Tumor Biol. DOI 10.1007/s13277-014-1690-x
RESEARCH ARTICLE
Aberrant expression of DPPA2 and HIWI genes in colorectal cancer and their impacts on poor prognosis Reza Raeisossadati & Mohammad Reza Abbaszadegan & Meysam Moghbeli & Alireza Tavassoli & Alexandre Hiroaki Kihara & Mohammad Mahdi Forghanifard
Received: 16 October 2013 / Accepted: 23 January 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014
Abstract Cancer cells have countless behaviors of pluripotent embryonic stem cells and germ line cells, such as unlimited proliferation, self-renewal, and migration. Expression of specific germ line and embryonic genes in tumor cells may be associated with indefinite growth and invasiveness of such cells. Developmental pluripotency factor 2 (DPPA2) and HIWI are two important developmental genes which are involved in embryonic and germ line stem cell properties. Deciphering the role of these genes seems to be necessary for understanding cancer initiation and progression. Tumoral and normal tissues from 46 colorectal cancer (CRC) patients were subjected to gene expression analysis using quantitative real-time reverse transcription-polymerase chain reaction, R. Raeisossadati : M. R. Abbaszadegan : M. Moghbeli Division of Human Genetics, Immunology Research Center, Avicenna Research Institute, Mashhad University of Medical Sciences, Mashhad, Iran A. H. Kihara Núcleo de Cognição e Sistemas Complexos, Centro de Matemática, Computação e Cognição, Universidade Federal do ABC, Santo Andre, Brazil M. R. Abbaszadegan Medical Genetics Research Center, Medical School, Mashhad University of Medical Sciences, Mashhad, Iran A. Tavassoli Endoscopic and Minimally Invasive Research Center, Qaem Hospital, Mashhad, Iran M. M. Forghanifard (*) Department of Biology, Damghan Branch, Islamic Azad University, Cheshmeh-Ali Boulevard, Sa’dei Square, P.O. Box: 3671639998, Damghan, Iran e-mail: [email protected] M. M. Forghanifard e-mail: [email protected]
prior to any therapeutic intervention. Overexpression of DPPA2 and HIWI was detected in 26.1 and 34.8 % of specimens, respectively. Significant correlation between DPPA2 overexpression and lymph node metastasis of the tumor cells (P=0.049) was seen in the samples with advanced stages (III/IV) of the tumor development. HIWI mRNA expression was significantly associated to the depth of tumor invasion (P = 0.020) and the stage of tumorigenesis progression (P=0.030). In samples with overexpression of at least one gene, DPPA2 mRNA expression was significantly correlated to the stage of tumor (P=0.017). In the same samples, a significant correlation was observed between mRNA expression of HIWI and the stage of tumor cells (P=0.034). These results documented the important role of HIWI and DPPA2 in tumorigenesis and also in lymph node metastasis of tumor cells. Further evaluation is required to uncover the detailed role of HIWI and DPPA2 and their interactions in tumorigenesis of CRC. Keywords Colorectal cancer . DPPA2 . HIWI . Expressional analysis . Real-time PCR
Introduction Colorectal cancer (CRC) is known as the third most prevalent tumor type in the world, which causes approximately 400,000 deaths per year [1, 2]. In developed regions, in spite of trifling diminution in cancer incidence and mortality rates throughout the past two decades, CRC remains the third most common cancer in these countries with nearly 50,000 deaths per year [3]. In Iran, CRC is also reported as one of the most frequent malignancies, with an incidence rate of 8 per 100,000 and a mortality rate of 1.3 and 1.8 per 100,000 in females and males, respectively [4, 5]. Several studies have been reported that approximately 40–50 % of CRC patients that undergo tumor resection show subsequent metastasis of tumor cells through
Tumor Biol.
the bloodstream or lymphatic circulation to other tissues and organs, which leads to significant decrease of the 5-year survival of the patients [6]. Therefore, early detection of the malignancy with accurate methods is absolutely vital to increase the patients’ survival through on-time tumor resection [5, 7]. Since many properties of cancer cells including selfrenewal, proliferation, and indefinite growth are shared with embryonic and germ line stem cells of different development stages [8], deciphering the involved genes and their role in cancer cells can bring new insight into cancer events and tumorigenesis. Developmental pluripotency factor 2 (DPPA2) and HIWI are two important developmental genes which are involved in embryonic and germ line stem cells properties. DPPA2 gene is located on chromosome 3q13 and encodes a protein product of 297 amino acids [9]. DPPA2 protein is reported to have a DNA-binding domain, the SAP (SAF-A/B, Acinus, and protein inhibitor of activated STATs [PIAS]) motif [10], which comprises two amphipathic helices separated by an invariant glycine [11] and potentially may have roles in chromatin configuration and modification or gene expression regulation through modifying epigenetic status and interaction with different transcription factors, respectively [11, 12]. Furthermore, DPPA2 may have roles in association with the initiation and/or progress of deprogramming and maintenance of the undifferentiated proliferative state of stem cells [12, 13]. Interestingly, the developmental expression pattern of DPPA2 is similar to OCT4 [14] and is restricted to pluripotent stem cells and the developing germ line cells. However, DPPA2 is aberrantly expressed in a range of cancers including lung, liver, and lymphoma malignancies [9, 13]. In 1970, Lin and Spradling described the PIWI family proteins as a subfamily of argonautes in the drosophila germ line cells. This group of proteins has four homologs in human beings, highly conserved during evolution [15]. One of these homologs was named HIWI and is cytogenetically mapped to 12q24.33 and encodes a 98.5-kDa protein. HIWI gene was originally isolated from a human testis cDNA library [16, 17]. The HIWI protein is comprised of a conserved architecture containing PIWI/Argonaute/Zwille (PAZ) and PIWI motifs [18, 19]. Generally, PIWI proteins have remarkable and impressive biological capacities in stem cells such as biogenesis/ regulation of small RNAs and control of mRNA stability/ protein synthesis, showing conserved functions related to maintenance and self-renewal of both embryonic and germ line stem cells during development [20–22]. HIWI does not only seems to play a significant role in the proliferation of stem cells, but it also plays crucial roles in stem cell division and self-renewal, germ cell proliferation and gametogenesis, and also gene expression regulation through RNAi mechanism in various organisms [20–22]. HIWI was also expressed in spermatocytes and round spermatids during spermatogenesis, and
increased rate of its mRNA expression (63 %) has been reported in testicular seminoma [20–24]. Moreover, HIWI is overexpressed in other types of cancer such as esophageal squamous cell carcinoma and hepatocellular carcinoma [25, 26]. The molecular process of CRC tumorigenesis functions as a complicated network including different critical changes at genetic or epigenetic levels. Despite of well-documented genetic changes such as mutations in tumor suppressor genes (APC and p53) or oncogenes (K-Ras) [27, 28], the epigenetic modifications in CRC cells which lead to changing of tumor cell transcriptome need further investigations. Having considered such statement, we performed mRNA expressional analysis of DPPA2 and HIWI genes in CRC tissue samples to evaluate the impact of these genes on CRC tumorigenesis and related clinicopathological features.
Material and method Study subjects Between March 2009 and February 2012, tumoral and distant tumor-free tissues of 46 CRC patients were obtained before any therapeutic procedure including preoperative chemotherapy or radiotherapy and surgery. All tumor and normal samples were submitted for histopathological analysis by experts in the field to ensure the purity of tumor. One of the criteria was to select samples with >70 % tumor cells controls. In accordance with the Mashhad University of Medical Sciences (MUMS) ethical guidelines, all of the enrolled patients were informed about the study and gave their written consent for the investigation as described before [29]. cDNA synthesis and quantitative RT-PCR Total RNA was extracted from normal and tumor tissues of the patients using the RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA quality and quantity were evaluated at an absorbance of 260 and 280 nm. First-strand cDNA was synthesized from 3 μg total RNA using oligo(dT)18 as amplification primer applying a reverse transcription-polymerase chain reaction (RT-PCR) kit (Fermentas, Vilnius, Lithuania). Quantitative real-time PCR was performed in a Stratagene Mx3000P thermocycler (Stratagene, La Jolla, CA). All samples were analyzed in triplicate. SYBR Green was used for the amplification of the DPPA2 as well as HIWI in a total volume of 20 μl reaction. Each reaction consisted of 10 μl SYBR green, 3 μl cDNA, 0.5 μl of each primer (10 pmol/μl), and 6 μl RNase-free water. Thermal cycling conditions were 10 min at 95 °C followed by 45 cycles at 95 °C for 40 s, 62 °C for 40 s, and 72 °C for 40 s. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was employed as an
Tumor Biol. Table 1 Primer set sequences used in real-time PCR HIWI DPPA2 GAPDH
Forward primer
Reverse primer
ATGATTGAAGTGGATGACAGAACTG GAAATACAATCCAGGTCATCTACTTC GGAAGGTGAAGGTCGGAGTCA
TACTTGACAACAGACAGACAACTAT GCATATCTTGCCGTTGTTCAGG GTCATTGATGGCAACAATATCCACT
endogenous control to normalize the data [30]. Real-time RTPCR primers for DPPA2, HIWI, and GAPDH were designed by AlleleID software 6.0 (PREMIER Biosoft, CA, USA), as shown in Table 1. A more than twofold fluorescence intensity of mRNA expression in tumor tissue, compared to corresponding normal tissue, was considered an overexpression for each gene. Less than twofold indicated underexpression, and the range in between was interpreted as no change in expression.
Results The expression of DPPA2 and HIWI was analyzed in 46 fresh frozen tumors and their normal margins by qRT-PCR .The clinicopathological features of the patients are described in Table 2.
Statistical analysis The statistical analysis was performed using SPSS 19.0 (SPSS, Chicago, IL, USA). The associations between gene expressions and different histopathological factors were analyzed by χ2 test or the Fisher exact test, when required. Independent sample t test and ANOVA were applied to compare expression levels of each gene between different Table 2 Clinicopathological features of the patients and their correlation with HIWI and DPPA2 gene expression
categorical data. Correlation between DPPA2 and HIWI levels of gene expression was assessed by Pearson’s correlation, and association between gene overexpression was assessed by χ2test. P value
RESEARCH ARTICLE
Aberrant expression of DPPA2 and HIWI genes in colorectal cancer and their impacts on poor prognosis Reza Raeisossadati & Mohammad Reza Abbaszadegan & Meysam Moghbeli & Alireza Tavassoli & Alexandre Hiroaki Kihara & Mohammad Mahdi Forghanifard
Received: 16 October 2013 / Accepted: 23 January 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014
Abstract Cancer cells have countless behaviors of pluripotent embryonic stem cells and germ line cells, such as unlimited proliferation, self-renewal, and migration. Expression of specific germ line and embryonic genes in tumor cells may be associated with indefinite growth and invasiveness of such cells. Developmental pluripotency factor 2 (DPPA2) and HIWI are two important developmental genes which are involved in embryonic and germ line stem cell properties. Deciphering the role of these genes seems to be necessary for understanding cancer initiation and progression. Tumoral and normal tissues from 46 colorectal cancer (CRC) patients were subjected to gene expression analysis using quantitative real-time reverse transcription-polymerase chain reaction, R. Raeisossadati : M. R. Abbaszadegan : M. Moghbeli Division of Human Genetics, Immunology Research Center, Avicenna Research Institute, Mashhad University of Medical Sciences, Mashhad, Iran A. H. Kihara Núcleo de Cognição e Sistemas Complexos, Centro de Matemática, Computação e Cognição, Universidade Federal do ABC, Santo Andre, Brazil M. R. Abbaszadegan Medical Genetics Research Center, Medical School, Mashhad University of Medical Sciences, Mashhad, Iran A. Tavassoli Endoscopic and Minimally Invasive Research Center, Qaem Hospital, Mashhad, Iran M. M. Forghanifard (*) Department of Biology, Damghan Branch, Islamic Azad University, Cheshmeh-Ali Boulevard, Sa’dei Square, P.O. Box: 3671639998, Damghan, Iran e-mail: [email protected] M. M. Forghanifard e-mail: [email protected]
prior to any therapeutic intervention. Overexpression of DPPA2 and HIWI was detected in 26.1 and 34.8 % of specimens, respectively. Significant correlation between DPPA2 overexpression and lymph node metastasis of the tumor cells (P=0.049) was seen in the samples with advanced stages (III/IV) of the tumor development. HIWI mRNA expression was significantly associated to the depth of tumor invasion (P = 0.020) and the stage of tumorigenesis progression (P=0.030). In samples with overexpression of at least one gene, DPPA2 mRNA expression was significantly correlated to the stage of tumor (P=0.017). In the same samples, a significant correlation was observed between mRNA expression of HIWI and the stage of tumor cells (P=0.034). These results documented the important role of HIWI and DPPA2 in tumorigenesis and also in lymph node metastasis of tumor cells. Further evaluation is required to uncover the detailed role of HIWI and DPPA2 and their interactions in tumorigenesis of CRC. Keywords Colorectal cancer . DPPA2 . HIWI . Expressional analysis . Real-time PCR
Introduction Colorectal cancer (CRC) is known as the third most prevalent tumor type in the world, which causes approximately 400,000 deaths per year [1, 2]. In developed regions, in spite of trifling diminution in cancer incidence and mortality rates throughout the past two decades, CRC remains the third most common cancer in these countries with nearly 50,000 deaths per year [3]. In Iran, CRC is also reported as one of the most frequent malignancies, with an incidence rate of 8 per 100,000 and a mortality rate of 1.3 and 1.8 per 100,000 in females and males, respectively [4, 5]. Several studies have been reported that approximately 40–50 % of CRC patients that undergo tumor resection show subsequent metastasis of tumor cells through
Tumor Biol.
the bloodstream or lymphatic circulation to other tissues and organs, which leads to significant decrease of the 5-year survival of the patients [6]. Therefore, early detection of the malignancy with accurate methods is absolutely vital to increase the patients’ survival through on-time tumor resection [5, 7]. Since many properties of cancer cells including selfrenewal, proliferation, and indefinite growth are shared with embryonic and germ line stem cells of different development stages [8], deciphering the involved genes and their role in cancer cells can bring new insight into cancer events and tumorigenesis. Developmental pluripotency factor 2 (DPPA2) and HIWI are two important developmental genes which are involved in embryonic and germ line stem cells properties. DPPA2 gene is located on chromosome 3q13 and encodes a protein product of 297 amino acids [9]. DPPA2 protein is reported to have a DNA-binding domain, the SAP (SAF-A/B, Acinus, and protein inhibitor of activated STATs [PIAS]) motif [10], which comprises two amphipathic helices separated by an invariant glycine [11] and potentially may have roles in chromatin configuration and modification or gene expression regulation through modifying epigenetic status and interaction with different transcription factors, respectively [11, 12]. Furthermore, DPPA2 may have roles in association with the initiation and/or progress of deprogramming and maintenance of the undifferentiated proliferative state of stem cells [12, 13]. Interestingly, the developmental expression pattern of DPPA2 is similar to OCT4 [14] and is restricted to pluripotent stem cells and the developing germ line cells. However, DPPA2 is aberrantly expressed in a range of cancers including lung, liver, and lymphoma malignancies [9, 13]. In 1970, Lin and Spradling described the PIWI family proteins as a subfamily of argonautes in the drosophila germ line cells. This group of proteins has four homologs in human beings, highly conserved during evolution [15]. One of these homologs was named HIWI and is cytogenetically mapped to 12q24.33 and encodes a 98.5-kDa protein. HIWI gene was originally isolated from a human testis cDNA library [16, 17]. The HIWI protein is comprised of a conserved architecture containing PIWI/Argonaute/Zwille (PAZ) and PIWI motifs [18, 19]. Generally, PIWI proteins have remarkable and impressive biological capacities in stem cells such as biogenesis/ regulation of small RNAs and control of mRNA stability/ protein synthesis, showing conserved functions related to maintenance and self-renewal of both embryonic and germ line stem cells during development [20–22]. HIWI does not only seems to play a significant role in the proliferation of stem cells, but it also plays crucial roles in stem cell division and self-renewal, germ cell proliferation and gametogenesis, and also gene expression regulation through RNAi mechanism in various organisms [20–22]. HIWI was also expressed in spermatocytes and round spermatids during spermatogenesis, and
increased rate of its mRNA expression (63 %) has been reported in testicular seminoma [20–24]. Moreover, HIWI is overexpressed in other types of cancer such as esophageal squamous cell carcinoma and hepatocellular carcinoma [25, 26]. The molecular process of CRC tumorigenesis functions as a complicated network including different critical changes at genetic or epigenetic levels. Despite of well-documented genetic changes such as mutations in tumor suppressor genes (APC and p53) or oncogenes (K-Ras) [27, 28], the epigenetic modifications in CRC cells which lead to changing of tumor cell transcriptome need further investigations. Having considered such statement, we performed mRNA expressional analysis of DPPA2 and HIWI genes in CRC tissue samples to evaluate the impact of these genes on CRC tumorigenesis and related clinicopathological features.
Material and method Study subjects Between March 2009 and February 2012, tumoral and distant tumor-free tissues of 46 CRC patients were obtained before any therapeutic procedure including preoperative chemotherapy or radiotherapy and surgery. All tumor and normal samples were submitted for histopathological analysis by experts in the field to ensure the purity of tumor. One of the criteria was to select samples with >70 % tumor cells controls. In accordance with the Mashhad University of Medical Sciences (MUMS) ethical guidelines, all of the enrolled patients were informed about the study and gave their written consent for the investigation as described before [29]. cDNA synthesis and quantitative RT-PCR Total RNA was extracted from normal and tumor tissues of the patients using the RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA quality and quantity were evaluated at an absorbance of 260 and 280 nm. First-strand cDNA was synthesized from 3 μg total RNA using oligo(dT)18 as amplification primer applying a reverse transcription-polymerase chain reaction (RT-PCR) kit (Fermentas, Vilnius, Lithuania). Quantitative real-time PCR was performed in a Stratagene Mx3000P thermocycler (Stratagene, La Jolla, CA). All samples were analyzed in triplicate. SYBR Green was used for the amplification of the DPPA2 as well as HIWI in a total volume of 20 μl reaction. Each reaction consisted of 10 μl SYBR green, 3 μl cDNA, 0.5 μl of each primer (10 pmol/μl), and 6 μl RNase-free water. Thermal cycling conditions were 10 min at 95 °C followed by 45 cycles at 95 °C for 40 s, 62 °C for 40 s, and 72 °C for 40 s. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was employed as an
Tumor Biol. Table 1 Primer set sequences used in real-time PCR HIWI DPPA2 GAPDH
Forward primer
Reverse primer
ATGATTGAAGTGGATGACAGAACTG GAAATACAATCCAGGTCATCTACTTC GGAAGGTGAAGGTCGGAGTCA
TACTTGACAACAGACAGACAACTAT GCATATCTTGCCGTTGTTCAGG GTCATTGATGGCAACAATATCCACT
endogenous control to normalize the data [30]. Real-time RTPCR primers for DPPA2, HIWI, and GAPDH were designed by AlleleID software 6.0 (PREMIER Biosoft, CA, USA), as shown in Table 1. A more than twofold fluorescence intensity of mRNA expression in tumor tissue, compared to corresponding normal tissue, was considered an overexpression for each gene. Less than twofold indicated underexpression, and the range in between was interpreted as no change in expression.
Results The expression of DPPA2 and HIWI was analyzed in 46 fresh frozen tumors and their normal margins by qRT-PCR .The clinicopathological features of the patients are described in Table 2.
Statistical analysis The statistical analysis was performed using SPSS 19.0 (SPSS, Chicago, IL, USA). The associations between gene expressions and different histopathological factors were analyzed by χ2 test or the Fisher exact test, when required. Independent sample t test and ANOVA were applied to compare expression levels of each gene between different Table 2 Clinicopathological features of the patients and their correlation with HIWI and DPPA2 gene expression
categorical data. Correlation between DPPA2 and HIWI levels of gene expression was assessed by Pearson’s correlation, and association between gene overexpression was assessed by χ2test. P value
