Am. J. Hum. Genet. 49:668-673, 1991
A Unique Mutation in the Vitamin D Receptor Gene in Three Japanese Patients with Vitamin D-dependent Rickets Type II: Utility of Single-Strand Conformation Polymorphism Analysis for Heterozygous Carrier Detection Takahiko Saijo, * Michinori Ito, Eiji Takeda, * A. H. M. Mahbubul Huq, * Etsuo Naito, * Ichiro Yokota,* Teruki Sonet J. Wesley Piket and Yasuhiro Kuroda* *
*Department of Pediatrics, University of Tokushima School of Medicine, Tokushima, Japan; and tDepartment of Cell Biology and Pediatrics, Baylor College of Medicine, Houston
Summary Vitamin D-dependent rickets type II is a hereditary disease resulting from a defective vitamin D receptor. In three Japanese patients with vitamin D-dependent rickets type II whose fibroblasts displayed normal cytosol binding and impaired nuclear uptake of 1,25-dihydroxyvitamin D3, western, Southern, and northern analyses failed to disclose any abnormalities in vitamin D3 receptor protein and its gene. Exons 2 and 3 of the vitamin D receptor cDNA, which encode the DNA-binding domain consisting of two zinc fingers, were amplified by PCR and sequenced to identify the specific mutations in the vitamin D receptor gene. In the three patients and one normal control a T-to-C transition was found in the putative initiation codon, while this transition was not observed in another normal control. This finding suggested that an original initiation codon was located at positions 10-12 in the human vitamin D receptor cDNA sequence reported previously. In contrast, a unique G-to-A transition at position 140 in exon 3, resulting in substitution of arginine by glutamine at residue 47, was revealed only in these three patients. The arginine at 47 is located between two zinc fingers and is conserved within all steroid hormone receptors. Therefore, it is highly conceivable that this amino acid substitution is responsible for the defect of the vitamin D receptor in the patients. Single-strand conformation polymorphism analysis of amplified DNA confirmed that all patients were homozygous and that parents from one family were heterozygous carriers for this mutation. Introduction Vitamin D-dependent rickets type II (VDDR II) is a hereditary disease characterized by early onset of
rickets associated with alopecia, hypocalcemia, hypophosphatemia, secondary hyperparathyroidism, and elevated levels of 1 ,25-dihydroxyvitamin D (1,25(OH)2D). This disease results from a spectrum of defects of the intracellular receptor for 1,25(OH)2D, which is a major biologically active vitamin D metabolite. Like all steroid hormone receptors, vitamin D Received April 3, 1991; revision received May 23, 1991. Address for correspondence and reprints: Takahiko Saijo, M.D., Department of Pediatrics, University of Tokushima School of Medicine, Kuramoto-cho 2, Tokushima 770, Japan. i 1991 by The American Society of Human Genetics. All rights reserved. 0002-9297/91 /4903-0021$02.00
668
receptor (VDR) is essentially comprised of two functional domains, a hormone-binding domain and a DNA-binding domain. The normal mechanism of vitamin D action involves binding of 1 ,25(OH)2D to the hormone-binding domain of the VDR. The DNAbinding domain of the VDR, which consists of two zinc fingers, in turn associates with specific DNA sequence elements located upstream of vitamin D-responsive gene promoters and modulates transcription of the vitamin D-responsive genes (Pike 1987; Kerner et al. 1989). Defective VDR from patients with VDDR II have been classified into three groups: hormonebinding defects, DNA-binding defects, and nucleartransfer or nuclear-localization defects (Liberman et al. 1983). In our previous studies on lymphocytes and cultured skin fibroblasts from three Japanese patients with
669
Mutant VDR Gene and Carrier Detection VDDR II, inhibition of DNA synthesis and induction of 25-hydroxyvitamin D-24-hydroxylase (24-hydroxylase) did not occur when the cells were exposed to 1 ,25(OH)2D3, showing that these cells were defective somewhere in the entire receptor-effector system for 1,25(OH)2D (Takeda et al. 1986, 1989). Patients' skin fibroblasts showed both normal cytosol binding of [3H]1,25(OH)2D3 and impaired nuclear uptake of [3H]1 ,25(OH)2D3, suggesting that the zinc-finger region of the VDR was defective (Takeda et al. 1989). We also suggested that this disease was an autosomal recessive disorder by showing intermediate levels of 24-hydroxylase induction in the parents (Takeda et al. 1990; Yokota et al., in press). Therefore, it would be important to identify genetic defects causing the disease and to detect heterozygous carriers at the molecular level. In the present study, we sequenced exons 2 and 3 of the VDR cDNA, which encode the zinc-finger region of the VDR. Single-strand conformation polymorphism (SSCP) analysis was applied to detect heterozygotes.
monoclonal antibody 9A7 (Pike 1984) as the first antibody and then with horseradish peroxidase (HRP)-labeled rabbit anti-rat IgG2b (Binding Site, Birmingham, England) as the second antibody. The immunoreactive protein was detected by using HRP color-development reagent (Bio-Rad).
Subjects and Methods Subjects Three Japanese patients with VDDR II (patients la, lb, and 2) from two families were studied. Patients la and lb (Takeda et al. 1989) were siblings, and their parents were first cousins.
First-Strand cDNA Synthesis and cDNA Amplification Total cellular RNA from fibroblasts of the patients was prepared by the methods described by Chomczynski and Sacchi (1987). Single-strand cDNA was synthesized from total RNA by using Moloney murine leukemia virus reverse transcriptase and a cDNA syn-
Cell Culture
Skin fibroblasts were grown in Eagle's minimal essential medium (Nissui, Tokyo) supplemented with 10% fetal bovine serum. Lymphocytes transformed with Epstein-Barr virus were cultured in RPMI-1 640 medium (Nissui) containing 15% fetal bovine serum. Western Blot Analysis
Western blot analysis was carried out according to the methods described by Malloy et al. (1989), with minor modification. In brief, purified fibroblast extracts were electrophoresed on a 10% SDS-polyacrylamide gel. The gel was incubated in 50 mM Tris pH 7.5 and 20% glycerol for 30 min at 240C with shaking. The proteins were transferred to nitrocellulose membrane (Bio-Rad, Richmond, CA) in 3 mM carbonate transfer buffer containing 20% methanol, for 16 h at 50 V. After electrophoretic transfer, the membrane was sequentially incubated with anti-VDR
Southern and Northern Blot Analyses
Genomic DNA was extracted from cultured lymphoblasts, and 10 gg of genomic DNA was digested with BamHI, EcoRI, MspI, PstI, or TaqI, was fractionated by electrophoresis in a 0.8% agarose gel, and was transferred to GeneScreenPlus (Dupont, Boston) nylon membrane. Poly(A)+ RNA was isolated from cultured lymphoblasts by a Fast Track mRNA isolation kit (Invitrogen, San Diego), and 25 gg of poly(A) + RNA was electrophoresed on a 1.0% agarose gel with 2.2 M formaldehyde and was transferred to the membrane. Hybridization of the blots was carried out according to instructions described by the membrane manufacturer, by using human VDR cDNA (Baker et al. 1988) which was labeled by the random priming method.
thesis kit (Bethesda Research Laboratories, Gaithersburg, MD) according to the manufacturer's instructions. Transcription was carried out at 37°C for 60 min in 50 jl of reaction mixture containing 10 g.g of total RNA. PCR amplification was carried out using 20 pl of the first-strand cDNA synthesis mixture as the template and 1 pM each of 27-oligonucleotide primers designed to amplify a 597-bp segment covering human VDR cDNA exons 2 and 3, which encoded the zincfinger region of the VDR (fig. 1). In each primer two nucleotides were substituted, so that the amplified segment would have an EcoRI recognition site at both ends. Thirty cycles of PCR were performed using a GeneAmp DNA amplification reagent kit (Perkin Elmer-Cetus, Norwalk, CT) according to the following program: 1 min denaturation at 94°C, 2 min annealing at 600C, and 3 min extension at 720C. Cloning and Sequencing of Amplified cDNA The PCR products were digested with EcoRI, isolated from low-melting-point agarose gels, and sub-
Saijo et al.
670 la
a-
If
I
2a Exon 2
hVDR cDNA Exon 3
-
2b
lb lOObp
Primers; la 5'AGTGTCTGTGAGAATTCACAGAAGAGC 3' lb 5'GAGTGTGTCTGGAATTCGGCCTGGAAG 3' 2a 5'CTGGCTTTCACTTCAAT 3' 2b 5 CAGTGGCGTCGGTTGTC 3'
Figure I Strategy of PCR for sequencing and SSCP analysis. Primers la and lb were used to amplify exons 2 and 3 as a single segment. Primers 2a and 2b, originally designed as internal primers for sequencing, were used in PCR for SSCP analysis. An arrowhead indicates the position of the point mutation in the patients.
cloned into an EcoRI-treated Bluescript II vector (Stratagene, La Jolla, CA). The recombinant plasmid was amplified by transforming Escherichia coli, strain XL1-Blue (Stratagene). To eliminate possible PCR errors, five clones from each patient were sequenced by the dideoxy chain-termination method using a Sequenase DNA sequence kit (United States Biochemical, Cleveland). Direct Search for a G-to-A Transition in Exon 3 of VDR cDNA by SSCP Analysis
A 1 33-bp segment of human VDR cDNA including both the last 52 bp of exon 2 and the first 81 bp of exon 3 was amplified by PCR (fig. 1). SSCP analysis was carried out by basically following the method described by Orita et al. (1989). The reaction mixture contained 1 gM of each of the 17-nucleotide primers, which were originally designed as internal primers for sequencing; 200 gM of each dNTP; 4 gl of the firststrand cDNA reaction mixture; 5 gCi [a-32P]dCTP (3,000 Ci/mmol, 10 mCi/ml; Amersham, Arlington Heights, IL); and 1 unit Taq DNA polymerase in 20 jl of amplification buffer. Then 1 jil of reaction mixture was added to 9 Jl of 95% formaldehyde dye, the mixture was boiled for 3 min, and then 1 jl of the sample was applied to a 6% polyacrylamide gel containing 1 x TBE (90 mM Tris-borate and 2 mM EDTA). Electrophoresis was performed at room temperature at 65 W. The gel was dried and autoradiographed overnight.
band was found in the normal subject (fig. 2, lane 1). In three patients with VDDR II, the size and the amount of the VDR protein were comparable to normal (fig. 2, lanes 2-4). Genomic digests with BamHI, EcoRI, MspI, PstI, or TaqI did not reveal any major deletions or structural alterations in the VDR locus (data not shown). In northern analysis of the VDR transcript, patient 2 had mRNA of normal size (4.6 kb) and amount (data not shown). Sequence Analysis of Exon 2 and Exon 3 of hVDR cDNA
The PCR products from the three patients and from two normal control subjects were of expected size, as assessed by agarose gel electrophoresis. In the clones from three patients and from one normal control, a T-to-C transition was found in the putative initiation codon in exon 2 of the normal human VDR cDNA sequence published by Baker et al. (1988), while in the clones from another normal control this transition was not found (fig. 3). Moreover, in all five clones from each patient, A was found at position 140 in exon 3, whereas in the clones from two normal controls and in
kDa 9366
52--m 45-
31-
1~~ ~~
~~~~~~~~
Results
Western, Southern, and Northern Blot Analyses In western blot analysis using anti-VDR monoclonal antibody, a single, 52-kDa immunoreactive
Figure 2 Western blot analysis of three patients with VDDR II. Lane 1, Normal control. Lanes 2-4; Patients la, ib, and 2, respectively. Immunoreactive bands of normal size and amount were detected in all patients.
Mutant VDR Gene and Carrier Detection hVDR cDNA Bakiret.L(gSS
Control 2 Patients lalb& 2
Control I
3.
671
32
3,
CG Ala 5 G T Met4 IOA A C Ala 3 G 0 A GIU 2 G 0 T Met I IA
Ala (2)
Ic Aba(2)
atMdf)
iO I aT Mst(1) 10
/T
JII3A
8a A
A
a
a8 a. T
G
G 6'
5'
Figure 3 Polymorphism in putative initiation codon of human VDR cDNA. An asterisk indicates the substituted nucleotide residue. Revised numbers for nucleotides and amino acids (or codons) are indicated in parentheses.
1 the previously published normal human VDR cDNA sequence, this position is occupied by a G (fig. 4). This G-to-A substitution alters Arg-47 to Gln in the zinc-finger region of the VDR.
Figure 5
2 3 4 5 6
7 8
SSCP analysis for G-to-A transition at position 140
in exon 3 of VDR cDNA. Lane 1, Normal control. Lanes 2-4, patients la, 1b, and 2, respectively. Lanes S and 6, parents of patient 2. Lane 7, Normal clone (Ni-i). Lane 8, mutant clone from patient la (la-1).
Direct Detection of G-to-A Substitution in Exon 3 by SSCP Analysis
The size of the major band amplified from cDNAs from three patients, from parents of patient 2, and from one normal control was 133 bp, as predicted. Segments of 133 bp were also amplified from a wildtype clone (N1-1) and from a mutant clone (la-1) by using the same pair of oligonucleotide primers and were analyzed to verify the electrophoretic patterns. Figure 5 illustrates the three patterns observed among the subjects. The pattern of the three patients (lanes 2, 3, and 4) was identical to that of the mutant clone (lane 8), and the pattern of the normal control (lane 1) was identical to that of the normal clone (lane 7). These two patterns were clearly separable from each Mutant
Normal
3'5' IAT AT GC
3'S' IAT *JilC TA _f..L ..
~~GC
a 2]Ar-47 A C G
Q X5C
CoG 5'3'
-
-
I
A C 6 T
A~~TAo Gln-47 TA
\GC vTA
VT aC 5'3'
Figure 4 Sequence analysis of normal and mutant VDR cDNA exon 3. Asterisks indicate the substituted nucleotide residues in the antisense and sense strands.
other. The pattern of the parents (lanes 5 and 6) suggested heterozygosity for this mutation. Discussion
Presence of VDR protein of both normal size and impaired nuclear uptake of 1 ,25(OH)2D3 in cultured skin fibroblasts from the patients with VDDR II suggested that the VDR protein DNA-binding domain, which consisted of two zinc fingers, was functionally defective in the patients. Results of Southern and northern analyses indicated that the abnormalities of the VDR gene in these patients were due to either point mutations or small insertions or deletions.Baker et al. (1988) recently cloned human VDR cDNA and showed that the zinc-finger region was encoded by exon 2 and exon 3 of the VDR gene. Therefore we focused on these two exons to identify genetic defects in the patients. Analysis of the amplified exons revealed both a T-to-C transition in exon 2 and a G-to-A transition in exon 3 in all patients. A T-to-C transition in the putative initiation codon in exon 2 was also found in one normal control, while this transition was not found in another. These findings suggested that this transition was not responsible for the defective VDR in the patients. They also indicated that the original initiation codon was not the three nucleotides at positions 1-3 but the second ATG sequence, located
Saijo et al.
672
at positions 10-12. Although they remain to be confirmed by amino acid sequencing of the N-terminus of the VDR, our findings were consistent with analysis of genomic DNA from a number of normal samples (R. A. Kesterson and J. W. Pike, unpublished data). In the present paper, nucleotides and either amino acids or codons are numbered with respect to the revised initiating methionine (i.e., for nucleotides, nine is deducted from the numbers assigned by Baker et al. [1988]; and, for amino acids or codons, three is deducted from the numbers assigned by Baker et al. [1988]). In contrast, a unique G-to-A transition at position 140 in exon 3 was revealed only in these three patients. This base change converted, at position 47, a GCA codon for arginine to a GAA codon for glutamine. The arginine at residue 47 is positionally conserved in the zinc-finger region within all steroid hormone receptors (Beato 1989), suggesting that it plays a critical role in receptor-DNA interactions. Therefore it is highly conceivable that this amino acid substitution is responsible for the defect of the VDR in our patients, although it remains to be determined by expression analysis whether this variant is of functional
significance. The identification of this point mutation in exon 3 of the VDR gene in our patients can be added to the three previously known mutations in the VDR gene encoding the zinc-finger region: in codon 30 of exon 2, a G-to-A transition which caused a Gly-to-Asp substitution (Hughes et al. 1988), and, in codons 70 and 77 of exon 3, a G-to-A point mutation which caused an Arg-To-Gln substitution (Hughes et al. 1988; Sone et al. 1990). It is of interest to note that these three amino acids are also conserved in all steroid hormone receptors. Three substitutions at codons 30, 70, and 77 are from different ethnic groups-Arabian, Haitian, and North African, respectively- and the point mutation that we have found in the present study was unique to Japanese patients. While there was no known kinship information to suggest that two kindreds were related, the nature of this rare mutation suggested a distant ancestral relationship. Because the mutation disclosed in our patients did not result in any change of restriction sites, we carried out SSCP analysis, which was recently proposed by Orita et al. (1989) to confirm heterozygosity of the parents. SSCP analysis relies on the differential electrophoretic mobility of single-stranded DNA under nondenaturing conditions, as even a single nucleotide substitution may induce conformational changes leading to mobility shifts. The electrophoretic pattern of the
amplified DNA from the patients was identical to that of DNA from the mutant clone and was clearly distinguishable from that of DNA from the normal clone, showing that all three patients are homozygous for this mutation. The pattern of the phenotypically normal parents was a mixture of the two patterns, indicating that these parents were heterozygous carriers. These results strongly support our previous studies on 24-hydroxylase induction (Takeda et al. 1990; Yokota et al., in press), which suggested that the disease was inherited as an autosomal recessive trait in the affected families. SSCP analysis was reported to be useful for detecting polymorphisms in Alu repeats and point mutations in both the ras oncogene and the human lipoprotein lipase gene (Orita et al. 1989; Hata et al. 1990). Whether SSCP analysis can disclose one nucleotide substitution remains to be confirmed. If it could, its technical simplicity would give it the capability to reveal previously unknown mutations in the amplified segment of DNA and would render it useful for largescale screening of genetic diseases as well as for heterozygote detection.
Acknowledgments This work was supported by grant 02670444 from the Ministry of Education, Science and Culture, Japan.
References Baker AR, McDonnell DP, Hughes M, Crisp TM, Mangelsdorf DJ, Haussler MR, Pike JW, et al (1988) Cloning and expression of full-length cDNA encoding human vitamin D receptor. Proc Natl Acad Sci USA 85:3294-3298 Beato M (1989) Gene regulation by steroid hormones. Cell 56:335-344 Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidium thiocyanate-phenolchloroform extraction. Anal Biochem 162:156-159 Hata A, Robertson M, Emi M, Lalouel J-M (1990) Direct detection and automated sequencing of individual alleles after electrophoretic strand separation: identification of a common nonsense mutation in exon 9 of the human lipoprotein lipase gene. Nucleic Acids Res 18:5407-5411 Hughes MR, Malloy PJ, Kieback DG, Kesterson RA, Pike JW, Feldman D, O'Malley BW (1988) Point mutations in the human vitamin D receptor gene associated with hypocalcemic rickets. Science 242:1702-1705 Kerner SA, Scott RA, Pike JW (1989) Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D3. Proc Natl Acad Sci USA 86:4455-4459
Mutant VDR Gene and Carrier Detection Liberman UA, Eil C, Marx SJ (1983) Resistance to 1,25dihydroxyvitamin D. J Clin Invest 71:192-200 Malloy PJ, Hochberg Z, PikeJW, Feldman D (1989) Abnormal binding of vitamin D receptors to deoxyribonucleic acid in a kindred with vitamin D-dependent rickets, type II. J Clin Endocrinol Metab 68:263-269 Orita M, Suzuki Y, Sekiya T, Hayashi K (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5: 874-879 Pike JW (1984) Monoclonal antibodies to chick intestinal receptors for 1,25-dihydroxyvitamin D3. J Biol Chem 259:1167-1173 (1987) Emerging concepts on the biologic role and mechanism of action of 1 ,25-dihydroxyvitamin D3. Steroids 49:3-27 Sone T. Marx SJ, Liberman UA, Pike JW (1990) A unique point mutation in the human vitamin D receptor gene confers hereditary resistance to 1,25-dihydroxyvitamin D3. Mol Endocrinol 4:623-631
673 Takeda E, Kuroda Y, Saijo T, Toshima K, Naito E, Kobashi H, Iwakuni Y, et al (1986) Rapid diagnosis of vitamin Ddependent rickets type II by use of phytohemagglutininstimulated lymphocytes. Clin Chim Acta 155:245-250 Takeda E, Yokota I, Ito M, Kobashi H, Saijo T, Kuroda Y (1990) 25-Hydroxyvitamin D-24-hydroxylase in phytohemagglutinin-stimulated lymphocytes: intermediate bioresponse to 1,25-dihydroxyvitamin D3 of cells from parents of patients with vitamin D-dependent rickets type II. J Clin Endocrinol Metab 70:1068-1074 Takeda E, Yokota I, Kawakami I, Hashimoto T, Kuroda Y, Arase S (1989) Two siblings with vitamin D-dependent rickets type II: no recurrence of rickets for 14 years after cessation of therapy. Eur J Pediatr 149:54-57 Yokota I, Takeda E, Ito M, Kobashi H, Saijo T, Kuroda Y. Clinical and biochemical findings in parents of children with vitamin D-dependent rickets type II. J Inherited Metab Dis (in press)
A Unique Mutation in the Vitamin D Receptor Gene in Three Japanese Patients with Vitamin D-dependent Rickets Type II: Utility of Single-Strand Conformation Polymorphism Analysis for Heterozygous Carrier Detection Takahiko Saijo, * Michinori Ito, Eiji Takeda, * A. H. M. Mahbubul Huq, * Etsuo Naito, * Ichiro Yokota,* Teruki Sonet J. Wesley Piket and Yasuhiro Kuroda* *
*Department of Pediatrics, University of Tokushima School of Medicine, Tokushima, Japan; and tDepartment of Cell Biology and Pediatrics, Baylor College of Medicine, Houston
Summary Vitamin D-dependent rickets type II is a hereditary disease resulting from a defective vitamin D receptor. In three Japanese patients with vitamin D-dependent rickets type II whose fibroblasts displayed normal cytosol binding and impaired nuclear uptake of 1,25-dihydroxyvitamin D3, western, Southern, and northern analyses failed to disclose any abnormalities in vitamin D3 receptor protein and its gene. Exons 2 and 3 of the vitamin D receptor cDNA, which encode the DNA-binding domain consisting of two zinc fingers, were amplified by PCR and sequenced to identify the specific mutations in the vitamin D receptor gene. In the three patients and one normal control a T-to-C transition was found in the putative initiation codon, while this transition was not observed in another normal control. This finding suggested that an original initiation codon was located at positions 10-12 in the human vitamin D receptor cDNA sequence reported previously. In contrast, a unique G-to-A transition at position 140 in exon 3, resulting in substitution of arginine by glutamine at residue 47, was revealed only in these three patients. The arginine at 47 is located between two zinc fingers and is conserved within all steroid hormone receptors. Therefore, it is highly conceivable that this amino acid substitution is responsible for the defect of the vitamin D receptor in the patients. Single-strand conformation polymorphism analysis of amplified DNA confirmed that all patients were homozygous and that parents from one family were heterozygous carriers for this mutation. Introduction Vitamin D-dependent rickets type II (VDDR II) is a hereditary disease characterized by early onset of
rickets associated with alopecia, hypocalcemia, hypophosphatemia, secondary hyperparathyroidism, and elevated levels of 1 ,25-dihydroxyvitamin D (1,25(OH)2D). This disease results from a spectrum of defects of the intracellular receptor for 1,25(OH)2D, which is a major biologically active vitamin D metabolite. Like all steroid hormone receptors, vitamin D Received April 3, 1991; revision received May 23, 1991. Address for correspondence and reprints: Takahiko Saijo, M.D., Department of Pediatrics, University of Tokushima School of Medicine, Kuramoto-cho 2, Tokushima 770, Japan. i 1991 by The American Society of Human Genetics. All rights reserved. 0002-9297/91 /4903-0021$02.00
668
receptor (VDR) is essentially comprised of two functional domains, a hormone-binding domain and a DNA-binding domain. The normal mechanism of vitamin D action involves binding of 1 ,25(OH)2D to the hormone-binding domain of the VDR. The DNAbinding domain of the VDR, which consists of two zinc fingers, in turn associates with specific DNA sequence elements located upstream of vitamin D-responsive gene promoters and modulates transcription of the vitamin D-responsive genes (Pike 1987; Kerner et al. 1989). Defective VDR from patients with VDDR II have been classified into three groups: hormonebinding defects, DNA-binding defects, and nucleartransfer or nuclear-localization defects (Liberman et al. 1983). In our previous studies on lymphocytes and cultured skin fibroblasts from three Japanese patients with
669
Mutant VDR Gene and Carrier Detection VDDR II, inhibition of DNA synthesis and induction of 25-hydroxyvitamin D-24-hydroxylase (24-hydroxylase) did not occur when the cells were exposed to 1 ,25(OH)2D3, showing that these cells were defective somewhere in the entire receptor-effector system for 1,25(OH)2D (Takeda et al. 1986, 1989). Patients' skin fibroblasts showed both normal cytosol binding of [3H]1,25(OH)2D3 and impaired nuclear uptake of [3H]1 ,25(OH)2D3, suggesting that the zinc-finger region of the VDR was defective (Takeda et al. 1989). We also suggested that this disease was an autosomal recessive disorder by showing intermediate levels of 24-hydroxylase induction in the parents (Takeda et al. 1990; Yokota et al., in press). Therefore, it would be important to identify genetic defects causing the disease and to detect heterozygous carriers at the molecular level. In the present study, we sequenced exons 2 and 3 of the VDR cDNA, which encode the zinc-finger region of the VDR. Single-strand conformation polymorphism (SSCP) analysis was applied to detect heterozygotes.
monoclonal antibody 9A7 (Pike 1984) as the first antibody and then with horseradish peroxidase (HRP)-labeled rabbit anti-rat IgG2b (Binding Site, Birmingham, England) as the second antibody. The immunoreactive protein was detected by using HRP color-development reagent (Bio-Rad).
Subjects and Methods Subjects Three Japanese patients with VDDR II (patients la, lb, and 2) from two families were studied. Patients la and lb (Takeda et al. 1989) were siblings, and their parents were first cousins.
First-Strand cDNA Synthesis and cDNA Amplification Total cellular RNA from fibroblasts of the patients was prepared by the methods described by Chomczynski and Sacchi (1987). Single-strand cDNA was synthesized from total RNA by using Moloney murine leukemia virus reverse transcriptase and a cDNA syn-
Cell Culture
Skin fibroblasts were grown in Eagle's minimal essential medium (Nissui, Tokyo) supplemented with 10% fetal bovine serum. Lymphocytes transformed with Epstein-Barr virus were cultured in RPMI-1 640 medium (Nissui) containing 15% fetal bovine serum. Western Blot Analysis
Western blot analysis was carried out according to the methods described by Malloy et al. (1989), with minor modification. In brief, purified fibroblast extracts were electrophoresed on a 10% SDS-polyacrylamide gel. The gel was incubated in 50 mM Tris pH 7.5 and 20% glycerol for 30 min at 240C with shaking. The proteins were transferred to nitrocellulose membrane (Bio-Rad, Richmond, CA) in 3 mM carbonate transfer buffer containing 20% methanol, for 16 h at 50 V. After electrophoretic transfer, the membrane was sequentially incubated with anti-VDR
Southern and Northern Blot Analyses
Genomic DNA was extracted from cultured lymphoblasts, and 10 gg of genomic DNA was digested with BamHI, EcoRI, MspI, PstI, or TaqI, was fractionated by electrophoresis in a 0.8% agarose gel, and was transferred to GeneScreenPlus (Dupont, Boston) nylon membrane. Poly(A)+ RNA was isolated from cultured lymphoblasts by a Fast Track mRNA isolation kit (Invitrogen, San Diego), and 25 gg of poly(A) + RNA was electrophoresed on a 1.0% agarose gel with 2.2 M formaldehyde and was transferred to the membrane. Hybridization of the blots was carried out according to instructions described by the membrane manufacturer, by using human VDR cDNA (Baker et al. 1988) which was labeled by the random priming method.
thesis kit (Bethesda Research Laboratories, Gaithersburg, MD) according to the manufacturer's instructions. Transcription was carried out at 37°C for 60 min in 50 jl of reaction mixture containing 10 g.g of total RNA. PCR amplification was carried out using 20 pl of the first-strand cDNA synthesis mixture as the template and 1 pM each of 27-oligonucleotide primers designed to amplify a 597-bp segment covering human VDR cDNA exons 2 and 3, which encoded the zincfinger region of the VDR (fig. 1). In each primer two nucleotides were substituted, so that the amplified segment would have an EcoRI recognition site at both ends. Thirty cycles of PCR were performed using a GeneAmp DNA amplification reagent kit (Perkin Elmer-Cetus, Norwalk, CT) according to the following program: 1 min denaturation at 94°C, 2 min annealing at 600C, and 3 min extension at 720C. Cloning and Sequencing of Amplified cDNA The PCR products were digested with EcoRI, isolated from low-melting-point agarose gels, and sub-
Saijo et al.
670 la
a-
If
I
2a Exon 2
hVDR cDNA Exon 3
-
2b
lb lOObp
Primers; la 5'AGTGTCTGTGAGAATTCACAGAAGAGC 3' lb 5'GAGTGTGTCTGGAATTCGGCCTGGAAG 3' 2a 5'CTGGCTTTCACTTCAAT 3' 2b 5 CAGTGGCGTCGGTTGTC 3'
Figure I Strategy of PCR for sequencing and SSCP analysis. Primers la and lb were used to amplify exons 2 and 3 as a single segment. Primers 2a and 2b, originally designed as internal primers for sequencing, were used in PCR for SSCP analysis. An arrowhead indicates the position of the point mutation in the patients.
cloned into an EcoRI-treated Bluescript II vector (Stratagene, La Jolla, CA). The recombinant plasmid was amplified by transforming Escherichia coli, strain XL1-Blue (Stratagene). To eliminate possible PCR errors, five clones from each patient were sequenced by the dideoxy chain-termination method using a Sequenase DNA sequence kit (United States Biochemical, Cleveland). Direct Search for a G-to-A Transition in Exon 3 of VDR cDNA by SSCP Analysis
A 1 33-bp segment of human VDR cDNA including both the last 52 bp of exon 2 and the first 81 bp of exon 3 was amplified by PCR (fig. 1). SSCP analysis was carried out by basically following the method described by Orita et al. (1989). The reaction mixture contained 1 gM of each of the 17-nucleotide primers, which were originally designed as internal primers for sequencing; 200 gM of each dNTP; 4 gl of the firststrand cDNA reaction mixture; 5 gCi [a-32P]dCTP (3,000 Ci/mmol, 10 mCi/ml; Amersham, Arlington Heights, IL); and 1 unit Taq DNA polymerase in 20 jl of amplification buffer. Then 1 jil of reaction mixture was added to 9 Jl of 95% formaldehyde dye, the mixture was boiled for 3 min, and then 1 jl of the sample was applied to a 6% polyacrylamide gel containing 1 x TBE (90 mM Tris-borate and 2 mM EDTA). Electrophoresis was performed at room temperature at 65 W. The gel was dried and autoradiographed overnight.
band was found in the normal subject (fig. 2, lane 1). In three patients with VDDR II, the size and the amount of the VDR protein were comparable to normal (fig. 2, lanes 2-4). Genomic digests with BamHI, EcoRI, MspI, PstI, or TaqI did not reveal any major deletions or structural alterations in the VDR locus (data not shown). In northern analysis of the VDR transcript, patient 2 had mRNA of normal size (4.6 kb) and amount (data not shown). Sequence Analysis of Exon 2 and Exon 3 of hVDR cDNA
The PCR products from the three patients and from two normal control subjects were of expected size, as assessed by agarose gel electrophoresis. In the clones from three patients and from one normal control, a T-to-C transition was found in the putative initiation codon in exon 2 of the normal human VDR cDNA sequence published by Baker et al. (1988), while in the clones from another normal control this transition was not found (fig. 3). Moreover, in all five clones from each patient, A was found at position 140 in exon 3, whereas in the clones from two normal controls and in
kDa 9366
52--m 45-
31-
1~~ ~~
~~~~~~~~
Results
Western, Southern, and Northern Blot Analyses In western blot analysis using anti-VDR monoclonal antibody, a single, 52-kDa immunoreactive
Figure 2 Western blot analysis of three patients with VDDR II. Lane 1, Normal control. Lanes 2-4; Patients la, ib, and 2, respectively. Immunoreactive bands of normal size and amount were detected in all patients.
Mutant VDR Gene and Carrier Detection hVDR cDNA Bakiret.L(gSS
Control 2 Patients lalb& 2
Control I
3.
671
32
3,
CG Ala 5 G T Met4 IOA A C Ala 3 G 0 A GIU 2 G 0 T Met I IA
Ala (2)
Ic Aba(2)
atMdf)
iO I aT Mst(1) 10
/T
JII3A
8a A
A
a
a8 a. T
G
G 6'
5'
Figure 3 Polymorphism in putative initiation codon of human VDR cDNA. An asterisk indicates the substituted nucleotide residue. Revised numbers for nucleotides and amino acids (or codons) are indicated in parentheses.
1 the previously published normal human VDR cDNA sequence, this position is occupied by a G (fig. 4). This G-to-A substitution alters Arg-47 to Gln in the zinc-finger region of the VDR.
Figure 5
2 3 4 5 6
7 8
SSCP analysis for G-to-A transition at position 140
in exon 3 of VDR cDNA. Lane 1, Normal control. Lanes 2-4, patients la, 1b, and 2, respectively. Lanes S and 6, parents of patient 2. Lane 7, Normal clone (Ni-i). Lane 8, mutant clone from patient la (la-1).
Direct Detection of G-to-A Substitution in Exon 3 by SSCP Analysis
The size of the major band amplified from cDNAs from three patients, from parents of patient 2, and from one normal control was 133 bp, as predicted. Segments of 133 bp were also amplified from a wildtype clone (N1-1) and from a mutant clone (la-1) by using the same pair of oligonucleotide primers and were analyzed to verify the electrophoretic patterns. Figure 5 illustrates the three patterns observed among the subjects. The pattern of the three patients (lanes 2, 3, and 4) was identical to that of the mutant clone (lane 8), and the pattern of the normal control (lane 1) was identical to that of the normal clone (lane 7). These two patterns were clearly separable from each Mutant
Normal
3'5' IAT AT GC
3'S' IAT *JilC TA _f..L ..
~~GC
a 2]Ar-47 A C G
Q X5C
CoG 5'3'
-
-
I
A C 6 T
A~~TAo Gln-47 TA
\GC vTA
VT aC 5'3'
Figure 4 Sequence analysis of normal and mutant VDR cDNA exon 3. Asterisks indicate the substituted nucleotide residues in the antisense and sense strands.
other. The pattern of the parents (lanes 5 and 6) suggested heterozygosity for this mutation. Discussion
Presence of VDR protein of both normal size and impaired nuclear uptake of 1 ,25(OH)2D3 in cultured skin fibroblasts from the patients with VDDR II suggested that the VDR protein DNA-binding domain, which consisted of two zinc fingers, was functionally defective in the patients. Results of Southern and northern analyses indicated that the abnormalities of the VDR gene in these patients were due to either point mutations or small insertions or deletions.Baker et al. (1988) recently cloned human VDR cDNA and showed that the zinc-finger region was encoded by exon 2 and exon 3 of the VDR gene. Therefore we focused on these two exons to identify genetic defects in the patients. Analysis of the amplified exons revealed both a T-to-C transition in exon 2 and a G-to-A transition in exon 3 in all patients. A T-to-C transition in the putative initiation codon in exon 2 was also found in one normal control, while this transition was not found in another. These findings suggested that this transition was not responsible for the defective VDR in the patients. They also indicated that the original initiation codon was not the three nucleotides at positions 1-3 but the second ATG sequence, located
Saijo et al.
672
at positions 10-12. Although they remain to be confirmed by amino acid sequencing of the N-terminus of the VDR, our findings were consistent with analysis of genomic DNA from a number of normal samples (R. A. Kesterson and J. W. Pike, unpublished data). In the present paper, nucleotides and either amino acids or codons are numbered with respect to the revised initiating methionine (i.e., for nucleotides, nine is deducted from the numbers assigned by Baker et al. [1988]; and, for amino acids or codons, three is deducted from the numbers assigned by Baker et al. [1988]). In contrast, a unique G-to-A transition at position 140 in exon 3 was revealed only in these three patients. This base change converted, at position 47, a GCA codon for arginine to a GAA codon for glutamine. The arginine at residue 47 is positionally conserved in the zinc-finger region within all steroid hormone receptors (Beato 1989), suggesting that it plays a critical role in receptor-DNA interactions. Therefore it is highly conceivable that this amino acid substitution is responsible for the defect of the VDR in our patients, although it remains to be determined by expression analysis whether this variant is of functional
significance. The identification of this point mutation in exon 3 of the VDR gene in our patients can be added to the three previously known mutations in the VDR gene encoding the zinc-finger region: in codon 30 of exon 2, a G-to-A transition which caused a Gly-to-Asp substitution (Hughes et al. 1988), and, in codons 70 and 77 of exon 3, a G-to-A point mutation which caused an Arg-To-Gln substitution (Hughes et al. 1988; Sone et al. 1990). It is of interest to note that these three amino acids are also conserved in all steroid hormone receptors. Three substitutions at codons 30, 70, and 77 are from different ethnic groups-Arabian, Haitian, and North African, respectively- and the point mutation that we have found in the present study was unique to Japanese patients. While there was no known kinship information to suggest that two kindreds were related, the nature of this rare mutation suggested a distant ancestral relationship. Because the mutation disclosed in our patients did not result in any change of restriction sites, we carried out SSCP analysis, which was recently proposed by Orita et al. (1989) to confirm heterozygosity of the parents. SSCP analysis relies on the differential electrophoretic mobility of single-stranded DNA under nondenaturing conditions, as even a single nucleotide substitution may induce conformational changes leading to mobility shifts. The electrophoretic pattern of the
amplified DNA from the patients was identical to that of DNA from the mutant clone and was clearly distinguishable from that of DNA from the normal clone, showing that all three patients are homozygous for this mutation. The pattern of the phenotypically normal parents was a mixture of the two patterns, indicating that these parents were heterozygous carriers. These results strongly support our previous studies on 24-hydroxylase induction (Takeda et al. 1990; Yokota et al., in press), which suggested that the disease was inherited as an autosomal recessive trait in the affected families. SSCP analysis was reported to be useful for detecting polymorphisms in Alu repeats and point mutations in both the ras oncogene and the human lipoprotein lipase gene (Orita et al. 1989; Hata et al. 1990). Whether SSCP analysis can disclose one nucleotide substitution remains to be confirmed. If it could, its technical simplicity would give it the capability to reveal previously unknown mutations in the amplified segment of DNA and would render it useful for largescale screening of genetic diseases as well as for heterozygote detection.
Acknowledgments This work was supported by grant 02670444 from the Ministry of Education, Science and Culture, Japan.
References Baker AR, McDonnell DP, Hughes M, Crisp TM, Mangelsdorf DJ, Haussler MR, Pike JW, et al (1988) Cloning and expression of full-length cDNA encoding human vitamin D receptor. Proc Natl Acad Sci USA 85:3294-3298 Beato M (1989) Gene regulation by steroid hormones. Cell 56:335-344 Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidium thiocyanate-phenolchloroform extraction. Anal Biochem 162:156-159 Hata A, Robertson M, Emi M, Lalouel J-M (1990) Direct detection and automated sequencing of individual alleles after electrophoretic strand separation: identification of a common nonsense mutation in exon 9 of the human lipoprotein lipase gene. Nucleic Acids Res 18:5407-5411 Hughes MR, Malloy PJ, Kieback DG, Kesterson RA, Pike JW, Feldman D, O'Malley BW (1988) Point mutations in the human vitamin D receptor gene associated with hypocalcemic rickets. Science 242:1702-1705 Kerner SA, Scott RA, Pike JW (1989) Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D3. Proc Natl Acad Sci USA 86:4455-4459
Mutant VDR Gene and Carrier Detection Liberman UA, Eil C, Marx SJ (1983) Resistance to 1,25dihydroxyvitamin D. J Clin Invest 71:192-200 Malloy PJ, Hochberg Z, PikeJW, Feldman D (1989) Abnormal binding of vitamin D receptors to deoxyribonucleic acid in a kindred with vitamin D-dependent rickets, type II. J Clin Endocrinol Metab 68:263-269 Orita M, Suzuki Y, Sekiya T, Hayashi K (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5: 874-879 Pike JW (1984) Monoclonal antibodies to chick intestinal receptors for 1,25-dihydroxyvitamin D3. J Biol Chem 259:1167-1173 (1987) Emerging concepts on the biologic role and mechanism of action of 1 ,25-dihydroxyvitamin D3. Steroids 49:3-27 Sone T. Marx SJ, Liberman UA, Pike JW (1990) A unique point mutation in the human vitamin D receptor gene confers hereditary resistance to 1,25-dihydroxyvitamin D3. Mol Endocrinol 4:623-631
673 Takeda E, Kuroda Y, Saijo T, Toshima K, Naito E, Kobashi H, Iwakuni Y, et al (1986) Rapid diagnosis of vitamin Ddependent rickets type II by use of phytohemagglutininstimulated lymphocytes. Clin Chim Acta 155:245-250 Takeda E, Yokota I, Ito M, Kobashi H, Saijo T, Kuroda Y (1990) 25-Hydroxyvitamin D-24-hydroxylase in phytohemagglutinin-stimulated lymphocytes: intermediate bioresponse to 1,25-dihydroxyvitamin D3 of cells from parents of patients with vitamin D-dependent rickets type II. J Clin Endocrinol Metab 70:1068-1074 Takeda E, Yokota I, Kawakami I, Hashimoto T, Kuroda Y, Arase S (1989) Two siblings with vitamin D-dependent rickets type II: no recurrence of rickets for 14 years after cessation of therapy. Eur J Pediatr 149:54-57 Yokota I, Takeda E, Ito M, Kobashi H, Saijo T, Kuroda Y. Clinical and biochemical findings in parents of children with vitamin D-dependent rickets type II. J Inherited Metab Dis (in press)
