hybridizing band but lack the 8.0-kb band. (The 2.1kb band is a cross-hybridizing fragment located somewhere in the genome outside of the 34 kb of the P locus we have mapped.) Fragment 14 detects 8.0- and 1.2-kb bands in P-ovov; in the P-ww-d mutants the 8.0kb band is missing. (Fragment 14 hybridizes to the 1.2-kb band due to the direct repeat sequence indi-
P. Athma and T. Peterson
168
o w
F-
2.1
o w
"
o w ~~
o w
=IW
'. .
FIGURE5.--Southern blots of genomic DNA from progenitor P-ovov and P-ww-d alleles digested with Sal1 and hybridized with the indicated probes from the P locus. The lanes are designated with 0 for P-ovov DNA and W for P-ww-d DNA. The numbers below each autoradiogram indicate the fragment used as probe; numbers in parentheses indicate adjacent probe fragments whichproducedthe same hybridization pattern. The P - w - d allele shown here is P-ww-7A24; essentially the same pattern was obtained from seven other P-ww-d alleles (P-ww-I 112, P-ww-7A8, P - w - ~ B ~ , P - w - ~ B ~ , P - w - 7 B 4 P, ~-7B5, P-ww-~B~).
-*
1.2 -
dmmB
Probe:
#6
#7(#9) (#ll)#12(#13)
#I4
#I5
cated by the arrows in Figure 2.) Fragment 15 detects 8.0-, 3.0- and 1.2-kb bands in P-ovov, while in the Pww-d mutants, only the 3.0- and 1.2-kb bands are present. (Fragment 15 hybridizes to the 3.0- and 1.2kb bands dueto a 250-bp repeat sequence motif indicated by the black boxes in Figure 2.) Fragments 16 and 17, which together cover a 7.0-kb region, detect 9.0- and 7.0-kb bands in P-ovov, while the 9.0kb band is absent in the P-ww-d mutants. Finally, fragment 19 detects a 4.0-kb band in P-ovov as well as inall the P-ww-d mutants. Together, these results indicate that sequences to theleft and right of the Ac insertion site in P-ovov have been deleted. The deletion endpoints lie within the flanking direct repeats, as shown in Figure 4. Sequence of direct repeats Southern hybridizations indicated that the 5.2-kb direct repeats are very highly homologous.T o determine the degree of similarity, we sequenced approximately 1.5 kb from the left and right hand direct repeats; comparison of the sequences indicated that the direct repeats are identical over the regions sequenced (data not shown). The direct repeats do not appear to be transposons, since their termini do not have the inverted repeats or flanking duplicationscharacteristic of most identified plant transposons(Figure 2, lower). Somatic and germinal instabilityof P alleles: T o determine the influence ofAc on somatic instabilityat the P locus, the frequency of colorlesspericarp sectors was determined for P-ovov. Two sibling P-ovov ears were screened for kernels with sectors oflight or colorless pericarp; the frequency ofsuch sectored kernels was found to be approximately 10% (65/627; Table 2). In contrast, the frequency of sectored kernels for P-rr-4026 (a P-rr allele derived by excision of Ac from P-ovov) was only 0.03 1%. When Ac was intro-
#16+17
#I9
duced in trans by crossing plants carrying P-rr-4026 by plants carrying R-nj(ml::Ac), there was no significant effect on somatic instability(Table 2). Chi-square tests (Table 3) indicate that thereis a highly significant difference between the sectoring frequencies in P-ovov and P-rr-4026, with or without Ac in trans. However, there is no significant difference between the sectoring frequenciesof P-rr-4026 lacking Ac, and P-rr-4026 with Ac in trans. These results indicatethat P-rr-4026, which contains the long direct repeats, is relatively stable, andthatthe stabilityis not altered by the presence of Ac on chromosome 10. Detection of deletions in sporophytic tissue: To determine whether the P locus deletions couldoccur premeiotically, DNA was prepared from the isolated pericarps of kernels taken froma large mutant sector whichoccupiedapproximately 2/3 ofan ear. The DNA samples were digested with Sal1 and analyzed on a Southern blotusing P locus fragment 15 as hybridization probe. The results are shown in Figure 6. Forcomparison, DNA samples prepared from leavesofhomozygousplants are showninlanes 1 through 4. In lane 1, the progenitor P-ovov allele gives 8.0-, 3.0- and 1.2-kb bands. In lane 2, the P-rr-4026 allele, derived by excision ofAc from the 8.0-kb band in P-ovov, gives 3.4-, 3.0- and 1.2-kb bands. In lane3, a P-ww-d allele (P-ww-1112)contains 3.0- and 1.2-kb bands. In lane 4, the P-ww[4Co63] allele gives a 1.0kb band. Lane 5 contains DNA made from a seedling grown from a kernel within the original mutant sector. Lane 6 contains DNA prepared from the pericarp of the original mutant kernels. Both seedling and pericarp DNAs in lanes 5 and 6 contain the 3.0- and 1.2kb bands typical of the P-ww-d mutants; the 8.0-kb band of the progenitor P-ovw allele is deleted. Lanes 5 and 6 alsocontain the 1-kb band from the P-
Recombination at Maize P Locus
169
TABLE 2 Sporophytic and germinal instabilities of various P alleles Germinal instabilitf
Allele
Statistical B0"P
Sporophytic instability*
1 65/627 (1 0.4%) P-ovov (0.6%) 131/23,201 23/73,900 (0.031 %) 2 P-rr-4026, no Ac 0/171 (0%) P-rr-4026, Ac in trans 0/4,721 (0%) 3 0/92 (0%) N D ~ 4 P-w' (0.2%) 8/4,575 Germinal instability = frequency of P-ww mutants in the progeny of plants homozygous for the indicated P allele crossed with P-ww or
P-wr plants. Sporophytic instability = frequency of kernels with light or colorless pericarp sectors when the indicated P allele is heterozygous with a colorless pericarp allele. This frequency cannot be determined for P - w because small sectors of colorless pericarp (genotypicallyP-ww) cannot be distinguished from the colorless pericarp background specified by P - w . It should be noted that the colorless pericarp sectors counted to determine sporophytic instability could result from any mutation which abolishes expression of P . For example, intragenic transposition of Ac from the site it occupies in P-ovov to another site in the P locus at which P expression is suppressed could account for a significant number 1984). In the small colorless sectors counted here, it is usually not of the sectors, since Ac tends to transpose to nearby sites (GREENBLATT, possible to determine from the phenotype of the sector whether it arises from a deletion of P , or an intragenic transposition of Ac to reconstitute a P - w allele. When multikernel sectors are considered, the number of sectors with a phenotype typical of P-ww-d mutant sectors is approximately 5-1 0 times the number of sectors with variegated pericarp typical of cases of intragenic transpositions of Ac (T. PETERSON and P. ATHMA,unpublished results). I f the relative frequencies of deletions and intragenic transpositions do not change during development, then roughly 10-20% of the total colorless pericarp sectors on P-ovov ears are due tointragenic transpositions. In a related study, ORTON ( 1 966)determined that the frequency of pericarp sectoring of P-rr alleles with linked Ac elements increases significantly with proximity of Ac to P , reflecting the tendency of Ac for short-range transposition. However, the highest pericarp sectoring frequency observed by ORTON for Ac tightly linked to P was 1.65%, significantly less than the 10.4% seen with P-ouov. ' Data from BRINK (1 958). Not determined.
-
TABLE 3
1
Groups compared
Statistical significance
All 1-2 1-3 2-3
P < 0.005 P < 0.005 P < 0.005 Not significant
ww[4Co63]allele; thisis expected since the earparent was genotypically P-ovov/P-ww[4Co63], and the ear was crossed by pollen from a plant homozygous for Pww[4Co63].These results show that the P-ww-d allele is present in the pericarps of the kernels within the original mutant sector; the deletion which produced this sector occurred premeiotically, at an early stage of ear development.
2
3 .
Chi-square teston the frequencyof pericarp sectors in Psvov and P-rralleles
4
5
- . . .
6
8.0-
3.43.0-
DISCUSSION
Possible mechanismof deletions: We found that a significant cause of instability ofthe P-ovov allele was the formation of P-ww alleles, and that most of these P-ww alleles share a common deletion. The deletion endpoints of eight P-ww-d alleles were mapped and found to lie within the two 5.2-kb homologousdirect repeats on either side of Ac (Figure 4). The same eight P-wu-d alleles produced identical Southern blot patterns after digestion with eight different restriction enzymes and probing with P locus probe #I5 (not shown). Of 44 P-ww-d alleles tested, all produced a 10.0-kb band upon digestion withEcoRI and probing
FIGURE ti.-Southern analysis of'pericarp DNA. Genomic DNA was purified from leaves (lanes 1-5) and pericarps (lane 6). DNA samples were digested with Sal1 and hybridized with P locus fragment 15. Lane 1 = P-ovov; lane 2 = P-rr-4026; lane 3 = P-ww-III2; lane 4 = P-ww[4Co63];lane 5 = P-ww-d[90327D]/P-ww[4Co63]; lane 6 = P-ww-d[90327D]/P-ww[4Co63]. DNA in lane 5 was prepared from a seedling grown from a kernel within a large mutant pericarp sector. DNAin lane 6 was prepared from pericarps of kernels taken from the same mutant sector. See text for details.
with P locus probe #15 (Table 1). Since EcoRI cuts at sites outside the direct repeats flanking the P gene,
170
P. Athrna and T. Peterson
we conclude that these P-ww-d alleles have a similar o r identical structure. Anothernotablefeature of our data is the high frequency of P-ww-d alleles which carry Ac (1 4 out of 30 tested; Table 1). T h e Ac elements present with the P-ww-d alleles must have transposed from the P-ovov allele either before or at the time the deletions occurred. GREENRLATT ( 1 984) showed that although Ac tends to transpose to linked sites, in 39% of the cases inwhich a transposed Ac was mapped,thesite of reinsertion was unlinked to P (GREENRLATT, 1984). Since our tests for the presence of Ac were made two generations after the deletions occurred, there were two intervening meioses during which unlinked or loosely linked Ac elements couldhave segregated from the P-ww-d allele. Therefore, the initial association of P-ww-d alleles and transposed Ac elements was probably much higher. This correlation between deletion formation and Ac transposition suggests that transposition of Ac is somehow involved in the deletion mechanism. It is conceivable thatthe P-ww-d deletion alleles arose from excision and ligation at specific sites within the direct repeats, as for example excision of a transposable element. We consider this possibility unlikely because we found no evidence for reinsertion of the deleted sequences, as might be expected for a transposon. Also, it is not clear why excision of such a hypothetical transposon should be greatly enhanced by insertion of Ac within it, but not by the presence of an Ac element in trans. Finally, the endsof the 5.2kb direct repeat sequences do not have any of the structures characteristic of transposable elements. Therefore, we consider it most likely that the P-wwd alleles arose by homologous recombination between the flanking direct repeats. Homologous recombination at any site within the two repeats would result in a 17-kb deletion which would remove Ac, the transcribed region of the P gene, and one direct repeat sequence. T h e resulting P-ww-d alleles would retain a single copy of the direct repeat sequence.T h e repeat sequence remaining in each P-ww-d mutant would be a hybrid of sequences derived from the left and right repeats, depending upon the site of recombination. T h e site of recombination couldconceivably be determined relative to any sequence differences between the direct repeats. However, no such nucleotide differences have been detected within the 1.5 kb of repeat sequences obtained to date. What recombination mechanism might account for the generation of the observed P-ww-d mutants? It is possible, thatunequal sister chromatidexchange (USCE) between the two directrepeats of P-ovov might give rise to the P-ww-d deletionmutantsas diagrammed in Figure 7A. If unequal crossing over occurred between sister chromatids then one would
" V "
PQVOY
I
I
I
I t
-v-v-
0
Expected phenotype: dark orange with fewer red sectors
L
P-m
A
1
- I
P-m
P-mu
B
C
FIGURE7.--1Molecul;~r modelsfor genesls of f-uml-d mutants. T h e hatched boxes indicate the 5.2-kb direct repeats. The trianglc indicates the Ar e l ~ ~ ~ n e The n t . schematic drawimgs A to C are possiblenwchanismsforthedeletions at the locus. A = unequal sister chrom;ltid exchange; 13 = double strand break recombination n~otlel:
