CELL ADHESION & MIGRATION 2017, VOL. 11, NO. 4, 399–418 https://doi.org/10.1080/19336918.2016.1236179

RESEARCH PAPER

Aberrant adhesion impacts early development in a Dictyostelium model for juvenile neuronal ceroid lipofuscinosis Robert J. Hubera, Michael A. Myreb,y, and Susan L. Cotmanc,y a Department of Biology, Trent University, Peterborough, Ontario, Canada; bDepartment of Biological Sciences, University of Massachusetts Lowell, Lowell, Massachusetts, USA; cCenter for Human Genetic Research, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts, USA

ABSTRACT

ARTICLE HISTORY

Neuronal ceroid lipofuscinosis (NCL), also known as Batten disease, refers to a group of severe neurodegenerative disorders that primarily affect children. The most common subtype of the disease is caused by loss-of-function mutations in CLN3, which is conserved across model species from yeast to human. The precise function of the CLN3 protein is not known, which has made targeted therapy development challenging. In the social amoeba Dictyostelium discoideum, loss of Cln3 causes aberrant mid-to-late stage multicellular development. In this study, we show that Cln3deficiency causes aberrant adhesion and aggregation during the early stages of Dictyostelium development. cln3¡ cells form »30% more multicellular aggregates that are comparatively smaller than those formed by wild-type cells. Loss of Cln3 delays aggregation, but has no significant effect on cell speed or cAMP-mediated chemotaxis. The aberrant aggregation of cln3¡ cells cannot be corrected by manually pulsing cells with cAMP. Moreover, there are no significant differences between wild-type and cln3¡ cells in the expression of genes linked to cAMP chemotaxis (e.g., adenylyl cyclase, acaA; the cAMP receptor, carA; cAMP phosphodiesterase, pdsA; g-protein a 9 subunit, gpaI). However, during this time in development, cln3¡ cells show reduced cell-substrate and cell-cell adhesion, which correlate with changes in the levels of the cell adhesion proteins CadA and CsaA. Specifically, loss of Cln3 decreases the intracellular level of CsaA and increases the amount of soluble CadA in conditioned media. Together, these results suggest that the aberrant aggregation of cln3¡ cells is due to reduced adhesion during the early stages of development. Revealing the molecular basis underlying this phenotype may provide fresh new insight into CLN3 function.

Received 15 June 2016 Revised 23 August 2016 Accepted 6 September 2016

Introduction Neuronal ceroid lipofuscinosis (NCL), also known as Batten disease, is the most common cause of neurodegeneration in children, with incidence rates estimated to be between 1:25000 and 1:100000 depending on the region.1 Historically NCL was categorized based on the age of onset and pathological features, but with the growing number of NCL genes identified, now at 13, a genebased nomenclature has been proposed.2-3 Clinical manifestations of the disease include the progressive loss of vision, mental ability, and motor function, as well as epileptic seizures and a reduced lifespan.4 At the cellular level, abnormal lysosomal function leads to an excessive accumulation of lipofuscin in neurons and other cell types, which is a pathological hallmark of NCL.5 The most common subtype of NCL, which typically has onset in the juvenile years, is caused by recessive CONTACT Robert J. Huber, Ph.D K9J 7B8. y These authors contributed equally. © 2017 Taylor & Francis

[email protected]

KEYWORDS

calcium; cell adhesion; chemotaxis; CLN3; neuronal ceroid lipofuscinosis; development; Dictyostelium discoideum

loss-of-function mutations in CLN3 (ceroid-lipofuscinosis, neuronal 3).6 CLN3 encodes a 438 amino acid multi-pass transmembrane protein that is primarily found in endosomes and lysosomes.7 A number of different systems and cell models have been developed to study the function of CLN3.8 Studies have linked the protein to intracellular trafficking, autophagy, apoptosis, lysosomal pH homeostasis, cell cycle control, osmoregulation, and calcium homeostasis.9-22 However, the precise function of CLN3 is still not known. As a result, there are currently no effective treatments for the disease. The social amoeba Dictyostelium discoideum is increasingly being used as a model system for neurological disease research.23-24 Proteins linked to Alzheimer disease, Parkinson disease, Huntington’s disease, and lissencephaly have been studied and more recently, this organism has proved useful for studying the functions of proteins linked to

Trent University, Department of Biology, 2140 East Bank Drive, Peterborough, Ontario, Canada

400

R. J. HUBER ET AL.

NCL.25-30 The Dictyostelium genome encodes an ortholog of CLN3, as well as orthologs to most of the other known NCL genes, thus highlighting the potential of this eukaryotic system to serve as a valuable model for studying the functions of NCL proteins. Dictyostelium has a unique life cycle comprised of both single-cell and multicellular phases and serves as an excellent model system for studying a variety of cellular and developmental processes.31 During growth, cells feed on bacteria and undergo a period of continuous mitotic cell division. Upon starvation, cells transition to a developmental stage where individual cells secrete the chemoattractant cAMP in a pulsatile manner causing cells to aggregate into multicellular mounds. Following aggregation, cells within the multicellular aggregate undergo a process of differentiation to form a fruiting body composed of a mass of spores supported atop a stalk. In Dictyostelium, Cln3 localizes to both the contractile vacuole (CV) system and the endocytic pathway.29 Cln3deficiency leads to increased rates of cell proliferation and precocious multicellular development; abnormalities that are rescued by the expression of either Dictyostelium or human CLN3.29 Given these results, we sought to determine whether the observed aberrant mid-to-late stage development was due to events that occurred earlier in development, specifically during cell migration and aggregation. Intriguingly, aberrant wound healing has been reported in mammalian CLN3-deficiency models.32-33 CLN3-deficient cells eventually heal the wound however they do so at a significantly reduced rate. In this study, we assessed the early development of cln3¡ cells by examining their ability to chemotax toward cAMP and form multicellular aggregates. The results show that Cln3 is required for optimal adhesion and aggregation during early development via mechanisms that are independent of the cAMP signal transduction machinery.

Results cln3¡ cells display aberrant aggregation We previously reported Cln3-deficiency phenotypes during the mid-to-late stages of Dictyostelium development.29 Specifically, we observed an overall accelerated rate of development between 12 and 24 hours of cln3¡ cells as compared to wild-type (WT).29 Based on those observations, as well as the dramatic increase in cln3 mRNA expression during the early stages of development,34 we sought to assess the effect of Cln3-deficiency on the earlier developmental processes that occur prior to those covered in that study. After 3 hours of starvation, which initiates multicellular development, there was no obvious difference between WT and cln3¡ cells (Fig. 1A). Aggregation ripples were observed after 4.5 hours of development in both cell lines. However they were larger and more pronounced in WT cells compared to cln3¡ cells (Fig. 1A). After 6 hours of development, cells of both lines had aggregated, however WT aggregates appeared tighter and more compact than cln3¡ aggregates (Fig. 1A). After 9 hours, both WT and cln3¡ cells had developed into multicellular mounds (Fig. 1A).When cells were plated at equal concentrations, Cln3-deficient cells consistently formed a greater number of mounds (»30%) compared to WT (genotype effect, one-way ANOVA, p < 0.05) (Fig. 1B). Moreover, cln3¡ mounds were smaller than those formed by WT cells (Fig. 1A, inset). Expression of GFP-Cln3 under the control of the act15 promoter in cln3¡ cells effectively restored the number and size of mounds to WT levels (Fig. 1A, B). The delayed and aberrant formation of cln3¡ mounds led us to investigate the localization of GFP-Cln3 during these early developmental stages. During the single cell growth phase, GFP-Cln3 co-localizes with VatC, Rh50, and p80.29 VatC forms part of the peripheral subunit of the V-ATPase

Figure 1. Effect of Cln3-deficiency on Dictyostelium aggregation and mound formation. (A) Cells imaged after 3, 4.5, 6, and 9 hours of development. M, mound. R, Ripple. Scale bar D 1 mm. (B) Quantification of the number of mounds observed after 9 hours of development. Data presented as the mean number of mounds § SEM (n > 10). p-value < 0.05 vs. WT [one-way ANOVA (p < 0.05) followed by the Bonferroni multiple comparison test].

CELL ADHESION & MIGRATION

that generates an acidic environment in several intracellular compartments, including the CV and endosomal systems.35,36 However the protein is enriched »10-fold in the CV system. The rhesus-like glycoprotein Rh50 is a protein of unknown function that localizes exclusively to the CV

401

system, while p80 is a late endosomal protein, also of unknown function.37,38 Consistent with our previous observations of GFP-Cln3 localization during growth,29 GFPCln3 localized predominantly to the vacuoles and tubules of the CV system (VatC and Rh50 co-localization), and to a smaller extent, to intracellular vesicles (VatC and p80 colocalization) and punctate distributions within the cytoplasm (VatC and p80 co-localization) (Fig. 2, localization indicated by arrows and labels). Together, these results suggest that the loss of a yet-to-be-defined function of Cln3 at the site of the CV and/or endocytic systems is responsible for the effects on normal growth and development in Dictyostelium. Cln3-deficiency delays aggregation The aberrant early development of cln3¡ cells led us to investigate whether there was an effect of Cln3-deficiency on cAMP chemotaxis. Consistent with this hypothesis, aberrant wound healing has been reported for mammalian cell models lacking CLN3.32-33 CLN3-deficient cells eventually heal the wound, however they do so at a significantly reduced rate compared to WT. In this study, we looked specifically at the chemotactic motility of Cln3-deficient cells toward cAMP using a well-established bioradial assay that assesses the total distance migrated by a population of cells over a 4 hour period (Fig. 3A). Cells are deposited on agar that contains a uniform concentration of cAMP. The starving cells make their own cAMP gradient by secreting cAMP-phosphodiesterase to locally break-down extracellular cAMP.39 Although cln3¡ cells were able to respond to cAMP, the total distance migrated by cln3¡ cells was significantly less compared to WT (Fig. 3A, B). Cells deposited on agar that did not contain cAMP did not migrate outwards, but instead migrated inwards and began to form multicellular aggregates (Fig. 3C). After 4 hours of starvation on agar that did not contain cAMP, the area of cln3¡ cell spots was significantly greater compared to WT, indicating that aggregation was delayed in cln3¡ cells (Fig. 3D). Like aggregation on cellulose filters (Fig. 1), cln3¡ cells also formed a larger number of aggregation centers compared to WT (Fig. 3C). Since the bioradial assay only quantifies the total distance migrated during a certain period of time, it cannot Figure 2. Localization of GFP-Cln3 in Dictyostelium cells during growth and starvation. Growth-phase cells and cells starved for 3 and 6 hours in KK2 buffer were fixed either in ultra-cold methanol (for VatC and Rh50 immunostaining) or 4% paraformaldehyde (for p80 immunostaining) and then probed with anti-VatC, antiRh50, and anti-p80, followed by secondary antibodies linked to Alexa 555 (red). Cells were stained with DAPI to reveal nuclei (blue). Images were merged with ImageJ. P, punctate. T, tubules. VC, vacuoles. VS, vesicles. Scale bars D 5 mm.

402

R. J. HUBER ET AL.

determine if cln3¡ cells have subtle defects in chemotaxis or cell speed. To address this possibility, we assessed the motility and chemotactic index (CI) of cln3¡ cells toward natural

Figure 3. (For figure legend, see page 403)

cAMP waves generated by aggregation territories. WT and cln3¡ cells were starved for 6 hours in KK2 buffer to achieve chemotactic responsiveness. Cells were then collected and

CELL ADHESION & MIGRATION

deposited onto glass slides and allowed to form natural aggregation centers. A small aliquot of starved cells was added to the slide and chemotaxis was observed using brightfield time-lapse microscopy. No significant difference in speed or CI was detected between WT and cln3¡ cells (Fig. 3E, F). To more closely examine early developmental events, cells were starved on plastic 6-well dishes and time-lapse microscopy was used to capture the onset of cell de-adhesion from the substrate, cAMP wave pulsing, and cell migration toward cAMP emanating from natural aggregation centers. Cell-substrate adhesion decreases during the early stages of development prior to cAMP pulsing and multicellular streaming.40,41 In this study, both WT and cln3¡ cells de-adhered from the substrate after »1.5 hours of starvation (Fig. 4A). However, the onset of cAMP wave pulsing and onset of migration toward the aggregation center were significantly delayed in cln3¡ cells compared to WT (Fig. 4BC). There was no significant effect of Cln3-deficiency on the periodicity of cAMP waves (Fig. 4D). Adherent Dictyostelium cells appear dark and amoeboid, while detached cells appear white and rounded. After 2 and 4 hours of starvation, cln3¡ cells were more rounded compared to WT, suggesting that they were detached from the substrate (discussed further below) (Fig. 4E). Cln3-deficiency delayed multicellular streaming by »1 hour compared to WT (Fig. 4E), but had no obvious effect on the number of aggregation centers (Fig. 4F). Interestingly, while cln3¡ cells did eventually stream, the streams they formed were consistently shorter than WT (Fig. 4G, Image 1) and often broke apart prior to reaching the aggregation center (Fig. 4G, Image 2). Our previous study reported a rescue of Cln3-deficiency phenotypes during mid-to-late stage development after treatment with the calcium chelator EGTA.29 Given these observations, and the fact that calcium signaling has also been linked to the starvation response in Dictyostelium,42 the effect of EGTA on the streaming of cln3¡ cells was assessed. Treatment of cln3¡ cells with EGTA (0.1 or 0.25 mM) restored the timing of stream formation to times observed for WT cells (Fig. 4E). Finally, to assess whether the aberrant streaming and aggregation of cln3¡ cells was due to altered cAMP signaling, cells were pulsed every 6 minutes over a 6-hour period with 75 nM cAMP. As expected, WT cells formed highly

403

polarized cells after being placed on a glass slide (Fig. 4H). In contrast, cln3¡ cells did not show a polarized morphology (Fig. 4H). Together, these results suggest that Cln3-deficiency impairs streaming morphology and aggregation in Dictyosteliuim. Effect of Cln3-deficiency on the expression of genes linked to cAMP signal transduction qPCR was used to assess whether the delayed early development of cln3¡ cells was due to alterations in the expression of genes required for streaming and aggregation. Upon starvation, adenylyl cyclase (AcaA) generates cAMP from ATP. cAMP is then secreted outside the cell where it functions as a chemoattractant by binding to the cAMP receptor (CarA) on the surface of neighboring cells. This binding initiates intracellular signal transduction that leads to chemotaxis, streaming, and aggregation. The signal is modulated by cAMP phosphodiesterase (PdsA) which degrades extracellular cAMP.39 Like Cln3, the G protein a 9 subunit (GpaI) negatively regulates growth and multicellular development in Dictyostelium.29,43,44 gpaI¡ cells form more cAMP signaling centers and complete aggregation sooner than WT cells, while overexpression of GpaI leads to defects in the formation of cAMP signaling centers.43 Given the similar phenotypes observed in cln3¡ and gpaI¡ cells, we wanted to assess the expression of gpaI during starvation. Consistent with previous studies, the expression of acaA, carA, pdsA, and gpaI increased in starved WT and cln3¡ cells (Fig. 5A).34 Importantly, there were no significant differences in gene expression between cell lines at any of the time points analyzed (Fig. 5A). We also observed no obvious differences between WT and cln3¡ cells in the level of CarA protein during starvation or in the localization of the protein to the cell surface (Fig. 5B-D). Together, these findings suggest that the delayed and aberrant aggregation of Cln3-deficient cells is not a result of deregulated expression of genes linked to the cells chemotactic machinery. Cln3-deficiency impairs cell-substrate and cell-cell adhesion during early development Cell-substrate and cell-cell adhesion are required for the migration and aggregation of cells during the early stages

Figure 3. (see previous page) Effect of Cln3-deficiency on cAMP chemotaxis. (A) Cells plated on 0.5% agar/KK2 C cAMP (10 mM). Pictures of cell spots were taken at 0 and 4 hours. Scale bar D 200 mm. (B) Quantification of the total distance migrated by cells after 4 hours. Data presented as the mean total distance migrated § SEM (nD14). p-value < 0.01 (2-sample t-test). (C) Cells plated on 0.5% agar/KK2. Pictures of cell spots were taken at 0 and 4 hours. Scale bar D 100 mm. (D) Quantification of the cell spot area that remained after 4 hours of starvation. Data presented as the mean area of cell spot remaining after 4 hours § SEM (n D 14). p-value < 0.05 (2-sample t-test). (E) The panels show the centroid tracks of 14 WT cells (left) and 12 cln3¡ cells (right) migrating in KK2 buffer toward natural aggregation territories (i.e., mounds, denoted M). Scale bar D 50 mm. (F) Quantitation of motility parameters. Speed and chemotactic index (CI) were measured as described in the Materials and Methods. Data presented as mean § SD (n D 3). Statistical significance was assessed using the 2-sample t-test. The p-values obtained were 0.361 and 0.063 for CI and cell speed, respectively.

404

R. J. HUBER ET AL.

of Dictyostelium development.41,45 As discussed above, when cells were developed on filters, WT aggregates appeared tighter and more compact than cln3¡

Figure 4. (For figure legend, see page 405)

aggregates (Fig. 1A). Since the onset of cell de-adhesion from the substrate was not significantly affected by the loss of Cln3, and the aberrant early development

CELL ADHESION & MIGRATION

appeared to be independent of cAMP signal transduction, it was important to assess whether the observed phenotypes were due to defects in cell-substrate and/or cell-cell adhesion. Cln3-deficiency significantly impaired cell-substrate adhesion after 3 hours of starvation, which was effectively restored through the expression of GFPCln3 in cln3¡ cells (Fig. 6A, B). In contrast, there was no effect of Cln3-deficiency on cell-substrate adhesion after 6 hours of starvation, suggesting that the defects in adhesion occurred during the period preceding multicellular streaming (Fig. 6A, B). During aggregation, Dictyostelium cells acquire EDTAresistant cell-cell adhesion due to the expression of the EDTA stable glycoprotein contact site A (CsaA).46 CsaA is a heavily glycosylated protein that mediates homophilic cell adhesion during the later stages of aggregation.46 csaA expression is induced by pulses of cAMP that are generated by starving cells, and the protein is anchored to the plasma membrane by a lipid glycan.47,48 In the absence of EDTA, cell-cell adhesion was significantly reduced in cln3¡ cells compared to WT after 2 and 4 hours of starvation (Fig. 7A, B). Interestingly, as was observed in the cell-substrate adhesion assay, there was no significant effect of Cln3-deficiency on cell-cell adhesion after 6 hours of starvation (Fig. 7A, B). In the presence of EDTA, cell-cell adhesion was significantly reduced in cln3¡ cells compared to WT after 4 and 6 hours of starvation (Fig. 7C, D). Finally, to assess whether the aberrant cell-cell adhesion was due to defects in cAMP signal transduction, cln3¡ cells were manually pulsed with cAMP. When pulsed with cAMP, WT cells formed multicellular clusters, while cln3¡ cells did not (Fig. 7E). Together, these data suggest that Cln3-deficiency impairs cell-substrate and cell-cell adhesion during the early stages of development and manual pulsing of cln3¡ cells with cAMP failed to correct the cell-cell adhesion defect. Cln3-deficiency alters the levels of the cell adhesion proteins CsaA and CadA during early development Based on the differences observed in our cell adhesion analyses, the effect of Cln3-deficiency on the intracellular

405

level of CsaA was assessed. After 6 hours of starvation, the amount of CsaA was significantly reduced (»25%) in cln3¡ cells compared to WT (Fig. 8A, B). Intriguingly, there was no significant difference between cell lines in the level of csaA mRNA during starvation, and no obvious difference in the localization of the protein (Fig 8C, D). The localization and function of CsaA is determined by its glycosylation status.49,50 Unmodified CsaA, which is stable and appears as a »50 kDa protein band on western blots, is non-functional and does not localize to the cell surface.49,50 In contrast, partially glycosylated CsaA, which appears as a »70 kDa protein band on western blots, is transported to the cell surface and can form EDTA-stable cell-cell contacts.49,50 To assess the effect of Cln3-deficiency on the glycosylation of CsaA, WT and cln3¡ cells were treated with tunicamycin, which is a potent inhibitor of glycosylation and EDTA-stable cellcell contacts.40,49-51 After 6 hours, WT cells treated with either DMSO (control) or tunicamycin had begun to stream, while cln3¡ cells remained as single cells (Fig. 8E). In DMSO-treated cells, there was again significantly less fully glycosylated CsaA in cln3¡ cells compared to WT (Fig. 8F, G). As expected, tunicamycin reduced the amount of fully glycosylated CsaA in both WT and cln3¡ cells (Fig. 8F, G). However the reduction in cln3¡ cells was more dramatic compared to WT (Fig. 8F). In addition to having a reduced amount of 80 kDa CsaA, cln3¡ cells treated with tunicamycin also had a reduced amount of the 70 kDa protein (Fig. 8F, H). Importantly, there was no significant difference in the level of 50 kDa CsaA between cell lines (Fig. 8F, H), which supports previous work that showed no effect of tunicamycin on protein synthesis.51 Together, these results indicate that Cln3-deficiency reduces the intracellular level of CsaA, but that the reduced level cannot be explained by alterations in csaA expression. Moreover, these data indicate that cln3¡ cells are more sensitive to tunicamycin than WT cells. During the early stages of development, CsaA functions together with cell adhesion molecule A (CadA) to mediate cell-cell adhesion.52 CadA is a calcium-binding

Figure 4. (see previous page) Effect of Cln3-deficiency on streaming and aggregation during Dictyostelium starvation. (A) Effect of Cln3deficiency on the onset of cell de-adhesion from the substrate. Data presented as the mean onset of de-adhesion § SEM (n D 9). (B) Effect of Cln3-deficiency on the onset of cAMP pulsing. Data presented as the mean onset of cAMP pulsing § SEM (n D 9). (C) Effect of Cln3-deficiency on the onset of cell migration toward the aggregation center. Data presented as the mean onset of migration toward aggregation center § SEM (n D 9–10). (D) Effect of Cln3-deficency on the periodicity of cAMP waves. Data presented as the mean periodicity of cAMP waves § SEM (n D 9–10). (E) Screenshots obtained from time-lapse movies capturing the early development of WT and cln3¡ cells, and the effect of EGTA (0.1 mM and 0.25 mM) on cln3¡ streaming and aggregation. Scale bar D 250 mm. (F) Effect of Cln3-deficiency on the number of aggregation centers after 6–7 hours of starvation. Representative images from 3 independent experiments are shown. Scale bar D 0.25 cm. (G) Effect of Cln3-deficiency on the morphology of streaming cells. Two representative images are shown for each cell line. Scale bar D 250 mm. (H) Effect of manual cAMP pulsing on cln3¡ early development. Cells were pulsed with cAMP for 6 hours, after which time an aliquot of cells was vigorously vortexed and placed on a glass slide. Cells were then imaged 30 minutes post-plating (6.5 hours total starvation). Images are representative of results from 3 independent experiments. Scale bar D 100 mm (inset, 20 mm). p-value < 0.05 (2-sample t-test).

406

R. J. HUBER ET AL.

Figure 5. Effect of Cln3-deficiency on the expression of genes linked to cAMP signal transduction and the localization of CarA. (A) qPCR of genes linked to cAMP signal transduction. Data presented as the mean normalized gene expression § SEM (nD4). (B) Whole cell lysates (5 mg) from cells starved for 3 and 6 hours were separated by SDS-PAGE and analyzed by western blotting with anti-CarA and anti-b-actin (loading control). Molecular weight markers (in kDa) are shown to the right of each blot. (C) CarA protein bands were quantified and plotted. Data presented as the mean normalized band intensity § SEM (nD4). (D) Effect of Cln3-deficiency on the localization of CarA in WT and cln3¡ cells after 6 hours of starvation. Cells were incubated with anti-CarA followed by secondary antibodies linked to Alexa Fluor 488 (green). Two representative cells are shown for each strain. Scale bar D 5 mm.

protein that shares limited sequence similarity with classical cadherins.53,54 Cells initially contact each other via the binding of their filopodia, which are enriched in CadA.55 This is followed by a second stage of cell-cell adhesion mediated by CsaA.56 There were no significant differences between WT and cln3¡ cells in the expression of cadA or the intracellular level of CadA during growth or starvation (Fig. 9A-C). CadA is presented to the cell surface and secreted via a non-classical pathway involving the CV system.54,57 Although CadA lacks a signal sequence for secretion, it has been detected in conditioned media from developing cells and as an integral component of the extracellular matrix (ECM) during the mid-to-late stages of Dictyostelium development.58,59 Given these findings, and the observation that GFP-Cln3 localizes predominantly to the CV system in Dictyostelium (Fig. 2),29 we also examined whether Cln3-

deficiency had any effect on the secretion of CadA, and if defects in its secretion could explain the aberrant early development of cln3¡ cells. Intriguingly, after 6 hours of starvation, cln3¡ conditioned media contained significantly more CadA compared to WT (Fig. 9D, E). Together, these results suggest that Cln3-deficiency alters the extracellular levels of CadA and results in lower intracellular levels of CsaA, and that these alterations are concomitant with aberrant cell adhesion and early stage development of Cln3-deficient cells.

Discussion In this study, we have shown that loss of Cln3 causes adhesion and aggregation defects during the early stages of Dictyostelium development. Dictyostelium has historically served as an excellent model system for studying random

CELL ADHESION & MIGRATION

407

Figure 6. Effect of Cln3-deficiency on cell-substrate adhesion during Dictyostelium starvation. (A) Cells were deposited in 6-well dishes and allowed to adhere to the bottom of the dish for 2 hours. Cells were washed 2 times with KK2 buffer and then starved in KK2 buffer for 3 and 6 hours. Scale bars D 100 mm. (B) Cell-substrate adhesion after 3 and 6 hours of starvation. Data presented as the mean percent total protein compared to the 0 hour sample § SEM (n D 6). p-value < 0.01; p-value < 0.001 [one-way ANOVA (p D 0.001) followed by the Newman-Keuls multiple comparison test].

and directed cell movement, and aberrant wound healing has been reported for mammalian cell models lacking CLN3.32,33,60 In Dictyostelium, Cln3-deficiency delayed aggregation and caused cells to form a greater number of multicellular mounds that were comparatively smaller than

those formed by WT cells. cln3¡ cells showed »1 hour delay in the initiation of both cAMP pulsing and multicellular streaming. However, these phenotypes were not due to alterations in the expression of genes linked to cAMP signal transduction. cln3¡ cells showed reduced

408

R. J. HUBER ET AL.

Figure 7. Effect of Cln3-deficiency on cell-cell adhesion during Dictyostelium starvation. (A-D) Cells starved for 0, 2, 4, and 6 hours were added to separate wells of a 12-well dish containing KK2 buffer § EDTA (20 mM). Dishes were spun at 150 rpm for 30 minutes at room temperature. Cells were fixed with glutaraldehyde and then placed in a hemocytometer for analysis. Scale bar D 250 mm. Data presented as the mean percent single cells § SEM (nD4). Control: Concentration of the cell suspension at 0 hours. p-value < 0.05; pvalue < 0.01; p-value < 0.001 [one-way ANOVA (p < 0.0001) followed by the Newman-Keuls multiple comparison test]. (E) Effect of manual cAMP pulsing on the adhesion of cln3¡ cells. Cells were pulsed with cAMP for 6 hours and imaged. Images are representative of results from 3 independent experiments. Scale bar D 100 mm.

cell-substrate and cell-cell adhesion, which correlated with a decrease in the intracellular level of CsaA, and an increase in the amount of soluble CadA in conditioned media. Finally, the localization of GFP-Cln3 to the CV system and endocytic pathway during early development, coupled with the ability of GFP-Cln3 over-expression to correct the

delayed aggregation and aberrant formation of cln3¡ mounds, imply that these defects are at least in part mediated by a Cln3 function within the CV and/or endocytic systems. The expression of genes linked to cAMP signal transduction was normal in cln3¡ cells compared to WT.

CELL ADHESION & MIGRATION

Interestingly, we also observed no significant effect of Cln3deficiency on the levels of the extracellular quorum-sensing proteins conditioned medium factor (CMF) and countin (CtnA), which together modulate aggregate formation and size during early development (data not shown).61,62 CtnA is a 40-kDa component of the 450-kDa countin factor (CF) complex that negatively regulates cell adhesion and aggregate size.63 Similar to phenotypes observed in cln3¡ cells,

Figure 8. (For figure legend, see page 410)

409

high levels of CF cause reduced cell-cell adhesion, which leads to the breakup of streams and smaller mounds.63 While we observed no effect of Cln3-deficiency on the extracellular levels of CtnA, it remains possible that the levels of the other components of the CF complex may have been affected by the loss of Cln3. Under normal conditions, cellsubstrate adhesion decreases during the early stages of development prior to cAMP pulsing and multicellular

410

R. J. HUBER ET AL.

streaming.40,41 In this study, both WT and cln3¡ cells deadhered from the substrate after 1–2 hours of starvation. The primary defect in cln3¡ cells appeared to be their ability to re-adhere to the substrate and initiate cAMP pulsing and multicellular aggregation. In support of this, we observed no significant difference between WT and cln3¡ cells in speed or chemotactic ability. While cln3¡ cells were eventually able to stream and aggregate, albeit poorly, the aberrant cellsubstrate and cell-cell adhesion of these cells caused them to form abnormal streams and mounds. The ability of GFPCln3 expression to rescue these defects in cln3¡ cells showed that the phenotype was a direct result of the loss of Cln3. Research using mammalian cell models has linked CLN3 function to intracellular trafficking.9,10,13,15,19 Based on the results presented in this study, it is reasonable to suggest that Cln3 may relay cAMP signaling to the transport and/or secretion of vesicles that contain adhesion proteins. To support the aberrant adhesion of cln3¡ cells and the subsequent delay in early development, we observed a reduction in the intracellular level of CsaA, which could not be easily explained by alterations in csaA expression or in the localization of the protein. These data suggest that Cln3 may be required for the trafficking of CsaA through the correct maturation pathway or for the turnover of the protein. In contrast to its effect on CsaA, Cln3-deficiency did not affect the expression or intracellular level of CadA, indicating that loss of Cln3 likely does not cause a global reduction in the levels of cell adhesion proteins. Previous work has shown that high levels of extracellular CadA have anti-adhesive effects,64 suggesting that the increased level of extracellular CadA in cln3¡ conditioned media contributed to the observed alterations in adhesion and aggregation. While the biological consequence of having more soluble CadA in conditioned media is not entirely clear, it is reasonable to suggest that increases in soluble CadA correlate with a reduction in the amount of CadA that is tethered to the cell membrane. Any such decreases

would ultimately compromise cell-cell adhesion. Interestingly, CadA is presented to the cell surface and secreted via a non-classical transport pathway involving the CV system.57,65 The protein localizes to the external surface of the plasma membrane and links to the membrane via the ABC (ATP-binding cassette) transporter, AbcB4.55,66 Coupled with the finding that GFP-Cln3 localizes predominantly to the CV system, these observations indicate that Cln3 may negatively affect CadA secretion. Alternatively, it is also possible that Cln3 may be required for the tethering of CadA to the cell membrane. Previous research has shown that alterations in CadA-mediated adhesion (e.g., blocked by EDTA) causes reductions in the level of CsaA.67 Moreover, under conditions where CadA-mediated cell contact is reduced, manual pulsing of cells with cAMP cannot induce csaA expression.67 These results may help to explain why manual pulsing of cln3¡ cells with cAMP failed to correct the aberrant adhesion and aggregation. Moreover, while the expression of genes linked to cAMP signal transduction were normal in cln3¡ cells compared to WT, our results do not rule out the possibility that activation of signaling components downstream of the cAMP receptor may be compromised. In total, these results suggest that the involvement of Cln3 in CadA-mediated cell adhesion warrants further investigation to gain a better insight into Cln3 function in Dictyostelium. Cell adhesion is known to play a very important role during all stages of the Dictyostelium life cycle.41,45 Recent proteomic profiling of conditioned media from developing cells, and the ECM surrounding the multicellular tissue commonly referred to as the slug, revealed the presence of a number of proteins linked to adhesion.58,59 Our previous study characterized Cln3-deficiency phenotypes during the mid-to-late stages of Dictyostelium development.29 Specifically, loss of Cln3 caused precocious development and enhanced slug migration.29 Based on the results presented

Figure 8. (see previous page) Effect of Cln3-deficiency on the expression and localization of CsaA during Dictyostelium starvation. (A) Whole cell lysates (5 mg) from growth-phase cells and cells starved for 6 hours in KK2 buffer were separated by SDS-PAGE and analyzed by western blotting with anti-CsaA and anti-b-actin (loading control). Molecular weight markers (in kDa) are shown to the left of each blot. (B) CsaA protein bands were quantified and plotted. Western blot (WB) data presented as the mean normalized band intensity § SEM (n D 4). (C) Effect of Cln3-deficiency on the expression of csaA. qPCR data presented as the mean normalized gene expression § SEM (n D 4). (D) Effect of Cln3-deficiency on the localization of CsaA in cells starved for 6 hours. Cells were incubated with anti-CsaA followed by secondary antibodies linked to Alexa Fluor 488 (green). Images are representative of 3 independent experiments. Scale bar D 25 mm. (E) Effect of tunicamycin on WT and cln3¡ cells during starvation. Cells were imaged after 6 hours of starvation. Scale bar D 200 mm. (F) Whole cell lysates (5 mg) from cells starved for 6 hours in KK2 buffer § tunicamycin were separated by SDS-PAGE and analyzed by western blotting with anti-CsaA and anti-b-actin (loading control). Immunoblots that were exposed for a longer period of time are included to show the immature forms of CsaA (indicated by arrows to the right of the blot). Molecular weight markers (in kDa) are shown to the left of each blot. DMSO (D, control), Tunicamycin (T, 0.4 mg/ml). (G) The amount of fully glycosylated CsaA in each sample was quantified and plotted. Data presented as the mean normalized band intensity § SEM (n D 3). (H) The amount of immature CsaA (70 kDa and 50 kDa) present in samples treated with tunicamycin was quantified and plotted. Data presented as the mean normalized band intensity § SEM (n D 3). p-value < 0.05 (2-sample t-test).

CELL ADHESION & MIGRATION

411

Figure 9. Effect of Cln3-deficiency on the intra- and extracellular levels of CadA during Dictyostelium starvation. (A) Whole cell lysates (WC, 5 mg) from cells starved for 0 and 6 hours in KK2 buffer were separated by SDS-PAGE and analyzed by western blotting with antiCadA and anti-b-actin (loading control). Molecular weight markers (in kDa) are shown to the left of each blot. (B) CadA protein bands were quantified and plotted. Western blot (WB) data presented as the mean amount of protein relative to WT 0 hour sample § SEM (n D 8). (C) Effect of Cln3-deficiency on the expression of cadA. qPCR data presented as the mean normalized gene expression § SEM (n D 4). (D) Equal volumes of conditioned media (CM) from 6 hour starved cells (24 ml) were separated by SDS-PAGE and analyzed by western blotting with anti-CadA, anti-b-actin (fractionation control), and anti-tubulin (fractionation control). Molecular weight markers (in kDa) are shown to the left of each blot. (E) CadA protein bands were quantified and plotted. Data presented as the mean amount of protein relative to WT sample § SEM (n D 8). p-value < 0.01 (one-sample t-test).

in this study, an important question to now consider is whether aberrant adhesion also plays a role in the Cln3-deficiency phenotypes observed during the mid-to-late stages of development, or if the aberrant adhesion of cln3¡ cells during early development sets the stage for later developmental phenotypes. The delay in the onset of cln3¡ early development was interesting given our previous observation that cln3¡ cells develop precociously following the formation of mounds.29 While these results may seem contradictory, other Dictyostelium knockout mutants have also been shown to develop precociously for only some stages of the life cycle. Like cln3¡ cells, loss of Png (peptide N-glycanase), which is involved in the degradation of misfolded glycosylated proteins, causes delayed

aggregation, but precocious mid-to-late stage development.68 Knockout of grlJ (glutamate receptor-like protein) or pisA (protein inhibitor of STAT) results in precocious development following aggregation.69,70 Finally, knockout of iplA (inositol 1,4,5-trisphosphate receptor-like protein) delays aggregation by 1–2 hours.71 The observations that grlJ¡ and iplA¡ cells, which are linked to calcium homeostasis, display similar developmental timing as cln3¡ cells was interesting given that altered calcium homeostasis has been observed in mammalian cell models that lack functional CLN3.14,17,22 Calcium is an important signaling molecule throughout Dictyostelium development, and is required for a number of processes including migration, adhesion, and aggregation.37,65,72-74 Our work has shown that

412

R. J. HUBER ET AL.

Cln3-deficiency phenotypes observed during development can be suppressed by treating cells with the calcium chelator EGTA.29 As discussed above, GFP-Cln3 localized primarily to the CV system during early development. The CV system in Dictyostelium is a major store of intracellular calcium. It is required for cAMPinduced calcium influx during chemotaxis, and is the organelle where calmodulin, the primary sensor of intracellular calcium predominantly localizes.65,75,76 The findings presented in this study suggest that cln3¡ cells may inappropriately buffer calcium from the environment, ultimately interfering with the local calcium transients that precede cAMP relay.73 Together, these results provide further support for altered calcium homeostasis in cln3¡ cells, and highlight the importance of analyzing the involvement of calcium in the function of Cln3 in Dictyostelium and in mammalian systems. In summary, we have shown that Cln3 is required for optimal adhesion and aggregation during early Dictyostelium development. The identification of early developmental phenotypes in Cln3-deficient cells, coupled with previous research showing aberrant mid-to-late stage development of cln3¡ cells, suggests that future work in Dictyostelium may be able to provide fresh new insight into the primary function of CLN3.

Materials and methods Dictyostelium cell lines, chemicals, and antibodies AX3 (parental line for cln3¡ cells hereafter referred to as wild-type, WT) and cln3¡ cells were grown and maintained at room temperature on SM agar with Klebsiella aerogenes.77 Cells were also grown axenically at room temperature and 150 rpm in HL5 medium supplemented with ampicillin (100 mg/ml) and streptomycin sulfate (300 mg/ml). cln3¡ were maintained under selection with blasticidin S hydrochloride (10 mg/ml), while cell lines carrying the extrachromosomal vector pTX-GFP were maintained under selection with G418 (10 mg/ ml).78 HL5 and low-fluorescence HL5 were purchased from Formedium. EGTA, cAMP, tunicamycin, and glutaraldehyde were purchased from Sigma-Aldrich. Mouse monoclonal anti-p80,38 mouse monoclonal anti-CsaA (33-294-17),49,50 mouse monoclonal anti-VatC,36 and mouse monoclonal anti-tubulin (12G10) were purchased from the Developmental Studies Hybridoma Bank. Rabbit polyclonal anti-Rh5037 was provided as a gift by Dr. Pierre Cosson. Rabbit polyclonal anti-CadA79 was provided as a gift by Dr. Chi-Hung Siu. Rabbit polyclonal anti-CarA80 was provided as a gift by Dr. Carole A. Parent. Mouse monoclonal anti-b-actin was purchased from Santa Cruz Biotechnology. All Alexa Fluor-conjugated

secondary antibodies Technologies.

were

purchased

from

Life

Dictyostelium development Cells grown in HL5 were harvested in the mid-log phase of growth (1–5 £ 106 cells/ml) and washed 2 times with KK2 buffer (2.2 g/L KH2PO4, 0.7 g/L K2HPO4, pH 6.5). Washed cells (3 £ 107 cells/ml) were deposited in 4 individual droplets (30 ml droplet in 6 mm £ 6 mm area) on black, gridded, cellulose filters (0.45 mm pore size) overlaid on 4 Whatman #3 cellulose filters (EMD Millipore) pre-soaked in KK2 buffer. Cells were maintained in a humidity chamber at room temperature in complete darkness. Structures were viewed and photographed with a Nikon SMZ800 microscope (Nikon Instruments Inc., Melville, NY, USA) equipped with a SPOT Insight color camera 3.2.0 (Diagnostic Instruments Inc., Sterling Heights, MI, USA). Images were captured with SPOT for Windows (Diagnostic Instruments Inc., Sterling Heights, MI, USA). After 9 hours, the number of mounds present in each 6 mm £ 6 mm area where cells were deposited was scored for each of the 4 droplets and averaged by 4 to obtain a mean value for that experiment (i.e., n D # of independent experiments). Statistical significance was assessed in GraphPad Prism 5 (GraphPad Software Inc., La Jolla, CA, USA) using one-way ANOVA followed by the Bonferroni multiple comparison test. A p-value < 0.05 was considered significant. Radial bioassay of Dictyostelium cAMP chemotaxis Chemotaxis toward cAMP was assessed using a radial bioassay.81 Briefly, cells in the mid-log phase of growth (1–5 £ 106 cells/ml) were harvested from HL5, washed 2 times with KK2 buffer, and plated (1.5£108 cells/ml) in 0.5 ml volumes on 0.5% agar/KK2 § cAMP (10 mM). Cell spots were imaged using a Nikon Eclipse TE2000-U microscope equipped with a Nikon Digital Sight DS-Qi1Mc digital camera (Nikon Instruments Inc., Melville, NY, USA). Images were viewed and analyzed using ImageJ. Statistical significance was assessed in GraphPad Prism 5 (GraphPad Software Inc., La Jolla, CA, USA) using the 2-sample t-test. A p-value < 0.05 was considered significant. Analysis of cAMP chemotaxis and behavior during natural aggregation The behavior of WT and cln3¡ cells in response to endogenously generated natural cAMP waves was analyzed. Cells starved for 6 hours in KK2 buffer were added dropwise to 750 ml of fresh KK2 buffer on a clean glass slide (4 £ 4 cm). Once mounds began to form, a small

CELL ADHESION & MIGRATION

aliquot of freshly starved cells were deposited onto the slide, which was then placed on the stage of an Olympus IX81 inverted microscope (Olympus Life Science Solutions, Center Valley, PA, USA) and left undisturbed for 30 minutes to allow cells to settle. Brightfield images of chemotaxing cells were then acquired at 20 second intervals for 30 minutes with Image Pro Plus 7 (Media Cybernetics, Rockville, MD, USA). Cell behavior was analyzed for motility parameters using the Image Pro Plus 2D Object Tracking tool. Chemotactic index (CI) was determined by calculating the net distance traveled (mm) in the direction of the aggregation territory divided by the total distance traveled (mm). The average speed was also determined for each cell line (mm/min). Experiments were performed in triplicate and the values represent the mean § SD computed for the population of cells. Statistical significance was assessed using the 2-sample t-test. A p-value < 0.05 was considered significant. Dictyostelium starvation and streaming assay Cells (5 £ 106 total) grown in HL5 and in the mid-log phase of growth (1–5 £ 106 cells/ml) were deposited in 6-well dishes and allowed to adhere to the surface for 2 hours. Cells were washed 2 times with KK2 buffer, and then starved in KK2 buffer while time-lapse movies capturing streaming and aggregation were taken with a Nikon Eclipse TE2000-U microscope equipped with a Nikon Digital Sight DS-Qi1Mc digital camera (Nikon Instruments Inc., Melville, NY, USA). Images and movies were captured and viewed with NIS Elements BR 3.0 (Nikon Instruments Inc., Melville, NY, USA). The onset of cell de-adhesion from the substrate, cAMP wave pulsing, and cell migration toward aggregation centers was determined through visual analysis of the recordings. Adherent Dictyostelium cells appear dark and amoeboid, while detached cells appear white and rounded. The onset of de-adhesion was identified when all of the cells in the field-of-view appeared white and rounded. For cAMP pulsing experiments, cells (5 £ 106 cells/ml) were starved in KK2 buffer and incubated at room temperature and 150 rpm. cAMP (75 nM) was added to cell suspensions every 6 minutes to simulate the natural pulsing of cAMP. After 6 hours, an aliquot of cells was vigorously vortexed and placed on a glass slide. Cells were then imaged 30 minutes post-plating. Aggregation centers formed during starvation were imaged with a Nikon SMZ1500 stereomicroscope equipped with a Nikon Digital Sight DS-Fi1 digital camera (Nikon Instruments Inc., Melville, NY, USA). Images were captured and viewed with NIS Elements F Package (Nikon Instruments Inc., Melville, NY, USA). For analysis of protein levels during starvation, growth-phase cells and cells starved for 3 and 6 hours in KK2 buffer were harvested and lysed. Conditioned media from 6-hour

413

starved cells was collected and filtered through a 0.45 mm filter unit. Proteins (5 mg) and equal volumes of conditioned media (24 ml) were separated by SDS-PAGE and analyzed by western blotting. For analysis of the effect of tunicamycin on the level of CsaA protein during early development, cells were deposited in 6-well dishes and starved in KK2 buffer for 3 hours, after which time they were treated with either tunicamycin (0.4 mg/ml) or DMSO (control, 0.02%). After an additional 3 hours of starvation (6 hours total), cells were imaged and lysed. Proteins (5 mg) were separated by SDSPAGE and analyzed by western blotting. Statistical significance was assessed in GraphPad Prism 5 (GraphPad Software Inc., La Jolla, CA, USA) using the one-sample or 2sample t-test. A p-value < 0.05 was considered significant. Dictyostelium cell-substrate adhesion assay Cells (5 £ 106 total) grown in HL5 and in the mid-log phase of growth (1–5 £ 106 cells/ml) were deposited in 6-well dishes and allowed to adhere to the bottom of the dish (i.e., the substrate) for 2 hours. Cells were washed 2 times with KK2 buffer and then starved in KK2 buffer for 3 and 6 hours. At the onset of starvation, cells were resuspended in lysis buffer containing 0.5% NP-40, 50 mM Tris–HCl pH 8.0, 150 mM sodium chloride and a protease inhibitor cocktail tablet (Hoffmann-La Roche). After 3 and 6 hours of starvation, the conditioned media was removed from the wells and replaced with fresh KK2 buffer. Plates were then spun at 150 rpm for 5 minutes at room temperature, after which time the KK2 buffer was removed from the wells, and cells were resuspended in lysis buffer. The total protein concentration of each lysate was measured using the Pierce BCA Protein Assay Kit according to the manufacturer’s instructions (Life Technologies). Dictyostelium cell-cell adhesion assay Cell-cell adhesion was assessed using a protocol that has been described previously with modifications described below.82 Cells grown in HL5 and in the mid-log phase of growth (1–5 £ 106 cells/ml) were washed 2 times with KK2 buffer and then resuspended in KK2 buffer at a concentration of 5 £ 106 cells/ml. Cell suspensions were placed in 50 ml flasks, which were incubated at room temperature and shaken at 150 rpm. At the 0, 2, 4, and 6 hour time points, 2 ml were removed from each flask. Cells were spun down, resuspended in 1 ml of fresh KK2 buffer, and then vigorously vortexed. 400 ml of this cell suspension was then added to separate wells of a 12-well dish containing 400 ml of KK2 buffer § EDTA (20 mM). Dishes were spun at 150 rpm for 30 minutes at room temperature after which time 200 ml of 10%

414

R. J. HUBER ET AL.

glutaraldehyde in KK2 buffer was added to each well (while dish was spinning). Dishes were spun for an additional 10 minutes after which time cell suspensions were removed from the wells and placed into 1.5 ml tubes. Tubes were gently inverted to resuspend the cells/aggregates and the number of single cells was then counted with a hemocytometer. Statistical significance was assessed in GraphPad Prism 5 (GraphPad Software Inc., La Jolla, CA, USA) using one-way ANOVA followed by the Newman-Keuls multiple comparison test. A p-value < 0.05 was considered significant. For cAMP pulsing experiments, cells (5 £ 106 cells/ml) were starved in KK2 buffer and incubated at room temperature and 150 rpm. cAMP (75 nM) was added to cell suspensions every 6 minutes to simulate the natural pulsing of cAMP. After 6 hours, an aliquot of cells was placed on a glass slide. Cells were then imaged 10 minutes post-plating. Dictyostelium live cell imaging, fixation, and immunolocalization Cells were grown overnight on coverslips in low fluorescence HL5. Growth-phase cells, and cells starved for 3 and 6 hours in KK2 buffer, were fixed in either ultra-cold methanol (for anti-VatC and anti-Rh50 immunostaining) or 4% paraformaldehyde (for anti-p80 immunostaining), followed by immunolocalization using previously described methods.83,84 The following primary and secondary antibodies were used: anti-VatC (1:50), anti-Rh50 (1:2000), anti-p80 (1:50), anti-mouse Alexa Fluor 555 (1:100), and anti-rabbit Alexa Fluor 555 (1:100). Coverslips were mounted on slides with Prolong gold anti-fade reagent with DAPI (Life Technologies) and sealed with nail polish. Fixed cells were imaged with a Zeiss Axioskop2 mot plus epifluorescence microscope equipped with a Zeiss AxioCam MRm digital camera (Carl Zeiss Microscopy LLC, Thornwood, NY, USA). Merged images were generated using ImageJ. Immunolocalization of CarA and CsaA in WT and cln3¡ cells during early development was performed using a previously described method.85 Briefly, cells grown in HL5 and in the mid-log phase of growth (1–5 £ 106 cells/ml) were washed 2 times with KK2 buffer and then starved for 6 hours in KK2 buffer at room temperature and 150 rpm. After 6 hours, cell aliquots (100 ml) were incubated with the appropriate primary antibody on ice for 20 minutes (50 ml anti-CarA, 100 ml anti-CsaA). The cell-antibody mixture was vortexed every 5 minutes to disaggregate the cells. After 20 minutes, cells were spun down and washed 2 times with ice-cold KK2 buffer. Cells were then resuspended in secondary antibody solution (200 ml) containing a 1:500 dilution of either anti-mouse Alexa Fluor 488 or anti-rabbit Alexa Fluor 488. The cell-

antibody mixture was incubated on ice for 20 minutes and vortexed every 5 minutes to disaggregate the cells. Cells were then spun down and washed 2 times with KK2 buffer. Cells were resuspended in fresh KK2 (100 ml) and placed on ice. An aliquot of cells (20 ml) was then placed on a slide, covered with a coverslip, and imaged immediately (within 2–3 minutes) on a Zeiss Axioskop2 mot plus epifluorescence microscope equipped with a Zeiss AxioCam MRm digital camera (Carl Zeiss Microscopy LLC, Thornwood, NY, USA). SDS-PAGE and western blotting Proteins (5 mg) were separated by SDS-PAGE and analyzed by western blotting with anti-CarA (1:4000), antiCsaA (1:500), anti-CadA (1:5000), anti-tubulin (1:1000), and anti-b-actin (1:1000). Immunoblots were digitally scanned using a GS800 Calibrated Densitometer scanner and Quantity One software (Bio-Rad Laboratories Inc., Hercules, CA, USA). For each protein, the relevant bands from WT and cln3¡ samples were quantified from the same blot with ImageJ. Protein levels were then normalized to b-actin levels. Statistical significance for CarA and CsaA protein level analysis was assessed using the 2-sample t-test. Statistical significance for CadA protein level analysis was assessed using the one-sample t-test (mean, 100; 2-tailed). A p-value < 0.05 was considered significant. RNA extraction, cDNA synthesis, and qPCR Cells grown in HL5 and in the mid-log phase of growth (1– 5 £ 106 cells/ml) were starved in KK2 buffer at room temperature and 150 rpm. After 0, 2, 4, and 6 hours, cells (1 £ 107 total) were spun down, flash frozen in liquid nitrogen, and stored at ¡80 C. Total RNA was extracted from frozen cell pellets using the RNeasy Plus Mini Kit according to the manufacturer’s instructions (Qiagen). During RNA extraction, samples were treated with the RNase-Free DNase Set according to the manufacturer’s instructions (Qiagen). cDNA was synthesized from total RNA (1 mg) using MMuLV Reverse Transcriptase according to the manufacturer’s instructions (New England Biolabs). qPCR was performed using the SsoFast EvaGreen Supermix and the CFX96 Touch Real-Time PCR Detection System according to the manufacturer’s instructions (Bio-Rad Laboratories Canada Limited, Mississauga, ON, Canada). Samples from 4 independent experiments were harvested. For each experiment, 3 technical replicates were performed for each primer pair. Data was analyzed using CFX Manager Software (Bio-Rad Laboratories Canada Limited, Mississauga, ON, Canada). Gene expression at each time point was normalized against the levels of glyceraldehyde-3-phosphate

CELL ADHESION & MIGRATION

Table 1. Primers used for qPCR. Gene

Direction

Sequence

AcaA

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

GAGAAAATGTCTGATTTCGC CATTCTAGAGGCGGTATTGG CACCAGATTCTGAAATTGTTAGC GGGAATGTCTCATCTTTTTTAATAAC GTTCAAGTCGTGGTACTTCTG ATGATGATAAAGAAGATGAAGATGAAC GAAAGCTGGTATCTCAAATGTTG GAATCTGGAGCACAAACTATATCAG CGTTGCACTTGGTGATTATG CCACCTTGGTAATCTGGG GATCAACTCTTGGTTCAATCC CCATTATTATTTGCTTCTTTTAATTG GTTGTCCCAATTGGTATTAATG GTGGGTTGAATCATATTTGAAC

cadA carA csaA gpaI pdsA gpdA

dehydrogenase (gpdA). The primers used for qPCR are found in Table 1.

Abbreviations AbcB4 AcaA CadA CarA CLN3 CM CsaA CV ECM ER GpaI GFP JNCL NCL PdsA VatC VatM WT

ATP-binding cassette transporter B4 adenylyl cyclase A cell adhesion molecule A cAMP receptor A ceroid-lipofuscinosis, neuronal 3 conditioned media contact site A contractile vacuole extracellular matrix endoplasmic reticulum g-protein a 9 subunit green fluorescent protein juvenile NCL neuronal ceroid lipofuscinosis cAMP phosphodiesterase A vacuolar ATPase subunit C vacuolar ATPase subunit M wild-type

Funding This work was supported by a Postdoctoral Fellowship from the Canadian Institutes of Health Research (MFE127336 to R.J.H.) and the National Institutes of Health: National Institute of Neurological Disorders & Stroke (R01NS073813 to S.L.C.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

References [14] [1] Williams RE. Appendix 1: NCL incidence and prevalence data. In: Mole SE, Williams RE, Goebel HH, editors. The neuronal ceroid lipofuscinoses (Batten

415

Disease), second edition. Oxford: Oxford University Press; 2011. p. 361-5. Williams RE, Mole SE. New nomenclature and classification scheme for the neuronal ceroid lipofuscinoses. Neurology 2012; 79:183-91; PMID:22778232; https://doi.org/ 10.1212/WNL.0b013e31825f0547 Mole SE, Cotman SL. Genetics of the neuronal ceroid lipofuscinoses (Batten disease). Biochim Biophys Acta 2015; 1852:2237-41; PMID:26026925; https://doi.org/10.1016/j. bbadis.2015.05.011 Schulz A, Kohlsch€ utter A, Mink J, Simonati A, Williams R. NCL diseases – clinical perspectives. Biochim Biophys Acta 2013; 1832:1801-6; PMID:23602993; https://doi. org/10.1016/j.bbadis.2013.04.008 RadkeJ,StenzelW,GoebelHH.HumanNCLNeuropathology. Biochim Biophys Acta 2015; 1852:2262-6; PMID:25989315; https://doi.org/10.1016/j.bbadis.2015.05.007 The International Batten Disease Consortium. Isolation of a novel gene underlying Batten disease, CLN3. Cell 1995; 82:949-57; PMID:7553855; https://doi.org/10.1016/ 0092-8674(95)90274-0 Cotman SL, Staropoli JF. The juvenile Batten disease protein, CLN3, and its role in regulating anterograde and retrograde post-Golgi trafficking. Clin Lipidol 2012; 7:7991; PMID:22545070; https://doi.org/10.2217/clp.11.70 Faller KM, Gutierrez-Quintana R, Mohammed A, Rahim AA, Tuxworth RI, Wager K, Bond M. The neuronal ceroid lipofuscinoses: Opportunities from model systems. Biochim Biophys Acta 2015; 1852:2267-78; PMID:25937302; https:// doi.org/10.1016/j.bbadis.2015.04.022 Luiro K, Yliannala K, Ahtiainen L, Maunu H, J€arvel€a I, Kytt€al€a A, Jalanko A. Interconnections of CLN3, Hook1 and Rab proteins link Batten disease to defects in the endocytic pathway. Hum Mol Genet 2004; 13:3017-27; PMID:15471887; https://doi.org/10.1093/hmg/ddh321 Fossale E, Wolf P, Espinola JA, Lubicz-Nawrocka T, Teed AM, Gao H, Rigamonti D, Cattaneo E, MacDonald ME, Cotman SL. Membrane trafficking and mitochondrial abnormalities precede subunit c deposition in a cerebellar cell model of juvenile neuronal ceroid lipofuscinosis. BMC Neurosci 2004; 5:57; PMID:15588329; https://doi. org/10.1186/1471-2202-5-57 Cao Y, Espinola JA, Fossale E, Massey AC, Cuervo AM, MacDonald ME, Cotman SL. Autophagy is disrupted in a knock-in mouse model of juvenile neuronal ceroid lipofuscinosis. J Biol Chem 2006; 281:20483-93; PMID:16714284; https://doi.org/10.1074/jbc.M602180200 Stein CS, Yancey PH, Martins I, Sigmund RD, Stokes JB, Davidson BL. Osmoregulation of ceroid neuronal lipofuscinosis type 3 in the renal medulla. Am J Physiol Cell Physiol 2010; 298:1388-1400; https://doi.org/10.1152/ ajpcell.00272.2009 Cao Y, Staropoli JF, Biswas S, Espinola JA, MacDonald ME, Lee JM, Cotman SL. Distinct early molecular responses to mutations causing vLINCL and JNCL presage ATP synthase subunit C accumulation in cerebellar cells. PLoS One 2011; 6:e17118; PMID:21359198; https:// doi.org/10.1371/journal.pone.0017118 An Haack K, Narayan SB, Li H, Warnock A, Tan L, Bennett MJ. Screening for calcium channel modulators in CLN3 siRNA knock down SH-SY5Y neuroblastoma cells reveals a significant decrease of intracellular calcium

416

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

R. J. HUBER ET AL.

levels by selected L-type calcium channel blockers. Biochim Biophys Acta 2011; 1810:186-91; PMID:20933060; https://doi.org/10.1016/j.bbagen.2010.09.004 Uusi-Rauva K, Kytt€al€a A, van der Kant R, Vesa J, Tanhuanp€a€a K, Neefjes J, Olkkonen VM, Jalanko A. Neuronal ceroid lipofuscinosis protein CLN3 interacts with motor proteins and modifies location of late endosomal compartments. Cell Mol Life Sci 2012; 69:2075-89; PMID:22261744; https://doi.org/10.1007/s00018-011-0913-1 Kang S, Kim JB, Heo TH, Kim SJ. Cell cycle arrest in Batten disease lymphoblast cells. Gene 2013; 519:245-50; PMID:23458879; https://doi.org/10.1016/j.gene.2013.02.022 Warnock A, Tan L, Li C, An Haack K, Narayan SB, Bennett MJ. Amlodipine prevents apoptotic cell death by correction of elevated intracellular calcium in a primary neuronal model of Batten disease (CLN3 disease). Biochem Biophys Res Commun 2013; 436:645-9; PMID:23769828; https://doi.org/ 10.1016/j.bbrc.2013.04.113 Vidal-Donet JM, Carcel-Trullols J, Casanova B, Aguado C, Knecht E. Alterations in ROS activity and lysosomal pH accountfor distinctpatterns of macroautophagy in LINCLand JNCL fibroblasts. PLoS One 2013; 8:e55526; PMID:23408996; https://doi.org/10.1371/journal.pone.0055526 Tecedor T, Stein CS, Schultz ML, Farwanah H, Sandhoff K, Davidson BL. CLN3 loss disturbs membrane microdomain properties and protein transport in brain endothelial cells. J Neurosci 2013; 33:18065-79; PMID:24227717; https://doi.org/10.1523/JNEUROSCI.0498-13.2013 Lojewski X, Staropoli JF, Biswas-Legrand S, Simas AM, Haliw L, Selig MK, Coppel SH, Goss KA, Petcherski A, Chandrachud U, et al. Human iPSC models of neuronal ceroid lipofuscinosis capture distinct effects of TPP1 and CLN3 mutations on the endocytic pathway. Hum Mol Genet 2014; 23:2005-22; PMID:24271013; https://doi. org/10.1093/hmg/ddt596 Zhu X, Huang Z, Chen Y, Zhou J, Hu S, Zhi Q, Song S, Wang Y, Wan D, Gu W, et al. Effect of CLN3 silencing by RNA interference on the proliferation and apoptosis of human colorectal cancer cells. Biomed Pharmacother 2014; 68:253-8; PMID:24556023; https://doi.org/10.1016/ j.biopha.2013.12.010 Chandrachud U, Walker MW, Simas AM, Heetveld S, Petcherski A, Klein M, Oh H, Wolf P, Zhao WN, Norton S, et al. Unbiased cell-based screening in a neuronal cell model of Batten disease highlights an interaction between Ca2C homeostasis, autophagy, and CLN3 protein function. J Biol Chem 2015; 290:14361-80; PMID:25878248; https://doi.org/10.1074/jbc.M114.621706 Myre MA. Clues to g-secretase, huntingtin and Hirano body normal function using the model organism Dictyostelium discoideum. J Biomed Sci 2012; 19:41; PMID:22489754; https://doi.org/10.1186/1423-0127-19-41 Annesley SJ, Chen S, Francione LM, Sanislav O, Chavan AJ, Farah C, De Piazza SW, Storey CL, Ilievska J, Fernando SG, Smith PK, Lay ST, Fisher PR. Dictyostelium, a microbial model for brain disease. Biochim Biophys Acta 2014; 1840:1413-32; PMID:24161926; https://doi.org/ 10.1016/j.bbagen.2013.10.019 McMains VC, Myre M, Kreppel L, Kimmel AR. Dictyostelium possesses highly diverged presenilin/gamma-secretase that regulates growth and cell-fate specification and can accurately process human APP: a system for

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

functional studies of the presenilin/gamma-secretase complex. Dis Model Mech 2010; 3:581-94; PMID:20699477; https://doi.org/10.1242/dmm.004457 Meyer I, Kuhnert O, Gr€af R. Functional analyses of lissencephaly-related proteins in Dictyostelium. Semin Cell Dev Biol 2011; 22:89-96; PMID:21034843; https://doi. org/10.1016/j.semcdb.2010.10.007 Kortholt A, Gilsbach B, van Haastert PJM. Dictyostelium discoideum: A model system to study LRRK2-mediated Parkinson disease. In: Dushanova J, editor. Mechanisms in Parkinson disease - Models and treatments. Croatia: InTech; 2012. p. 293-310 Myre MA, Lumsden AL, Thompson MN, Wasco W, MacDonald ME, Gusella JF. Deficiency of huntingtin has pleiotropic effects in the social amoeba Dictyostelium discoideum. PLoS Genet 2011; 7:e1002052; PMID:21552328; https://doi.org/10.1371/journal.pgen.1002052 Huber RJ, Myre MA, Cotman SL. Loss of Cln3 function in the social amoeba Dictyostelium discoideum causes pleiotropic effects that are rescued by human CLN3. PLoS One 2014; 9:e110544; PMID:25330233; https://doi. org/10.1371/journal.pone.0110544 Phillips JE, Gomer RH. Partial genetic suppression of a loss of function mutant of the neuronal ceroid lipofuscinosis-associated protease TPP1 in Dictyostelium discoideum. Dis Model Mech 2015; 8:147-56; PMID:25540127; https://doi.org/10.1242/dmm.018820 Muller-Taubenberger A, Kortholt A, Eichinger L. Simple system - substantial share: The use of Dictyostelium in cell biology and molecular medicine. Eur J Cell Biol 2013; 92:45-53; PMID:23200106; https://doi.org/10.1016/j. ejcb.2012.10.003 Getty AL, Benedict JW, Pearce DA. A novel interaction of CLN3 with nonmuscle myosin-IIB and defects in cell motility of Cln3(¡/¡) cells. Exp Cell Res 2011; 317:5169; PMID:20850431; https://doi.org/10.1016/j. yexcr.2010.09.007 Schultz ML, Tecedor L, Stein CS, Stamnes MA, Davidson BL. CLN3 deficient cells display defects in the ARF1Cdc42 pathway and actin-dependent events. PLoS One 2014; 9:e96647; PMID:24792215; https://doi.org/10.1371/ journal.pone.0096647 Rot G, Parikh A, Curk T, Kuspa A, Shaulsky G, Zupan B. dictyExpress: A Dictyostelium discoideum gene expression database with an explorative data analysis web-based interface. BMC Bioinformatics 2009; 10:256; PMID:19695104; https:// doi.org/10.1186/1471-2105-10-265 Fok AK, Clarke M, Ma L, Allen RD. Vacuolar HCATPase of Dictyostelium discoideum. A monoclonal antibody study. J Cell Sci 1993; 106:1103-13; PMID:8126094 Journet A, Chapel A, Jehan S, Adessi C, Freeze H, Klein G, Garin J. Characterization of Dictyostelium discoideum cathepsin D: Molecular cloning, gene disruption, endolysosomal localization and sugar modifications. J Cell Sci 1999; 112:3833-43; PMID:10523518 Ravanel K, de Chassey B, Cornillon S, Benghezal M, Zulianello L, Gebbie L, Letourneur F, Cosson P. Membrane sorting in the endocytic and phagocytic pathway of Dictyostelium discoideum. Eur J Cell Biol 2001; 80:754-64; PMID:11831389; https://doi.org/10.1078/0171-9335-00215 Benghezal M, Gotthardt D, Cornillon S, Cosson P. Localization of the Rh50-like protein to the contractile vacuole in

CELL ADHESION & MIGRATION

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

Dictyostelium. Immunogenetics 2001; 52:284-8; PMID:11220631; https://doi.org/10.1007/s002510000279 Darmon M, Barra J, Brachet P. The role of phosphodiesterase in aggregation of Dictyostelium discoideum. J Cell Sci 1978; 31:233-43; PMID:209055 McDonald CJ, Sampson J. The effects of inhibition of protein glycosylation on the aggregation of Dictyostelium discoideum. J Embryol Exp Morphol 1983; 78:229-48; PMID:6319528 Tarantola M, Bae A, Fuller D, Bodenschatz E, Rappel WJ, Loomis WF. Cell substratum adhesion during early development of Dictyostelium discoideum. PLoS One 2014; 9:e106574; PMID:25247557; https://doi.org/ 10.1371/journal.pone.0106574 Tanaka Y, Itakura R, Amagai A, Maeda Y. The signals for starvation response are transduced through elevated [Ca2C]i in Dictyostelium cells. Exp Cell Res 1998; 240:340-8; PMID:9597007; https://doi.org/10.1006/ excr.1998.3947 Brzostowski JA, Johnson C, Kimmel AR. Galpha-mediated inhibition of developmental signal response. Curr Biol 2002; 12:1199-208; PMID:12176329; https://doi.org/ 10.1016/S0960-9822(02)00953-3 Bakthavatsalam D, Choe JM, Hanson NE, Gomer RH. A Dictyostelium chalone uses G proteins to regulate proliferation. BMC Biol 2009; 7:44; PMID:19635129; https:// doi.org/10.1186/1741-7007-7-44 Siu CH, Sriskanthadevan S, Wang J, Hou L, Chen G, Xu X, Thomson A, Yang C. Regulation of spatiotemporal expression of cell-cell adhesion molecules during development of Dictyostelium discoideum. Dev Growth Differ 2011; 53:518-27; PMID:21585356; https://doi.org/ 10.1111/j.1440-169X.2011.01267.x Murray BA, Niman HL, Loomis WF. Monoclonal antibody recognizing gp80, a membrane glycoprotein implicated in intercellular adhesion of Dictyostelium discoideum. Mol Cell Biol 1983; 3:863-70; PMID:6191197; https://doi.org/10.1128/MCB.3.5.863 Muller K, Gerisch G. A specific glycoprotein as the target site of adhesion blocking Fab in aggregating Dictyostelium cells. Nature 1978; 274:445-9; PMID:566857; https://doi.org/10.1038/274445a0 Stadler J, Keenan TW, Bauer G, Gerisch G. The contact site A glycoprotein of Dictyostelium discoideum carries a phospholipid anchor of a novel type. EMBO J 1989; 8:371-7; PMID:2721485 Hohmann HP, Bozzaro S, Yoshida M, Merkl R, Gerisch G. Two-step glycosylation of the contact site A protein of Dictyostelium discoideum and transport of an incompletely glycosylated form to the cell surface. J Biol Chem 1987; 262:16618-24; PMID:3316223 Hohmann HP, Bozzaro S, Merkl R, Wallraff E, Yoshida M, Weinhart U, Gerisch G. Post-translational glycosylation of the contact site A protein of Dictyostelium discoideum is important for stability but not for its function in cell adhesion. EMBO J 1987; 6:3663-71; PMID:16453812 Yamada H, Hirano T, Miyazaki T, Takatsuki A, Tamura G. Effects of tunicamycin on cell adhesion and biosynthesis of glycoproteins in aggregation-competent cells of Dictyostelium discoideum. J Biochem 1982; 92:399-406; PMID:6813319

417

[52] Coates JC, Harwood AJ. Cell-cell adhesion and signal transduction during Dictyostelium development. J Cell Sci 2001; 114:4349-58; PMID:11792801 [53] Knecht DA, Fuller DL, Loomis WF. Surface glycoprotein, gp24, involved in early adhesion of Dictyostelium discoideum. Dev Biol 1987; 121:277-83; PMID:3569662; https://doi.org/10.1016/0012-1606(87)90160-6 [54] Wong EFS, Brar SK, Sesaki H, Yang C, Siu C-H. Molecular cloning and characterization of DdCAD-1, a Ca2C-dependent cell-cell adhesion molecule, in Dictyostelium discoideum. J Biol Chem 1996; 271:16399-408; PMID:8663243; https://doi.org/10.1074/jbc.271.27.16399 [55] Sesaki H, Siu C-H. Novel redistribution of the Ca2Cdependent cell adhesion molecule DdCAD-1 during development of Dictyostelium discoideum. Dev Biol 1996; 177:504-11; PMID:8806827; https://doi.org/10.1006/ dbio.1996.0181 [56] Choi AH, Siu CH. Filopodia are enriched in a cell cohesion molecule of Mr 80,000 and participate in cell-cell contact formation in Dictyostelium discoideum. J Cell Biol 1987; 104:1375-87; PMID:3553212; https://doi.org/ 10.1083/jcb.104.5.1375 [57] Sesaki H, Wong EF, Siu CH. The cell adhesion molecule DdCAD-1 in Dictyostelium is targeted to the cell surface by a nonclassical transport pathway involving contractile vacuoles. J Cell Biol 1997; 138:939-51; PMID:9265658; https://doi.org/10.1083/jcb.138.4.939 [58] Bakthavatsalam D, Gomer RH. The secreted proteome profile of developing Dictyostelium discoideum cells. Proteomics 2010; 10:2556-9; PMID:20422638; https://doi. org/10.1002/pmic.200900516 [59] Huber RJ, O’Day DH. Proteomic profiling of the extracellular matrix (slime sheath) of Dictyostelium discoideum. Proteomics 2015; 15:3315-9; PMID:26152465; https:// doi.org/10.1002/pmic.201500143 [60] Okimura C, Ueda K, Sakumura Y, Iwadate Y. Fast-crawling cell types migrate to avoid the direction of periodic substratum stretching. Cell Adh Migr 2016; in press; [61] Gomer RH, Yuen IS, Firtel RA. A secreted 8010(3) Mr protein mediates sensing of cell density and the onset of development in Dictyostelium. Development 1991; 112:269-78; PMID:1663029 [62] Brock DA, Gomer RH. A cell-counting factor regulating structure size in Dictyostelium. Genes Dev 1999; 13:1960-9; PMID:10444594; https://doi.org/10.1101/gad.13.15.1960 [63] Roisin-Bouffay C, Jang W, Caprette DR, Gomer RH. A precise group size in Dictyostelium is generated by a cellcounting factor modulating cell-cell adhesion. Mol Cell 2000; 6:953-9; PMID:11090633; https://doi.org/10.1016/ S1097-2765(05)00082-1 [64] Siu C-H, Harris TJC, Wong EFS, Yang C, Sesaki H, Wang J. Cell adhesion molecules in Dictyostelium. In: Maeda Y, Inouye K, Takeuchi I, editors. Dictyostelium – A model system for cell and developmental Biology. Tokyo: University Academy Press; 1997. p. 111-21 [65] Sriskanthadevan S, Brar SK, Manoharan K, Siu CH. Ca (2C) -calmodulin interacts with DdCAD-1 and promotes DdCAD-1 transport by contractile vacuoles in Dictyostelium cells. FEBS J 2013; 280:1795-806; PMID:23441816; https://doi.org/10.1111/febs.12203 [66] Yang C, Hou L, Yang Q, Siu CH. ATP-binding cassette transporter B4 anchors the cell adhesion molecule

418

[67]

[68]

[69]

[70]

[71]

[72]

[73]

[74]

[75]

R. J. HUBER ET AL.

DdCAD-1 to cell membrane in Dictyostelium discoideum. Indian J Microbiol 2013; 53:460-6; PMID:24426151; https://doi.org/10.1007/s12088-013-0393-0 Desbarats L, Brar SK, Siu CH. Involvement of cell-cell adhesion in the expression of the cell cohesion molecule gp80 in Dictyostelium discoideum. J Cell Sci 1994; 107:1705-12; PMID:7962211 Gosain A, Lohia R, Shrivastava A, Saran S. Identification and characterization of peptide: N-glycanase from Dictyostelium discoideum. BMC Biochem 2012; 13:9; PMID:22682495; https://doi.org/10.1186/1471-2091-13-9 Prabhu Y, M€ uller R, Anjard C, Noegel AA. GrlJ, a Dictyostelium GABAB-like receptor with roles in post-aggregation development. BMC Dev Biol 2007; 7:44; PMID:17501984; https://doi.org/10.1186/1471-213X-7-44 Kawata T, Hirano T, Ogasawara S, Aoshima R, Yachi A. Evidence for a functional link between Dd-STATa and Dd-PIAS, a Dictyostelium PIAS homologue. Dev Growth Differ 2011; 53:897-909; PMID:21933174; https://doi. org/10.1111/j.1440-169X.2011.01296.x Schaloske RH, Lusche DF, Bezares-Roder K, Happle K, Malchow D, Schlatterer C. Ca2C regulation in the absence of the iplA gene product in Dictyostelium discoideum. BMC Cell Biol 2005; 6:13; PMID:15760480; https://doi. org/10.1186/1471-2121-6-13 Lusche DF, Wessels D, Soll DR. The effects of extracellular calcium on motility, pseudopod and uropod formation, chemotaxis, and the cortical localization of myosin II in Dictyostelium discoideum. Cell Motil Cytoskeleton 2009; 66:567-87; PMID:19363786; https://doi.org/ 10.1002/cm.20367 Scherer A, Kuhl S, Wessels D, Lusche DF, Raisley B, Soll DR. Ca2C chemotaxis in Dictyostelium discoideum. J Cell Sci 2010; 123:3756-67; PMID:20940253; https://doi.org/ 10.1242/jcs.068619 Poloz Y, O’Day DH. Ca2C signaling regulates ecmB expression, cell differentiation and slug regeneration in Dictyostelium. Differentiation 2012; 84:163-75; PMID:22595345; https://doi.org/10.1016/j.diff.2012.02.009 Malchow D, Lusche DF, Schlatterer C, De Lozanne A, M€ uller-Taubenberger A. The contractile vacuole in Ca2Cregulation in Dictyostelium: its essential function for cAMP-

[76]

[77]

[78]

[79]

[80]

[81]

[82] [83]

[84]

[85]

induced Ca2C-influx. BMC Dev Biol 2006; 6:31; PMID:16787542; https://doi.org/10.1186/1471-213X-6-31 Zhu Q, Clarke M. Association of calmodulin and an unconventional myosin with the contractile vacuole complex of Dictyostelium discoideum. J Cell Biol 1992; 118:347-58; PMID:1629238; https://doi.org/10.1083/ jcb.118.2.347 Fey P, Kowal AS, Gaudet P, Pilcher KE, Chisholm RL. Protocols for growth and development of Dictyostelium discoideum. Nat Protoc 2007; 2:1307-16; PMID:17545967; https:// doi.org/10.1038/nprot.2007.178 Levi S, Polyakov M, Egelhoff TT. Green fluorescent protein and epitope tag fusion vectors for Dictyostelium discoideum. Plasmid 2000; 44:231-8; PMID:11078649; https://doi.org/10.1006/plas.2000.1487 Brar SK, Siu CH. Characterization of the cell adhesion molecule gp24 in Dictyostelium discoideum. Mediation of cell-cell adhesion via a Ca(2C)-dependent mechanism. J Biol Chem 1993; 268:24902-9; PMID:8227052 Das S, Rericha EC, Bagorda A, Parent CA. Direct biochemical measurements of signal relay during Dictyostelium development. J Biol Chem 2011; 286:38649-58; PMID:21911494; https://doi.org/10.1074/jbc.M111.284182 O’Day DH. Aggregation during sexual development in Dictyostelium discoideum. Can J Microbiol 1979; 25:1416-26; PMID:231480; https://doi.org/10.1139/m79-221 Bozzaro S. Assaying cell-cell adhesion. Methods Mol Biol 2006; 346:449-67; PMID:16957307 Hagedorn M, Neuhaus EM, Soldati T. Optimized fixation and immunofluorescence staining methods for Dictyostelium cells. Methods Mol Biol 2006; 346:327-38; PMID:16957300 Charette SJ, Cosson P. Exocytosis of late endosomes does not directly contribute membrane to the formation of phagocytic cups or pseudopods in Dictyostelium. FEBS Lett 2006; 580:4923-8; PMID:16920105; https://doi.org/ 10.1016/j.febslet.2006.08.009 Thompson MN, MacDonald ME, Gusella JF, Myre MA. Huntingtin supplies a csaA-independent function essential for EDTA-resistant homotypic cell adhesion in Dictyostelium discoideum. J Huntingtons Dis 2014; 3:261-71; PMID:25300330