ISSN 00062979, Biochemistry (Moscow), 2014, Vol. 79, No. 6, pp. 531537. © Pleiades Publishing, Ltd., 2014. Published in Russian in Biokhimiya, 2014, Vol. 79, No. 6, pp. 675683.

A Unique Disulfide Bridge of the Thermophilic Xylanase SyXyn11 Plays a Key Role in Its Thermostability X. Yin1#, Y. Yao2#, M. C. Wu3*, T. D. Zhu1, Y. Zeng2, and Q. F. Pang3 1

School of Biotechnology and Key Laboratory of Carbohydrate Chemistry & Biotechnology, Ministry of Education, Jiangnan University, 1800 Lihu Road, 214122 Wuxi, China; fax: +08651085329042; Email: [email protected] 2 School of Pharmaceutical Sciences, Jiangnan University, 1800 Lihu Road, 214122 Wuxi, China; fax: +08651085329042; Email: [email protected] 3 Wuxi Medical School, Jiangnan University, 1800 Lihu Road, 214122 Wuxi, China; fax: +08651085329042; Email: [email protected] Received November 30, 2013 Revision received December 6, 2013 Abstract—Based on the hyperthermostable family 11 xylanase (EvXyn11TS) gene sequence (EU591743), the gene Syxyn11 encoding a thermophilic xylanase SyXyn11 was synthesized with synonymous codons biasing towards Pichia pastoris. The homology alignment of primary structures among family 11 xylanases revealed that, at their Ntermini, only SyXyn11 con tains a disulfide bridge (Cys5–Cys32). This to some extent implied the significance of the disulfide bridge of SyXyn11 to its thermostability. To confirm the correlation between the Nterminal disulfide bridge and thermostability, a SyXyn11C5T encoding gene, Syxyn11C5T, was constructed by mutating the Cys5 codon of Syxyn11 to Thr5. Then, the genes for the recombinant xylanases, reSyXyn11 and reSyXyn11C5T, were expressed in P. pastoris GS115, yielding xylanase activity of about 35 U per ml cell culture. Both xylanases were purified to homogeneity with specific activities of 363 and 344 U/mg, respectively. The temperature optimum and stability of reSyXyn11C5T decreased to 70 and 50°C from 85 and 80°C of reSyXyn11, respectively. There was no obvious change in pH characteristics. DOI: 10.1134/S0006297914060066 Key words: xylanase, thermostability, disulfide bridge, computational prediction, sitedirected mutagenesis

Xylanases (endoβ(l,4)xylanases, EC 3.2.1.8) are glycoside hydrolases that catalyze the hydrolysis of inter nal β(1,4)Dxylosidic linkages of xylans, the major hemicelluloses in plant cell walls. Based on hydrophobic cluster analysis and homology alignment of amino acid sequences, the majority of xylanases have been classified into glycoside hydrolase (GH) families 10 and 11 [1]. Compared with GH family 10 counterparts, the family 11 xylanases, composed only of socalled “true xylanases” possessing exclusively catalytic activity on Dxylosecon taining substrates, were investigated in more detail [2]. Currently, thermophilic xylanases, especially those from GH family 11, are widely needed in biotechnological processes where high temperatures are required, for example pulp bleaching and foodstuff preparation [3]. The overall threedimensional (3D) structure of family 11 xylanases shares a common folding pattern hav # These authors contributed equally to this work. * To whom correspondence should be addressed.

ing one αhelix and two βsheets, resembling a partially closed right hand, but there are some local differences between thermophilic and mesophilic xylanases [4]. It has been confirmed that some motifs or local regions such as N or Cterminus, disulfide bridge, charged surface residue, and salt bridge could affect the thermostability of the enzymes [59]. For example, the introduction of one disulfide bridge at the Nterminus of xylanase XYNII from Trichoderma reesei increased its thermal inactivation halflife at 65°C from 40 s to 20 min [10]. In the GH fam ily 11 xylanases, unfolding starts from the Nterminus to the βsheet region of the xylanase [11]. For that reason, the unfolding process could be blocked by stabilizing motifs at the Nterminus of the xylanase [10, 12]. In our previous work, the thermostability of the mesophilic xylanase AoXyn11 was enhanced by substitut ing its Nterminal region with the corresponding one of the thermophilic xylanase SyXyn11 [2]. The SyXyn11 encoding gene, Syxyn11, was artificially synthesized with synonymous codons biasing towards P. pastoris based on

531

532

YIN et al.

an EvXyn11TS gene sequence (EU591743) [13]. During the past decades, many methods have been explored to improve the properties of xylanases, such as protein engi neering, amino acid modification, computational predic tion, and molecular dynamics (MD) simulation [14]. In this work, by aligning the primary structure of SyXyn11 with those of several mesophilic GH family 11 xylanases, we found that only SyXyn11 at its Nterminal region con tains one disulfide bridge (Cys5–Cys32). Together with the analytical results of MD simulations, it is reasonable to deduce that the Nterminal disulfide bridge probably contributes to the high thermostability of SyXyn11. To test this deduction experimentally, the unique disulfide bridge of SyXyn11 was eliminated by mutating Cys5 into Thr5. Then, the Syxyn11 gene and its mutant Syxyn11C5T constructed by sitedirected mutagenesis were expressed in P. pastoris GS115. The temperature optima and ther mostabilities of reSyXyn11 and reSyXyn11C5T were char acterized and compared.

MATERIALS AND METHODS Strains, vectors, and media. The recombinant Tvec tor pUCmTSyxyn11 was constructed and preserved in our laboratory. Escherichia coli JM109 and vector pUCm T (Sangon, China) were used for gene cloning, while E. coli DH5α and vector pPIC9K (Invitrogen, USA) were used for construction of the recombinant expression vec tor. Escherichia coli JM109 and DH5α were cultured in the Luria–Bertani medium, while P. pastoris GS115 and its transformant were cultured and induced in YPD, MD, geneticin G418containing YPD, BMGY, and BMMY media. All the media were prepared as described in the manual of the MultiCopy Pichia Expression Kit (Invitrogen). Analysis of primary structure. The putative Nlinked glycosylation sites of both SyXyn11 and SyXyn11C5T were located using the NetNGlyc program 1.0 (http://www. cbs.dtu.dk/services/NetNGlyc/). The physicochemical properties were identified using the ProtParam program (http://au.expasy.org/tools/protparam.html). The homo logy sequence search at the NCBI website (http://www. ncbi.nlm.nih.gov/) was performed using the BLAST serv er, while the homology alignment of primary structures among family 11 xylanases were accomplished using the ClustalW2 program (http://www.ebi.ac.uk/Tools/msa/ clustalw2/) and DNAMAN 6.0. Computational prediction for thermostability. The root mean square deviation (RMSD) value, an important index for evaluating thermal fluctuation, was defined as the Cαatomic displacement range of a protein from its original conformation to the changed one at a high tem perature and at a certain time. The RMSD value of a pro tein has negative correlation with its thermostability [15]. To predict the thermostabilities of SyXyn11 and

SyXyn11C5T, their 3D structures were modeled using the MODELLER 9.9 program (http://salilab.org/modeller/) based on the crystal structure of EvXyn11TS (PDB: 2VUL) and subjected to MD simulation at 500 K for 10 ns. The RMSD values were calculated using the g_rms software of the GROMACS 4.5 package (http://www.gromacs.org/) and statistically analyzed using Origin 9 software (http://www.originlab.com/). Assessment of secondary structure variability. The thermostability of a protein, closely correlated with its 3D structure diversity at high temperature, can be evaluated using the defined secondary structure of proteins (DSSP) method [16]. In this work, the 3D structures of SyXyn11 and SyXyn11C5T were subjected to MD simulations at 500 K for 10 ns. Then the variability of secondary struc tures, such as helix (including αhelix, πhelix, and 3′ helix), strand (βsheet and βbridge), and loop (coil, bend, and turn), was assessed using the DSSP program (http://swift. cmbi.ru.nl/gv/dssp/). Sitedirected mutagenesis. Using pUCmTSyxyn11 as the template, the mutant gene Syxyn11C5T was ampli fied by PCR with primers XC5TF: 5′GAATTCAACGCT CAAACT ACT CTTACCTCTCCAC3′ with an EcoRI site (underlined) and a mutant codon (boxed) and XC5TR: 5′ GCGGCCGCTTAACTAACAGTAATGTCAGA3′ with a NotI site (underlined). Conditions for PCR amplifica tion were as follows: denaturation at 94°C for 5 min; 30 cycles of 94°C for 30 s, 56°C for 30 s, 72°C for 40 s; an elongation at 72°C for 10 min. The amplified target PCR product, Syxyn11C5T, was inserted into vector pUCmT and transformed into E. coli JM109. The resulting recom binant Tvector, designated pUCmTSyxyn11C5T, was confirmed by DNA sequencing. Expression of the xylanase gene. The genes Syxyn11 and Syxyn11C5T were separately excised from pUCmT Syxyn11 and pUCmTSyxyn11C5T by digestion with EcoRI and NotI, agarose gelpurified, and inserted into vector pPIC9K digested with the same enzymes, followed by transforming them into E. coli DH5α. Then the result ing recombinant expression vectors, pPIC9KSyxyn11 and pPIC9KSyxyn11C5T, were linearized with SalI and transformed into P. pastoris GS115 by electroporation on a Gene Pulser apparatus (BioRad, USA). Pichia pastoris GS115 transformed with vector pPIC9K was used as the negative control (P. pastoris GSXC). All P. pastoris trans formants were primarily screened based on their ability to grow on an MD plate, and they were successively inocu lated on G418containing YPD plates at increasing con centrations of 1, 2, and 4 mg/ml for screening multiple copies of integrated Syxyn11 and Syxyn11C5T. The gene Syxyn11 or Syxyn11C5T in P. pastoris GS115 was expressed according to the instructions for the MultiCopy Pichia Expression Kit with slight modification [17]. Enzyme activity and protein assays. Xylanase activity was assayed using the 3,5dinitrosalicylic acid (DNS) method [18], in which 100 μl of diluted enzyme was incu BIOCHEMISTRY (Moscow) Vol. 79 No. 6 2014

DISULFIDE BRIDGE OF XYLANASE IMPORTANT FOR ITS THERMOSTABILITY bated with 2.4 ml of 5 mg/ml birchwood xylan (Sigma, USA) in 50 mM Na2HPO4citric acid buffer (pH 5.5) at 50°C for 10 min. One unit (U) of xylanase activity was defined as the amount of xylanase liberating 1 μmol of reducing sugar equivalent per minute under the assay conditions stated above. Sodium dodecyl sulfate polyacrylamide gel elec trophoresis (SDSPAGE) was performed on a 12.5% gel according to the method of Laemmli [19]. The isolated proteins were visualized by staining with Coomassie Brilliant Blue R250 (Sigma), and their apparent molec ular masses were estimated using Quantity One software based on standard protein markers. The protein concen tration was measured with the BCA200 Protein Assay Kit (Pierce, USA) using bovine serum albumin as the standard. Purification of the expressed xylanases. After the P. pastoris transformant was induced by 1% methanol for 72 h, a total of 100 ml of cultured supernatant was brought to 80% saturation by adding solid (NH4)2SO4 and left overnight. The precipitate was harvested, dis solved in 8 ml of 20 mM Na2HPO4NaH2PO4 buffer (pH 6.0), and dialyzed against the same buffer overnight. The dialyzate was concentrated to 2 ml by ultrafiltration using a 10kDa cutoff membrane (Millipore, USA) and loaded onto a Sephadex G50 column (Amersham Pharmacia Biotech, Sweden; 1.6 × 80 cm), followed by elution with the same buffer at flow rate 0.4 ml/min. Aliquots of 3 ml eluent only containing reSyXyn11 or reSyXyn11C5T were pooled and concentrated by ultrafil tration. All purification steps were performed at 4°C unless stated otherwise. Carbohydrate content and Ndeglycosylation assays. The carbohydrate content of the purified xylanase was assayed with the phenol–sulfuric acid method [20] using Dmannose (Sigma) as the standard. The Ndeglycosyla tion assay was performed as follows: the purified xylanase solution was treated at 100°C for 10 min, cooled to room temperature, and then incubated with an endoglycosidase H (Endo H; New England Biolabs, USA) at 37°C for 1 h followed by SDSPAGE analysis. Reduction of the disulfide bridge by DTT. Dithiothreitol (DTT; Sangon, China), a smallmolecule reducing agent, can reduce the disulfide bridge between two cysteine residues under an alkalescent environment. In this work, the purified reSyXyn11 was incubated with 5 mM DTT in 20 mM TrisHCl buffer (pH 8.0) at 40°C for 30 min, followed by measuring the residual xylanase activity under the standard assay conditions. DTT in Na2HPO4citric acid buffer (pH 5.5) was used as the con trol. Temperature optimum and stability. The temperature optima of reSyXyn11 and reSyXyn11C5T were measured under the standard enzyme activity assay conditions except reaction temperatures ranging from 55 to 90°C. To estimate the temperature stability, reSyXyn11 was incu BIOCHEMISTRY (Moscow) Vol. 79 No. 6 2014

533

bated in the absence of substrate at 80 and 90°C for 1 h, while the reSyXyn11C5T was incubated at 50, 60, and 70°C. The thermostability in this work is defined as the temperature at or below which the residual xylanase activity, measured under the standard assay conditions, retained over 95% of its original activity for 1 h. pH optimum and stability. The pH optimum of reSyXyn11 or reSyXyn11C5T was measured under the stan dard assay conditions except for 5 mg/ml xylan in 50 mM Na2HPO4citric acid buffer over the pH range of 3.07.5. To evaluate the pH stability, the reSyXyn11 or reSyXyn11C5T was incubated at 40°C and different pH val ues (Na2HPO4citric acid buffer, pH 3.07.5; TrisHCl buffer, pH 8.010.0) for 1 h. The pH stability was defined here as the pH range over which the residual xylanase activity was more than 85% of its original activity.

RESULTS AND DISCUSSION Homology alignment of primary structures. Four mesophilic GH family 11 xylanases sharing the highest primary structure identities with the thermophilic coun terpart SyXyn11 were searched by using the BLAST serv er. The homology alignment of primary structures dis played identities of SyXyn11 (ACB87631) with four mesophilic GH family 11 xylanases from A. oryzae (AFA51067), A. niger (XP_001388522), A. usamii (AEJ87263), and T. reesei (CAA49293) of 64.4, 62.4, 62.4, and 54.9%, respectively (Fig. 1). Simultaneously, we found that only SyXyn11 at its Nterminal region con tains one disulfide bridge (Cys5–Cys32) (Figs. 2a and 2b). It has been reported that the disulfide bridge can resist the thermal inactivation of xylanases [3, 10]. Therefore, it is reasonable to assume that the unique N terminal disulfide bridge of SyXyn11 was most likely con tributing to its high thermostability. Prediction for the xylanase thermostability. The 3D structures of SyXyn11 and SyXyn11C5T were homological ly modeled using the MODELLER 9.9 program (Figs. 2b and 2c) and then subjected to MD simulation at 500 K for 10 ns, followed by calculating their RMSD values (Fig. 3a). Although a temperature of 500 K is experimentally unrealistic, the MD simulation at extremely high temper ature gives an insight into protein unfolding [11]. As shown in Fig. 3a, the RMSD values of SyXyn11C5T after equilibration were larger than those of SyXyn11. Besides, the distributions of RMSD values of SyXyn11 and SyXyn11C5T were statistically analyzed using the Origin 9 software (Fig. 3b). The RMSD values of SyXyn11 were principally focused at 0.58 Å while those of SyXyn11C5T were at 0.71 Å, indicating that the rigidity of SyXyn11C5T was less than that of SyXyn11. Based on the reported ana lytical result that the rigidity of a protein is positively related to its thermostability [21], SyXyn11C5T was pre dicted to be less thermostable than SyXyn11.

534

YIN et al.

Fig. 1. Homology alignment of primary structures between the thermophilic GH family 11 xylanase (SyXyn11) and four representative of mesophilic counterparts. Abbreviations: SyXyn11, synthetic family 11 xylanase (ACB87631); AorXyn11, A. oryzae xylanase (AFA51067); AniXyn11, A. niger xylanase (XP_001388522); AusXyn11, A. usamii xylanase (AEJ87263); TreXyn11, T. reesei xylanase (CAA49293). A disul fide bridge Cys5–Cys32 is marked in triangles.

a

b

c

Fig. 2. Disulfide bridge and Nlinked glycosylation sites in SyXyn11 and SyXyn11C5T. a) The disulfide bridge in the primary structure of SyXyn11 is indicated and the mutant amino acid is marked in gray. b, c) The 3D structures of SyXyn11 and SyXyn11C5T were homologically modeled using the MODELLER 9.9 program. A disulfide bridge (Cys5–Cys32) and three Nlinked glycosylation sites (N42, N62 and N135) are shown.

BIOCHEMISTRY (Moscow) Vol. 79 No. 6 2014

DISULFIDE BRIDGE OF XYLANASE IMPORTANT FOR ITS THERMOSTABILITY

a

RMSD, Å

0.8 0.7

2

0.6

1

0.5 0.4 0.3 0.2 0.1 0

1

2

3

4

5

6

7

8

9

10

Time, ns 600

1

b

Distribution

500

2

400 300 200 100 0

0.1 0.2 0.3 0.4

0.5 0.6 0.7 0.8 0.9

535

TSyxyn11 by PCR with primers XC5TF and XC5TR. The DNA sequencing result demonstrated that the amplified Syxyn11C5T was exactly 599 bp in length (con taining EcoRI and NotI sites), encoding a 194aa SyXyn11C5T without the disulfide bridge (Figs. 2a and 2c). The theoretical molecular mass and isoelectric point (pI) of SyXyn11C5T were 21,275 Da and 8.02, respective ly, which are similar to those of SyXyn11 (21,277 Da and 7.94). Expression of Syxyn11 and Syxyn11C5T. The P. pas toris transformant that can resist higher concentrations of geneticin G418 might contain multiple copies of integra tion of the heterologous gene into the P. pastoris genome, which could potentially lead to a higher expression level of the heterologous protein or enzyme as elucidated in the manual of MultiCopy Pichia Expression Kit. However, the expression level of the protein was not directly pro portional to the concentration of G418 [17]. For those reasons, all the P. pastoris transformants (containing Syxyn11 or Syxyn11C5T), separately resistant to 1, 2 and 4 mg/ml of G418, were picked out for flask expression tests. After the transformants were induced by adding methanol to final concentration of 20 μl/ml at 24 h inter vals for 72 h, their cultured supernatants were harvested and used for xylanase activity and protein assays, respec tively. Among all transformants tested, two transformants

RMSD, Å

Assessment of secondary structure variability. The diversity of secondary structure contents of both SyXyn11 and SyXyn11C5T was assessed using the DSSP program (Fig. 4). At the beginning of MD simulation, SyXyn11 statistically consisted of ~5% helix, ~60% strand, and ~35% loop, while SyXyn11C5T contained ~5% helix, ~63% strand, and ~32% loop. During the MD simula tion, the helix conformations of both SyXyn11 and SyXyn11C5T were relatively intact in spite of sporadically marginal deviation, while their partial strands gradually drifted to loops. The strand content of SyXyn11 decreased by 27% after 6 ns, while that of SyXyn11C5T decreased by 30% after only 4 ns, suggesting that the unfolding of SyXyn11C5T is quicker than that of SyXyn11. In other words, the Nterminal disulfide bridge of SyXyn11 made its strand conformation more stable at high temperature, which may contribute to its high thermostability. The DSSP method has been extensively applied to evaluate or predict the thermostability of a protein or enzyme [15, 22]. Sitedirected mutagenesis of Syxyn11. An about 600bp band of the Syxyn11C5T gene was amplified from pUCm BIOCHEMISTRY (Moscow) Vol. 79 No. 6 2014

Secondary structure content, %

Fig. 3. The RMSD values and their distributions of SyXyn11 and SyXyn11C5T. a) Curves of RMSD values of SyXyn11 (1) and SyXyn11C5T (2) after MD simulation at 500 K for 10 ns. b) The distributions of RMSD values of SyXyn11 (1) and SyXyn11C5T (2).

80 70 60 50 40 30 20 10 0 80 70 60 50 40 30 20 10 0

a 2

3

1

2

3

4

5

6

7

8

9

1 10

b 2

3

1 1

2

3

4

5

6

7

8

9

10

Time, ns Fig. 4. Assessments of secondary structure variabilities of (a) SyXyn11 and (b) SyXyn11C5T using the DSSP program after MD simulation at 500 K for 10 ns: 1) helix (including αhelix, π helix, and 3′helix) content; 2) loop (including coil, bend, and turn) content; 3) strand (including βsheet and βbridge) con tent.

536

YIN et al. kDa

М

1

2

3

kDa

97.2 66.4

44.3

29.0

31.0

detected in the cultured supernatant of P. pastoris GSXC under the same expression conditions. Purification of reSyXyn11 and reSyXyn11C5T. One of advantages of the P. pastoris expression system is that the purity of the expressed recombinant protein is very high as described in the manual of MultiCopy Pichia Expression Kit, which could greatly simplify the purification proce dures. It was reported that the purities of recombinant A. usamii xylanase AuXyn11D and A. sulphureus βman nanase expressed in P. pastoris GS115 and X33 reached 90 and 97%, respectively [23, 24]. In this work, the amount of expressed reSyXyn11 or reSyXyn11C5T in the cultured supernatant accounted for more than 88% of the total pro tein, which was assayed by protein bandscanning. For this reason, they were purified to homogeneity by only a simple combination of ammonium sulfate precipitation, ultrafil tration, and Sephadex G50 gel chromatography. The spe cific activities of purified reSyXyn11 and reSyXyn11C5T

21.1

20.1

a 100

Fig. 5. SDSPAGE analysis of reSyXyn11, reSyXyn11C5T, and N deglycosylated reSyXyn11C5T. Lanes: M) protein markers; 1) puri fied reSyXyn11 with apparent molecular mass of about 31.0 kDa; 2, 3) purified reSyXyn11C5T and its Ndeglycosylated protein with apparent molecular masses of about 31.0 and 21.1 kDa, respec tively.

1

80 60 40 2

100 Relative activity, %

1 80 60 40

Relative activity, %

20

b 100

1

80 20 0 50

2

60 2

60

70

80

90

40

Temperature, °C 20 Fig. 6. Temperature optima of (1) reSyXyn11 and (2) reSyXyn11C5T. The temperature optima were measured under the standard assay conditions except that the reaction temperatures ranged from 55 to 90°C, respectively.

3 0

10

20

30

40

50

60

Incubation time, min

expressing the maximum reSyXyn11 and reSyXyn11C5T activities of 36.8 and 34.5 U/ml, respectively, labeled as P. pastoris GSX49 and GSXC5T413, were screened and used for subsequent studies. No xylanase activity was

Fig. 7. Thermostabilities of reSyXyn11 and reSyXyn11C5T. a) The reSyXyn11 was incubated in the absence of substrate at (1) 80°C and (2) 90°C for 1 h. b) The reSyXyn11C5T was incubated at (1) 50°C, (2) 60°C and (3) 70°C for 1 h.

BIOCHEMISTRY (Moscow) Vol. 79 No. 6 2014

DISULFIDE BRIDGE OF XYLANASE IMPORTANT FOR ITS THERMOSTABILITY towards 5 mg/ml birchwood xylan at pH 5.5 and 50°C for 10 min were 363 and 344 U/mg, respectively. The disulfide bridge at the protein Nterminus decreased the enzyme activity, as reported previously [5]. However, the reduction of Nterminal disulfide bridge of reSyXyn11C5T in this work did not show any benefit to its specific activity. NDeglycosylation assay of reSyXyn11C5T. SDS PAGE assay of the purified reSyXyn11 and reSyXyn11C5T displayed single protein bands (Fig. 5, lanes 1 and 2). The same apparent molecular masses (31.0 kDa) of reSyXyn11 and reSyXyn11C5T were much larger than their theoretical ones (21,277 and 21,275 Da). Pichia pastoris enables some posttranslational modifications, including the assembly of disulfide bridges, exclusion of signal pep tide, and N and/or Oglycosylation, etc. To determine if the difference between the apparent and theoretical molecular masses resulted from Nglycosylation, Nde glycosylation assay, using reSyXyn11C5T as an example, was carried out. As a result, a clear protein band of about 21.1 kDa was observed on SDSPAGE (Fig. 5, lane 3), which is very close to the theoretical molecular mass of reSyXyn11C5T. Simultaneously, the carbohydrate content of reSyXyn11C5T was determined to be 10.3% using the phenol–sulfuric acid method [20]. These results verified that reSyXyn11C5T is an Nglycosylated protein, which is also in good agreement with the fact that there are three putative Nglycosylation sites (N42, N62, and N135) in primary structure of SyXyn11 (Fig. 2). Temperature properties of reSyXyn11 and reSyXyn11C5T. The temperature optimum of reSyXyn11 incubated with 5 mM DTT (pH 8.0) was 75°C, which is lower than that of reSyXyn11 (85°C) treated with 5 mM DTT (pH 5.5) or without DTT. These experimental results confirmed the presence of the disulfide bridge in SyXyn11, which greatly contributed to its high thermostability. The temperature optima of reSyXyn11 and reSyXyn11C5T were 85 and 70°C (measured at pH 5.5 for 10 min), respective ly, which displayed a difference of 15°C (Fig. 6). The reSyXyn11 was highly thermostable (more than 95%) at 80°C for 1 h, and it retained 50% of its original activity (t1/2) at 90°C for 32 min (Fig. 7a). Whereas, the reSyXyn11C5T was thermostable only at 50°C for 1 h, it retained 50% of its original activity at 60°C for 60 min and 70°C for 8 min, respectively (Fig. 7b). Our experimental results demonstrate that the reduction and/or elimination of the Nterminal disulfide bridge of SyXyn11 indeed decreased its thermostability. Similar conclusions that the disulfide bridge plays an important role in maintaining thermostability of family 11 xylanases were also reported [3, 5, 10]. Both reSyXyn11 and reSyXyn11C5T displayed higher catalytic activities in the pH range 5.57.5, highest activ ities being at pH 6.5. They were highly stable over a broad pH range of 4.09.5 (data not shown). The experimental results verified that there is no obvious change in pH characteristics. BIOCHEMISTRY (Moscow) Vol. 79 No. 6 2014

537

This work was supported by the National Nature Science Foundation of China (No. 31101229), Key Laboratory of Carbohydrate Chemistry & Biotechnology, Ministry of Education, Jiangnan University (KLCCB KF201208), Fundamental Research Funds for the Central Universities of China (JUDCF13011) and Postgraduate Innovation Training Project of Jiangsu (CXZZ13_0757).

REFERENCES 1. Collins, T., Gerday, C., and Feller, G. (2005) FEMS Microbiol. Rev., 29, 323. 2. Yin, X., Li, J. F., Wang, J. Q., Tang, C. D., and Wu, M. C. (2013) J. Sci. Food Agric., 93, 30163023. 3. Wang, Y., Fu, Z., Huang, H., Zhang, H., Yao, B., Xiong, H., and Turunen, O. (2012) Bioresour. Technol., 112, 275279. 4. Paes, G., Berrin, J. G., and Beaugrand, J. (2012) Biotechnol. Adv., 30, 564592. 5. Xiong, H., Fenel, F., Leisola, M., and Turunen, O. (2004) Extremophiles, 8, 393400. 6. Zhang, S., Zhang, K., Chen, X. Z., Chu, X., Sun, F., and Dong, Z. (2010) Biochem. Biophys. Res. Commun., 395, 200206. 7. Lee, J. H., Heo, S. Y., Lee, J. W., Yoon, K. H., Kim, Y. H., and Nam, S. W. (2009) Biotechnol. Bioprocess Eng., 14, 639644. 8. Hakulinen, N., Turunen, O., Janis, J., Leisola, M., and Rouvinen, J. (2003) Eur. J. Biochem., 270, 13991412. 9. Xue, H. P., Zhou, J. G., You, C., Huang, Q., and Lu, H. (2012) J. Ind. Microbiol. Biotechnol., 39, 12791288. 10. Fenel, F., Leisola, M., Janis, J., and Turunen, O. (2004) J. Biotechnol., 108, 137143. 11. Purmonen, M., Valjakka, J., Valjakka, K., Laitinen, T., and Rouvinen, J. (2007) Protein Eng. Des. Sel., 20, 551559. 12. Janis, J., Rouvinen, J., Vainiotalo, P., Turunen, O., and Shnyrov, V. L. (2008) Int. J. Biol. Macromol., 42, 7580. 13. Dumon, C., Varvak, A., Wall, M. A., Flint, J. E., Lewis, R. J., Lakey, J. H., Morland, C., Luginbuhl, P., Healey, S., and Todaro, T. (2008) J. Biol. Chem., 283, 2255722564. 14. Verma, D., and Satyanarayana, T. (2012) Bioresour. Technol., 117, 360367. 15. Badieyan, S., Bevan, D. R., and Zhang, C. (2012) Biotechnol. Bioeng., 109, 3144. 16. Kabsch, W., and Sander, C. (1983) Biopolymers, 22, 2577 2637. 17. Li, J. F., Tang, C. D., Shi, H. L., and Wu, M. C. (2011) J. Biosci. Bioeng., 111, 537540. 18. Wu, M. C., Fu, D. D., Zhu, J., and Xia, M. F. (2005) J. Food Sci. Biotechnol., 24, 2933. 19. Laemmli, U. K. (1970) Nature, 227, 680685. 20. Dubois, M., Gilles, K. A., Hamilton, J. K., Rebers, P. A., and Smith, F. (1956) Anal. Chem., 28, 350356. 21. Radestock, S., and Gohlke, H. (2008) Eng. Life Sci., 8, 507522. 22. Matthes, D., and de Groot, B. L. (2009) Biophys. J., 97, 599608. 23. Zhang, H. M., Wu, M. C., Li, J. F., Gao, S. J., and Yang, Y. J. (2012) Appl. Biochem. Biotechnol., 167, 21982211. 24. Chen, X. L., Cao, Y. H., Ding, Y. H., Lu, W. Q., and Li, D. F. (2007) J. Biotechnol., 128, 452461.