Novel Insights from Clinical Practice
HOR MON E RE SE ARCH I N PÆDIATRIC S
Received: February 3, 2014 Accepted: July 14, 2014 Published online: September 18, 2014
Horm Res Paediatr 2014;82:338–343 DOI: 10.1159/000365888
A Tunisian Patient with Two Rare Syndromes: Triple A Syndrome and Congenital Hypogonadotropic Hypogonadism Lamia Cherif Ben Abdallah a Youssef Lakhoua b Majdi Nagara a Karima Khiari b Sahar Elouej a Olfa Messaoud a Yosra Bouyacoub a Lilia Romdhane a Zinet Turki c Sonia Abdelhak a Nejib Ben Abdallah b
a
LR11IPT05, Laboratoire de Génomique Biomédicale et Oncogénétique, Institut Pasteur de Tunis, Université de Tunis El Manar, b Service d’Endocrinologie, Hôpital Charles-Nicolle, and c Service d’Endocrinologie, Institut de Nutrition, Tunis, Tunisia
Established Facts • Triple A syndrome (AAAS) and congenital hypogonadotropic hypogonadism (CHH) are two rare diseases. The first is autosomal recessive caused by mutations in the AAAS gene; the second presents a yet unknown genetic etiology.
Novel Insights • We report on phenotypic, endocrine and molecular features of a consanguineous patient with AAAS for whom CHH was subsequently diagnosed. The coexistence of these diseases has never been described. Given the particular psychosocial consequences related to impotence and infertility, the diagnosis of CHH should be taken into consideration in patients with AAAS and who carry the Maghrebian founder mutation.
Abstract Background/Aims: The coexistence of triple A syndrome (AAAS) and congenital hypogonadotropic hypogonadism (CHH) has so far not been reported in the literature. This study aimed to characterize at the clinical and genetic level one patient presenting an association of AAAS and CHH in
© 2014 S. Karger AG, Basel 1663–2818/14/0825–0338$39.50/0 E-Mail [email protected] www.karger.com/hrp
order to identify causal mutations. Methods: Clinical and endocrinal investigations were performed and followed by mutational screening of candidate genes. Results: At the age of 18, the patient presented sexual infantilism, a micropenis and gynecomastia. No mutation was revealed in GnRHR, TACR3/TAC3, PROK2/PROKR2 and PROP1 genes, except a homozygous intronic variation (c.244 + 128C>T;
L. Cherif Ben Abdallah and Y. Lakhoua contributed equally to this work.
Youssef Lakhoua Département d’Endocrinologie, Hôpital Charles-Nicolle Boulevard 9 Avril 1938 Tunis 1006 (Tunisia) E-Mail laksoso @ yahoo.fr
Downloaded by: UCSF Library & CKM 169.230.243.252 - 12/8/2014 9:22:13 AM
Key Words Triple A syndrome · Congenital hypogonadotropic hypogonadism · Founder mutation · Comorbidity · ALADIN
© 2014 S. Karger AG, Basel
Introduction
The triple A syndrome (AAAS), also known as Allgrove syndrome (AS; MIM: 231550), is a rare autosomal recessive disorder. Though its incidence is still unknown [1], its prevalence in Europe was estimated at A transition (c.1232 + 1G>C; dbSNP: rs15051103) which was reported as a founder mutation among patients of North African origin (Tunisia and Algeria) [6] and may have spread to other Mediterranean populations (France, Spain and Portugal) [7, 8]. Congenital hypogonadotropic hypogonadism (CHH), or idiopathic hypogonadotropic hypogonadism, causes pubertal failure and infertility. CHH is usually due to insufficient secretion of LH and FSH, the two pituitary gonadotropins. CHH can be due to defective GnRH release by the hypothalamus or to primary gonadotrope cell dysfunction in the pituitary [9]. The CHH prevalence ranges between 1/4,000 and 1/10,000 in males [10]. Association of AAAS with CHH
The CHH molecular mechanisms, in patients with a normal sense of smell, are diverse. In some cases, they are due to mutations in the following genes affecting GnRH secretion: GnRHR (GnRH receptor, MIM: 138850); KISS1R (KISS1 receptor, MIM: 604161); TAC3 (tachykinin 3, MIM: 162330) and TACR3 (tachykinin receptor 3, MIM: 162332) or the GnRH action like the GnRHR gene (GnRH receptor, MIM: 138850) [10]. Mutations in genes affecting GnRH neuron migration as PROK2 (prokineticin 2, MIM: 607002) and PROKR2 (prokineticin receptor 2, MIM: 607212) [11] have been reported as well as the PROP1 transcription factor gene [12]. In the present study, we report on the clinical and genetic investigation of a Tunisian patient born to a consanguineous marriage and presenting an association of two rare syndromes: AS and CHH.
Patients and Methods Case Presentation An 18-year-old boy (patient M8HH) was admitted to the Endocrinology Department of the Charles-Nicolle Hospital for short stature and delayed puberty. This patient belongs to a consanguineous family originating from the Jerba island, with common ancestors not precisely identified but likely going back to around 6–7 generations ago (fig. 1). His birth weight was 3.2 kg after a monofetal pregnancy followed by a normal psychomotor development and an uneventful neonatal period. At the age of 5, he was first referred for a pediatric consultation because of recurrent convulsive seizures secondary to hypoglycemia. Clinical and biological examinations showed adrenal insufficiency. A replacement therapy with hydrocortisone was started. One year later, an intermittent paradoxical dysphagia appeared. An esophagogastroduodenoscopy followed by esophageal manometry showed an achalasia cardia with a moderate dilatation of a hypokinetic esophagus. Surgical Heller myotomy was done; then, an anti-reflux valve prosthesis was implanted. Consequently, AS diagnosis was confirmed by the presence of achalasia, Addison’s disease and alacrima. At the age of 11 years, the patient presented to us for treatment and surveillance. Physical examination revealed a delayed stature (height: 140 cm). The weight was 58 kg, and secondary sexual characteristics were absent. Hormonal exploration showed ACTH level at 640 ng/l (normal levels, A) was found in the AAAS gene. This mutation, responsible for AAAS, is a founder mutation in North Africa. Conclusion: This is the first report on a Tunisian patient with the coexistence of AAAS and CHH. The diagnosis of CHH should be taken in consideration in patients with Allgrove syndrome and who carry the IVS14 + 1G>A mutation as this might challenge appropriate genetic counseling.
Common ancestors going back around 6–7 generations ago
I 1
II
3
6
1
2
2
3
3
4
5
6
7
8
9
7
8
III 1 IV
2 M8HH
3
4
5
6 1
AS and CHH Hypofertile: conception after 20 years of marriage (according to the genetic questionnaire) Type 1 diabetes at the age of 20 years Investigated members
Fig. 1. M8HH family pedigree and history
Spontaneous miscarriage
drawn with the help of the index case using a genetic questionnaire.
Methods A genetic questionnaire was completed by interviewing the patient and his parents who signed an informed consent form after being informed about the benefit of the genetic study. Genomic DNA was extracted from peripheral blood leukocytes using standard procedures [13]. Targeted sequences were amplified using Taq Polymerase (Qiagen) and examined on 1% agarose gel electrophoresis. After PCR product purification using the Exo-SAP protocol, direct sequencing was performed using the Big Dye V.3.1 terminator Kit (Applied Biosystems, Foster City, Calif., USA) in an ABI Prism 3130 sequencer (Applied Biosystems).
340
Horm Res Paediatr 2014;82:338–343 DOI: 10.1159/000365888
Mutation Screening The M8HH patient was screened for IVS14 + 1G>A mutation, which was reported as the cause of AS syndrome in Tunisia. Concerning CHH mutation screening, exons of the 7 genes underlying CHH as well as their intronic boundaries were sequenced. Primers used for molecular screening of this mutation are illustrated in table 1.
Results
Direct sequencing revealed the presence of the IVS14 + 1G>A mutation at a homozygous state in the M8HH patient. His parents were heterozygous for the same mutation (fig. 2). Nevertheless, molecular investigation of the 7 genes involved in CHH failed to find any mutation. Only a known homozygous intronic variant (c.244 + 128C>T; dbSNP: rs350129) has been identified in the KISS1R gene. Its minor C allele frequency (Global MAF) is equal to 0.43. This neutral polymorphism was not disease associated, but its position corresponded to the regulatory region. Thus, we carried out an in silico analysis to test if the mutation may cause aberrant splicing by creating or abolishing a splice site. This analysis was performed Cherif Ben Abdallah et al.
Downloaded by: UCSF Library & CKM 169.230.243.252 - 12/8/2014 9:22:13 AM
theless, the patient presents a micropenis (penile size = 3 cm), a gonadal volume under 2 ml, a gynecomastia (S2) and a Tanner stage G1P1A1. Clinical features were carried out and showed a normal secretion of PRL and TSH. Growth hormone secretion was normal after stimulation (insulin tolerance test). The basal LH level was 0.18 mU/ml (normal levels, 1.14–8.75 mU/ml), and the basal FSH level was 1.6 mU/ml (normal levels, 1.37–13.58 mU/ml).The testosterone serum level was 0.14 nmol/l (normal levels, 10.4–42.6 mmol/l). LH and FSH hormone level peaks after stimulation with GnRH were 8 and 7 mU/ml, respectively. Cytogenetic investigation showed a normal karyotype. The positive response to the GnRH test indicates a hypothalamic origin of the gonadotropin deficiency; hence, the diagnosis of CHH was confirmed. A hypothalamic lesion was suspected. Magnetic resonance imaging of the hypothalamic and the pituitary region was normal.
4 PROK2 and PROKR2
all
Dodé et al. [36]
GnRHR
1
F: R: F: R: F: R:
2 3
TCTCAGGGACAAAATTTGACA AGGTAACAGAACAGAGCCAGA TGTCTCATACAGTTATACATCTTC CCTTATGGGGTGATTGTGAA CTTATTAAAACATGCTTTTCAAA GTATTTTTCCTGAAGACTTTTC
TAC3
3 and 4 F: R: 5 and 6 F: R:
TCAGGATGGGCTCAGGAAG TCCTAGTTCTGGATGGCCTCT TTAGGGGAGGCACTTGCTAA ACCTGTAGCATGGGAGGAAATG
TACR3
1
F: R: F: R: F: R: F: R:
CCAACCTCACCAACCAGTTC ACTCGAGGGCTACAAATGGG CCTAGACTATGCCATGATTACCA GCCATCCCACATAGACATCC CAACTGGCAGCATTTGAAAC GATTACAGTATGTGGACAGCAGC CAACTGGCAGCATTTGAAAC GATTACAGTATGTGGACAGCAGC
F: R: F: R:
GACAGGCACATGTGGTCCA CTCAATGCAGTTGCTCTGATG GCCTTGTGGAAGAGCTTTACTCC ATTTCTAATCGCTGAGCTGACCC
2 3 4 PROP1
2 3
AAAS
14
F: GTGAGAGGCCTGTTTCTTGC R: CAGCTTCTCCATCCAACTCC
using the NetGene2 Server (http://www.cbs.dtu.dk/ services/NetGene2/) and the Human Splicing (http:// www.umd.be/HSF/); none of them gave evidence for a likely deleterious effect.
Discussion
We report the first description of the coexistence of AS and CHH in the same consanguineous patient. The cosegregation of two genetic diseases in the same family, also known as comorbidity, has been previously reported in inbred populations from Middle East and North Africa Association of AAAS with CHH
Fig. 2. Electropherograms of exon 14 of the AAAS gene showing the presence of the IVS14 + 1G>A mutation at a homozygous state in the proband and at a heterozygous state in the parents. Wildtype sequence is also shown.
[14–18]. In Tunisia, 75 comorbid associations have been described. Among them, consanguinity was noticed in 41 cases [unpubl. data]. This finding largely supports the implication of familial endogamy in the emergence of multiple genetic diseases in the same family. Nevertheless, past isolation and subsequent consanguinity and endogamy could favor comorbidity expression. In fact, the patient family descend from common ancestors going back to around 6–7 generations and originating from the island of Jerba. This island located in the South East of Tunisia is inhabited by four ethnic groups [19]. The founder mutation causing AS in this patient likely has an Arab origin. Mutation datation has estimated its age to 2,400 years [7], which was then adjusted to 1,000–1,175 years ago. This age corresponds to a period of important migrations in North Africa from the Arabian Peninsula [6, 20]. Clinical examination showed that the M8HH patient had a short stature (142 cm) and delayed puberty without GH deficiency. Unlike CHH, growth retardation or small final size have been reported by several authors as being Horm Res Paediatr 2014;82:338–343 DOI: 10.1159/000365888
341
Downloaded by: UCSF Library & CKM 169.230.243.252 - 12/8/2014 9:22:13 AM
3
TTGCCGCTGGGTGAATAGAG GGGACCACAGGGAAAAGATT GAGCCATCCTGCTGGTCACT CCAGCTTCTGAGTGCATCTC CACCTTCTGTCCCCTCAAC TGCCGTGAAGGTGGTTAGAC GGTGGGAGGACAGCAAGG CTTCACAACGAAACTGCACC
Color version available online
2
F: R: F: R: F: R: F: R:
Heterozygous (parents)
1
Control
KISS1R
Homozygous (proband)
Table 1. PCR primers used for molecular study
Table 2. Association of AS with other genetic diseases
Ethnic origin
Consanguinity
3A mutation (locus: 12q13)
Second disease
Second gene mutation
Related phenotype
Ref.
Pakistani family
yes
AAAS (R194X)
primary growth hormone insensitivity
GHR c.618 + short stature 792A >1 G
31
Egyptian family
yes
ND
hypoglycemia
ND
giant café-au-lait patches
32
Southern Italian no parents
AAAS L381R
syringomyelia
ND
33 adrenal failure, muscle weakness, excessive fatigue and ataxia
Three members yes of a Greek family
AAAS A167V
ophthalmic features
ND
ND
34
Croatian parents
no
AAAS compound heterozygous (S296Y/S263P)
hereditary polyneuropathy
ND
hyperkeratosis of palms, cutis anserina, and nasal speech
35
Tunisian
yes
AAAS IVS14 + 1G>A
lateral amyotrophic sclerosis
ND
neurological disorders
present study
ND = Not determined.
342
Horm Res Paediatr 2014;82:338–343 DOI: 10.1159/000365888
considered as it might be a cooccurrence of CHH and hereditary hearing loss, the latter being due to a frequent GJB2 mutation [28]. In conclusion, high rates of consanguinity favor coexistence of various genetic diseases. Indeed, what seems to be exceptional may be taken into consideration in highly inbred communities [29]. Despite its rareness, comorbidity challenges appropriate genetic counseling and should be taken into account in countries where consanguineous and endogamous marriages are still culturally favored.
Acknowledgment We are thankful to the patient for his collaboration. This work was supported by the Tunisian Ministry of Higher Education and Scientific Research (Laboratory on ‘Biomedical Genomics and Oncogenetics’ LR11IPT05) and the Tunisian Ministry of Health.
References
1 Kilicli F, Acibucu F, Senel S, Dokmetas HS: Allgrove syndrome. Singapore Med J 2012; 53:e92–e94. 2 Capataz Ledesma M, Mendez Perez P, Rodriguez Lopez R, Galan Gomez E: Allgrove syndrome (triple A). Finding of a mutation not described in the AAAS gene (in Spanish). An Pediatr (Barc) 2013;78:109–112.
Cherif Ben Abdallah et al.
Downloaded by: UCSF Library & CKM 169.230.243.252 - 12/8/2014 9:22:13 AM
associated with 3 A syndrome [3, 21, 22]. This is likely the case for this family as two relatives suffering from AS have a short stature according to the parent’s interview. In addition, the patient had severe obesity. The co-occurrence of both diseases in the same patient, morbid obesity with short stature, as a familial characteristic might explain this feature uncommon for triple A and CHH patients. We have screened the literature for phenotypes associated with AS; delayed puberty caused by CHH has never been reported as being associated with this syndrome. However, AS has been described in association with other genetic diseases (table 2). Direct sequencing showed absence of any mutation in the investigated candidate genes. This result corroborates data of other articles which assert that genetic etiology of CHH subjects is still unknown, and more than 60–70% of mutations remain unidentified [23–25]. This supports the significant role of oligogenic inheritance and multifactorial genetic mechanisms of this disease [26]. In 2002, Houang et al. [27] have described an uncommon association, a patient (Tunisian with Sephardic Jew origin) who presented CHH in association with prelingual deafness due to the most frequent GJB2 gene mutation 35delG. The authors suggested a possible involvement of connexin in puberty initiation by its plausible role in coordination and synchronization of GnRH release. This hypothesis of common etiology should be re-
Association of AAAS with CHH
14 Ben Halim N, Ben Alaya Bouafif N, Romdhane L, Kefi Ben Atig R, Chouchane I, Bouyacoub Y, Arfa I, Cherif W, Nouira S, Talmoudi F, et al: Consanguinity, endogamy, and genetic disorders in Tunisia. J Community Genet 2013;4:273–284. 15 Bchetnia M, Merdassi A, Charfeddine C, Mgaieth F, Kassar S, Ouechtati F, Chouchene I, Boussen H, Mokni M, Osman AD, et al: Coexistence of mal de Meleda and congenital cataract in a consanguineous Tunisian family: two case reports. J Med Case Rep 2010;4:108. 16 Bchetnia M, Charfeddine C, Kassar S, Zribi H, Guettiti HT, Ellouze F, Cheour M, Boubaker S, Osman AD, Abdelhak S, Mokni M: Clinical and mutational heterogeneity of Darier disease in Tunisian families. Arch Dermatol 2009;145:654–656. 17 Romdhane L, Kefi R, Azaiez H, Ben Halim N, Dellagi K, Abdelhak S: Founder mutations in Tunisia: implications for diagnosis in North Africa and Middle East. Orphanet J Rare Dis 2012;7:52. 18 Ben Said M, Dhouib H, BenZina Z, Ghorbel A, Moreno F, Masmoudi S, Ayadi H, HmaniAifa M: Segregation of a new mutation in SLC26A4 and p.E47X mutation in GJB2 within a consanguineous Tunisian family affected with Pendred syndrome. Int J Pediatr Otorhinolaryngol 2012;76:832–836. 19 Loueslati BY, Cherni L, Khodjet-Elkhil H, Ennafaa H, Pereira L, Amorim A, Ben Ayed F, Ben Ammar Elgaaied A: Islands inside an island: reproductive isolates on Jerba island. Am J Hum Biol 2006;18:149–153. 20 Nebel A, Landau-Tasseron E, Filon D, Oppenheim A, Faerman M: Genetic evidence for the expansion of Arabian tribes into the Southern Levant and North Africa. Am J Hum Genet 2002;70:1594–1596. 21 Kinjo S, Takemoto M, Miyako K, Kohno H, Tanaka T, Katsumata N: Two cases of Allgrove syndrome with mutations in the AAAS gene. Endocr J 2004;51:473–477. 22 Houlden H, Smith S, De Carvalho M, Blake J, Mathias C, Wood NW, Reilly MM: Clinical and genetic characterization of families with triple A (Allgrove) syndrome. Brain 2002;125: 2681–2690. 23 Topaloglu AK, Kotan LD: Molecular causes of hypogonadotropic hypogonadism. Curr Opin Obstet Gynecol 2010;22:264–270. 24 Lewkowitz-Shpuntoff HM, Hughes VA, Plummer L, Au MG, Doty RL, Seminara SB, Chan YM, Pitteloud N, Crowley WF Jr, Balasubramanian R: Olfactory phenotypic spectrum in idiopathic hypogonadotropic hypogonadism: pathophysiological and genetic implications. J Clin Endocrinol Metab 2012; 97:E136–E144.
25 Beate K, Joseph N, Nicolas de R, Wolfram K: Genetics of isolated hypogonadotropic hypogonadism: role of GnRH receptor and other genes. Int J Endocrinol 2012;2012:147893. 26 Sykiotis GP, Plummer L, Hughes VA, Au M, Durrani S, Nayak-Young S, Dwyer AA, Quinton R, Hall JE, Gusella JF, et al: Oligogenic basis of isolated gonadotropin-releasing hormone deficiency. Proc Natl Acad Sci USA 2010;107:15140–15144. 27 Houang M, Gourmelen M, Moatti L, Le BY, Garabedian EN, Denoyelle F: Hypogonadotrophic hypogonadism associated with prelingual deafness due to a connexin 26 gene mutation. J Pediatr Endocrinol Metab 2002; 15:219–223. 28 Riahi Z, Hammami H, Ouragini H, Messai H, Zainine R, Bouyacoub Y, Romdhane L, Essaid D, Kefi R, Rhimi M, et al: Update of the spectrum of GJB2 gene mutations in Tunisian families with autosomal recessive nonsyndromic hearing loss. Gene 2013;525:1–4. 29 Romdhane L, Abdelhak S: Genetic diseases in the Tunisian population. Am J Med Genet A 2011;155A:238–267. 30 Marin S, Casano-Sancho P, Villarreal-Pena N, Sebastiani G, Pinillos S, Perez-Duenas B, Hwa V, Rosenfeld RG, Ibanez L: Triple A syndrome in a patient with genetic growth hormone insensitivity: phenotypic effects of two genetic disorders. Horm Res Paediatr 2012; 77:63–68. 31 Ismail AF, Mohamed S, Ezz-Elregal M, Talat I, Muthurajan S, Fouda A: Associations with hypoglycemia are useful: a case report of Allgrove syndrome. Turk J Gastroenterol 2012; 23:608–609. 32 Bizzarri C, Benevento D, Terzi C, Huebner A, Cappa M: Triple A (Allgrove) syndrome: an unusual association with syringomyelia. Ital J Pediatr 2013;39:39. 33 Moschos MM, Margetis I, Koehler K, Gatzioufas Z, Huebner A: New ophthalmic features in a family with triple A syndrome. Int Ophthalmol 2011;31:239–243. 34 Dumic M, Barisic N, Rojnic-Putarek N, Kusec V, Stanimirovic A, Koehler K, Huebner A: Two siblings with triple A syndrome and novel mutation presenting as hereditary polyneuropathy. Eur J Pediatr 2011;170:393–396. 35 Mokni N, Younes S, Chebel S, Marzouk K, Huebner A, Ayadi A, Sfar MT: Sclérose latérale amyotrophique et syndrome d’Allgrove chez deux familles. JCC Open 2013;1:49–53. 36 Dodé C, Teixeira L, Levilliers J, Fouveaut C, et al: Kallmann syndrome: mutations in the genes encoding prokineticin-2 and prokineticin receptor-2. PLoS Genet 2006;2:e175.
Horm Res Paediatr 2014;82:338–343 DOI: 10.1159/000365888
343
Downloaded by: UCSF Library & CKM 169.230.243.252 - 12/8/2014 9:22:13 AM
3 Handschug K, Sperling S, Yoon SJ, Hennig S, Clark AJ, Huebner A: Triple A syndrome is caused by mutations in AAAS, a new WDrepeat protein gene. Hum Mol Genet 2001;10: 283–290. 4 Cooper DN, Ball EV, Krawczak M: The human gene mutation database. Nucleic Acids Res 1998;26:285–287. 5 Sarathi V, Shah NS: Triple-A syndrome. Adv Exp Med Biol 2010;685:1–8. 6 Genin E, Tullio-Pelet A, Begeot F, Lyonnet S, Abel L: Estimating the age of rare disease mutations: the example of Triple-A syndrome. J Med Genet 2004;41:445–449. 7 Tullio-Pelet A, Salomon R, Hadj-Rabia S, Mugnier C, de Laet MH, Chaouachi B, Bakiri F, Brottier P, Cattolico L, Penet C, et al: Mutant WD-repeat protein in triple-A syndrome. Nat Genet 2000;26:332–335. 8 Hadj-Rabia S, Salomon R, Pelet A, Penet C, Rotschild A, de Laet MH, Chaouachi B, Hannachi R, Bakiri F, Brauner R, et al: Linkage disequilibrium in inbred North African families allows fine genetic and physical mapping of triple A syndrome. Eur J Hum Genet 2000; 8:613–620. 9 Young J: Approach to the male patient with congenital hypogonadotropic hypogonadism. J Clin Endocrinol Metab 2012; 97: 707– 718. 10 Brioude F, Bouligand J, Trabado S, Francou B, Salenave S, Kamenicky P, Brailly-Tabard S, Chanson P, Guiochon-Mantel A, Young J: Non-syndromic congenital hypogonadotropic hypogonadism: clinical presentation and genotype-phenotype relationships. Eur J Endocrinol 2010;162:835–851. 11 Pitteloud N, Zhang C, Pignatelli D, Li JD, Raivio T, Cole LW, Plummer L, JacobsonDickman EE, Mellon PL, Zhou QY, Crowley WF Jr: Loss-of-function mutation in the prokineticin 2 gene causes Kallmann syndrome and normosmic idiopathic hypogonadotropic hypogonadism. Proc Natl Acad Sci USA 2007;104:17447–17452. 12 Reynaud R, Barlier A, Vallette-Kasic S, Saveanu A, Guillet MP, Simonin G, Enjalbert A, Valensi P, Brue T: An uncommon phenotype with familial central hypogonadism caused by a novel PROP1 gene mutant truncated in the transactivation domain. J Clin Endocrinol Metab 2005;90:4880–4887. 13 Miller SA, Dykes DD, Polesky HF: A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.
HOR MON E RE SE ARCH I N PÆDIATRIC S
Received: February 3, 2014 Accepted: July 14, 2014 Published online: September 18, 2014
Horm Res Paediatr 2014;82:338–343 DOI: 10.1159/000365888
A Tunisian Patient with Two Rare Syndromes: Triple A Syndrome and Congenital Hypogonadotropic Hypogonadism Lamia Cherif Ben Abdallah a Youssef Lakhoua b Majdi Nagara a Karima Khiari b Sahar Elouej a Olfa Messaoud a Yosra Bouyacoub a Lilia Romdhane a Zinet Turki c Sonia Abdelhak a Nejib Ben Abdallah b
a
LR11IPT05, Laboratoire de Génomique Biomédicale et Oncogénétique, Institut Pasteur de Tunis, Université de Tunis El Manar, b Service d’Endocrinologie, Hôpital Charles-Nicolle, and c Service d’Endocrinologie, Institut de Nutrition, Tunis, Tunisia
Established Facts • Triple A syndrome (AAAS) and congenital hypogonadotropic hypogonadism (CHH) are two rare diseases. The first is autosomal recessive caused by mutations in the AAAS gene; the second presents a yet unknown genetic etiology.
Novel Insights • We report on phenotypic, endocrine and molecular features of a consanguineous patient with AAAS for whom CHH was subsequently diagnosed. The coexistence of these diseases has never been described. Given the particular psychosocial consequences related to impotence and infertility, the diagnosis of CHH should be taken into consideration in patients with AAAS and who carry the Maghrebian founder mutation.
Abstract Background/Aims: The coexistence of triple A syndrome (AAAS) and congenital hypogonadotropic hypogonadism (CHH) has so far not been reported in the literature. This study aimed to characterize at the clinical and genetic level one patient presenting an association of AAAS and CHH in
© 2014 S. Karger AG, Basel 1663–2818/14/0825–0338$39.50/0 E-Mail [email protected] www.karger.com/hrp
order to identify causal mutations. Methods: Clinical and endocrinal investigations were performed and followed by mutational screening of candidate genes. Results: At the age of 18, the patient presented sexual infantilism, a micropenis and gynecomastia. No mutation was revealed in GnRHR, TACR3/TAC3, PROK2/PROKR2 and PROP1 genes, except a homozygous intronic variation (c.244 + 128C>T;
L. Cherif Ben Abdallah and Y. Lakhoua contributed equally to this work.
Youssef Lakhoua Département d’Endocrinologie, Hôpital Charles-Nicolle Boulevard 9 Avril 1938 Tunis 1006 (Tunisia) E-Mail laksoso @ yahoo.fr
Downloaded by: UCSF Library & CKM 169.230.243.252 - 12/8/2014 9:22:13 AM
Key Words Triple A syndrome · Congenital hypogonadotropic hypogonadism · Founder mutation · Comorbidity · ALADIN
© 2014 S. Karger AG, Basel
Introduction
The triple A syndrome (AAAS), also known as Allgrove syndrome (AS; MIM: 231550), is a rare autosomal recessive disorder. Though its incidence is still unknown [1], its prevalence in Europe was estimated at A transition (c.1232 + 1G>C; dbSNP: rs15051103) which was reported as a founder mutation among patients of North African origin (Tunisia and Algeria) [6] and may have spread to other Mediterranean populations (France, Spain and Portugal) [7, 8]. Congenital hypogonadotropic hypogonadism (CHH), or idiopathic hypogonadotropic hypogonadism, causes pubertal failure and infertility. CHH is usually due to insufficient secretion of LH and FSH, the two pituitary gonadotropins. CHH can be due to defective GnRH release by the hypothalamus or to primary gonadotrope cell dysfunction in the pituitary [9]. The CHH prevalence ranges between 1/4,000 and 1/10,000 in males [10]. Association of AAAS with CHH
The CHH molecular mechanisms, in patients with a normal sense of smell, are diverse. In some cases, they are due to mutations in the following genes affecting GnRH secretion: GnRHR (GnRH receptor, MIM: 138850); KISS1R (KISS1 receptor, MIM: 604161); TAC3 (tachykinin 3, MIM: 162330) and TACR3 (tachykinin receptor 3, MIM: 162332) or the GnRH action like the GnRHR gene (GnRH receptor, MIM: 138850) [10]. Mutations in genes affecting GnRH neuron migration as PROK2 (prokineticin 2, MIM: 607002) and PROKR2 (prokineticin receptor 2, MIM: 607212) [11] have been reported as well as the PROP1 transcription factor gene [12]. In the present study, we report on the clinical and genetic investigation of a Tunisian patient born to a consanguineous marriage and presenting an association of two rare syndromes: AS and CHH.
Patients and Methods Case Presentation An 18-year-old boy (patient M8HH) was admitted to the Endocrinology Department of the Charles-Nicolle Hospital for short stature and delayed puberty. This patient belongs to a consanguineous family originating from the Jerba island, with common ancestors not precisely identified but likely going back to around 6–7 generations ago (fig. 1). His birth weight was 3.2 kg after a monofetal pregnancy followed by a normal psychomotor development and an uneventful neonatal period. At the age of 5, he was first referred for a pediatric consultation because of recurrent convulsive seizures secondary to hypoglycemia. Clinical and biological examinations showed adrenal insufficiency. A replacement therapy with hydrocortisone was started. One year later, an intermittent paradoxical dysphagia appeared. An esophagogastroduodenoscopy followed by esophageal manometry showed an achalasia cardia with a moderate dilatation of a hypokinetic esophagus. Surgical Heller myotomy was done; then, an anti-reflux valve prosthesis was implanted. Consequently, AS diagnosis was confirmed by the presence of achalasia, Addison’s disease and alacrima. At the age of 11 years, the patient presented to us for treatment and surveillance. Physical examination revealed a delayed stature (height: 140 cm). The weight was 58 kg, and secondary sexual characteristics were absent. Hormonal exploration showed ACTH level at 640 ng/l (normal levels, A) was found in the AAAS gene. This mutation, responsible for AAAS, is a founder mutation in North Africa. Conclusion: This is the first report on a Tunisian patient with the coexistence of AAAS and CHH. The diagnosis of CHH should be taken in consideration in patients with Allgrove syndrome and who carry the IVS14 + 1G>A mutation as this might challenge appropriate genetic counseling.
Common ancestors going back around 6–7 generations ago
I 1
II
3
6
1
2
2
3
3
4
5
6
7
8
9
7
8
III 1 IV
2 M8HH
3
4
5
6 1
AS and CHH Hypofertile: conception after 20 years of marriage (according to the genetic questionnaire) Type 1 diabetes at the age of 20 years Investigated members
Fig. 1. M8HH family pedigree and history
Spontaneous miscarriage
drawn with the help of the index case using a genetic questionnaire.
Methods A genetic questionnaire was completed by interviewing the patient and his parents who signed an informed consent form after being informed about the benefit of the genetic study. Genomic DNA was extracted from peripheral blood leukocytes using standard procedures [13]. Targeted sequences were amplified using Taq Polymerase (Qiagen) and examined on 1% agarose gel electrophoresis. After PCR product purification using the Exo-SAP protocol, direct sequencing was performed using the Big Dye V.3.1 terminator Kit (Applied Biosystems, Foster City, Calif., USA) in an ABI Prism 3130 sequencer (Applied Biosystems).
340
Horm Res Paediatr 2014;82:338–343 DOI: 10.1159/000365888
Mutation Screening The M8HH patient was screened for IVS14 + 1G>A mutation, which was reported as the cause of AS syndrome in Tunisia. Concerning CHH mutation screening, exons of the 7 genes underlying CHH as well as their intronic boundaries were sequenced. Primers used for molecular screening of this mutation are illustrated in table 1.
Results
Direct sequencing revealed the presence of the IVS14 + 1G>A mutation at a homozygous state in the M8HH patient. His parents were heterozygous for the same mutation (fig. 2). Nevertheless, molecular investigation of the 7 genes involved in CHH failed to find any mutation. Only a known homozygous intronic variant (c.244 + 128C>T; dbSNP: rs350129) has been identified in the KISS1R gene. Its minor C allele frequency (Global MAF) is equal to 0.43. This neutral polymorphism was not disease associated, but its position corresponded to the regulatory region. Thus, we carried out an in silico analysis to test if the mutation may cause aberrant splicing by creating or abolishing a splice site. This analysis was performed Cherif Ben Abdallah et al.
Downloaded by: UCSF Library & CKM 169.230.243.252 - 12/8/2014 9:22:13 AM
theless, the patient presents a micropenis (penile size = 3 cm), a gonadal volume under 2 ml, a gynecomastia (S2) and a Tanner stage G1P1A1. Clinical features were carried out and showed a normal secretion of PRL and TSH. Growth hormone secretion was normal after stimulation (insulin tolerance test). The basal LH level was 0.18 mU/ml (normal levels, 1.14–8.75 mU/ml), and the basal FSH level was 1.6 mU/ml (normal levels, 1.37–13.58 mU/ml).The testosterone serum level was 0.14 nmol/l (normal levels, 10.4–42.6 mmol/l). LH and FSH hormone level peaks after stimulation with GnRH were 8 and 7 mU/ml, respectively. Cytogenetic investigation showed a normal karyotype. The positive response to the GnRH test indicates a hypothalamic origin of the gonadotropin deficiency; hence, the diagnosis of CHH was confirmed. A hypothalamic lesion was suspected. Magnetic resonance imaging of the hypothalamic and the pituitary region was normal.
4 PROK2 and PROKR2
all
Dodé et al. [36]
GnRHR
1
F: R: F: R: F: R:
2 3
TCTCAGGGACAAAATTTGACA AGGTAACAGAACAGAGCCAGA TGTCTCATACAGTTATACATCTTC CCTTATGGGGTGATTGTGAA CTTATTAAAACATGCTTTTCAAA GTATTTTTCCTGAAGACTTTTC
TAC3
3 and 4 F: R: 5 and 6 F: R:
TCAGGATGGGCTCAGGAAG TCCTAGTTCTGGATGGCCTCT TTAGGGGAGGCACTTGCTAA ACCTGTAGCATGGGAGGAAATG
TACR3
1
F: R: F: R: F: R: F: R:
CCAACCTCACCAACCAGTTC ACTCGAGGGCTACAAATGGG CCTAGACTATGCCATGATTACCA GCCATCCCACATAGACATCC CAACTGGCAGCATTTGAAAC GATTACAGTATGTGGACAGCAGC CAACTGGCAGCATTTGAAAC GATTACAGTATGTGGACAGCAGC
F: R: F: R:
GACAGGCACATGTGGTCCA CTCAATGCAGTTGCTCTGATG GCCTTGTGGAAGAGCTTTACTCC ATTTCTAATCGCTGAGCTGACCC
2 3 4 PROP1
2 3
AAAS
14
F: GTGAGAGGCCTGTTTCTTGC R: CAGCTTCTCCATCCAACTCC
using the NetGene2 Server (http://www.cbs.dtu.dk/ services/NetGene2/) and the Human Splicing (http:// www.umd.be/HSF/); none of them gave evidence for a likely deleterious effect.
Discussion
We report the first description of the coexistence of AS and CHH in the same consanguineous patient. The cosegregation of two genetic diseases in the same family, also known as comorbidity, has been previously reported in inbred populations from Middle East and North Africa Association of AAAS with CHH
Fig. 2. Electropherograms of exon 14 of the AAAS gene showing the presence of the IVS14 + 1G>A mutation at a homozygous state in the proband and at a heterozygous state in the parents. Wildtype sequence is also shown.
[14–18]. In Tunisia, 75 comorbid associations have been described. Among them, consanguinity was noticed in 41 cases [unpubl. data]. This finding largely supports the implication of familial endogamy in the emergence of multiple genetic diseases in the same family. Nevertheless, past isolation and subsequent consanguinity and endogamy could favor comorbidity expression. In fact, the patient family descend from common ancestors going back to around 6–7 generations and originating from the island of Jerba. This island located in the South East of Tunisia is inhabited by four ethnic groups [19]. The founder mutation causing AS in this patient likely has an Arab origin. Mutation datation has estimated its age to 2,400 years [7], which was then adjusted to 1,000–1,175 years ago. This age corresponds to a period of important migrations in North Africa from the Arabian Peninsula [6, 20]. Clinical examination showed that the M8HH patient had a short stature (142 cm) and delayed puberty without GH deficiency. Unlike CHH, growth retardation or small final size have been reported by several authors as being Horm Res Paediatr 2014;82:338–343 DOI: 10.1159/000365888
341
Downloaded by: UCSF Library & CKM 169.230.243.252 - 12/8/2014 9:22:13 AM
3
TTGCCGCTGGGTGAATAGAG GGGACCACAGGGAAAAGATT GAGCCATCCTGCTGGTCACT CCAGCTTCTGAGTGCATCTC CACCTTCTGTCCCCTCAAC TGCCGTGAAGGTGGTTAGAC GGTGGGAGGACAGCAAGG CTTCACAACGAAACTGCACC
Color version available online
2
F: R: F: R: F: R: F: R:
Heterozygous (parents)
1
Control
KISS1R
Homozygous (proband)
Table 1. PCR primers used for molecular study
Table 2. Association of AS with other genetic diseases
Ethnic origin
Consanguinity
3A mutation (locus: 12q13)
Second disease
Second gene mutation
Related phenotype
Ref.
Pakistani family
yes
AAAS (R194X)
primary growth hormone insensitivity
GHR c.618 + short stature 792A >1 G
31
Egyptian family
yes
ND
hypoglycemia
ND
giant café-au-lait patches
32
Southern Italian no parents
AAAS L381R
syringomyelia
ND
33 adrenal failure, muscle weakness, excessive fatigue and ataxia
Three members yes of a Greek family
AAAS A167V
ophthalmic features
ND
ND
34
Croatian parents
no
AAAS compound heterozygous (S296Y/S263P)
hereditary polyneuropathy
ND
hyperkeratosis of palms, cutis anserina, and nasal speech
35
Tunisian
yes
AAAS IVS14 + 1G>A
lateral amyotrophic sclerosis
ND
neurological disorders
present study
ND = Not determined.
342
Horm Res Paediatr 2014;82:338–343 DOI: 10.1159/000365888
considered as it might be a cooccurrence of CHH and hereditary hearing loss, the latter being due to a frequent GJB2 mutation [28]. In conclusion, high rates of consanguinity favor coexistence of various genetic diseases. Indeed, what seems to be exceptional may be taken into consideration in highly inbred communities [29]. Despite its rareness, comorbidity challenges appropriate genetic counseling and should be taken into account in countries where consanguineous and endogamous marriages are still culturally favored.
Acknowledgment We are thankful to the patient for his collaboration. This work was supported by the Tunisian Ministry of Higher Education and Scientific Research (Laboratory on ‘Biomedical Genomics and Oncogenetics’ LR11IPT05) and the Tunisian Ministry of Health.
References
1 Kilicli F, Acibucu F, Senel S, Dokmetas HS: Allgrove syndrome. Singapore Med J 2012; 53:e92–e94. 2 Capataz Ledesma M, Mendez Perez P, Rodriguez Lopez R, Galan Gomez E: Allgrove syndrome (triple A). Finding of a mutation not described in the AAAS gene (in Spanish). An Pediatr (Barc) 2013;78:109–112.
Cherif Ben Abdallah et al.
Downloaded by: UCSF Library & CKM 169.230.243.252 - 12/8/2014 9:22:13 AM
associated with 3 A syndrome [3, 21, 22]. This is likely the case for this family as two relatives suffering from AS have a short stature according to the parent’s interview. In addition, the patient had severe obesity. The co-occurrence of both diseases in the same patient, morbid obesity with short stature, as a familial characteristic might explain this feature uncommon for triple A and CHH patients. We have screened the literature for phenotypes associated with AS; delayed puberty caused by CHH has never been reported as being associated with this syndrome. However, AS has been described in association with other genetic diseases (table 2). Direct sequencing showed absence of any mutation in the investigated candidate genes. This result corroborates data of other articles which assert that genetic etiology of CHH subjects is still unknown, and more than 60–70% of mutations remain unidentified [23–25]. This supports the significant role of oligogenic inheritance and multifactorial genetic mechanisms of this disease [26]. In 2002, Houang et al. [27] have described an uncommon association, a patient (Tunisian with Sephardic Jew origin) who presented CHH in association with prelingual deafness due to the most frequent GJB2 gene mutation 35delG. The authors suggested a possible involvement of connexin in puberty initiation by its plausible role in coordination and synchronization of GnRH release. This hypothesis of common etiology should be re-
Association of AAAS with CHH
14 Ben Halim N, Ben Alaya Bouafif N, Romdhane L, Kefi Ben Atig R, Chouchane I, Bouyacoub Y, Arfa I, Cherif W, Nouira S, Talmoudi F, et al: Consanguinity, endogamy, and genetic disorders in Tunisia. J Community Genet 2013;4:273–284. 15 Bchetnia M, Merdassi A, Charfeddine C, Mgaieth F, Kassar S, Ouechtati F, Chouchene I, Boussen H, Mokni M, Osman AD, et al: Coexistence of mal de Meleda and congenital cataract in a consanguineous Tunisian family: two case reports. J Med Case Rep 2010;4:108. 16 Bchetnia M, Charfeddine C, Kassar S, Zribi H, Guettiti HT, Ellouze F, Cheour M, Boubaker S, Osman AD, Abdelhak S, Mokni M: Clinical and mutational heterogeneity of Darier disease in Tunisian families. Arch Dermatol 2009;145:654–656. 17 Romdhane L, Kefi R, Azaiez H, Ben Halim N, Dellagi K, Abdelhak S: Founder mutations in Tunisia: implications for diagnosis in North Africa and Middle East. Orphanet J Rare Dis 2012;7:52. 18 Ben Said M, Dhouib H, BenZina Z, Ghorbel A, Moreno F, Masmoudi S, Ayadi H, HmaniAifa M: Segregation of a new mutation in SLC26A4 and p.E47X mutation in GJB2 within a consanguineous Tunisian family affected with Pendred syndrome. Int J Pediatr Otorhinolaryngol 2012;76:832–836. 19 Loueslati BY, Cherni L, Khodjet-Elkhil H, Ennafaa H, Pereira L, Amorim A, Ben Ayed F, Ben Ammar Elgaaied A: Islands inside an island: reproductive isolates on Jerba island. Am J Hum Biol 2006;18:149–153. 20 Nebel A, Landau-Tasseron E, Filon D, Oppenheim A, Faerman M: Genetic evidence for the expansion of Arabian tribes into the Southern Levant and North Africa. Am J Hum Genet 2002;70:1594–1596. 21 Kinjo S, Takemoto M, Miyako K, Kohno H, Tanaka T, Katsumata N: Two cases of Allgrove syndrome with mutations in the AAAS gene. Endocr J 2004;51:473–477. 22 Houlden H, Smith S, De Carvalho M, Blake J, Mathias C, Wood NW, Reilly MM: Clinical and genetic characterization of families with triple A (Allgrove) syndrome. Brain 2002;125: 2681–2690. 23 Topaloglu AK, Kotan LD: Molecular causes of hypogonadotropic hypogonadism. Curr Opin Obstet Gynecol 2010;22:264–270. 24 Lewkowitz-Shpuntoff HM, Hughes VA, Plummer L, Au MG, Doty RL, Seminara SB, Chan YM, Pitteloud N, Crowley WF Jr, Balasubramanian R: Olfactory phenotypic spectrum in idiopathic hypogonadotropic hypogonadism: pathophysiological and genetic implications. J Clin Endocrinol Metab 2012; 97:E136–E144.
25 Beate K, Joseph N, Nicolas de R, Wolfram K: Genetics of isolated hypogonadotropic hypogonadism: role of GnRH receptor and other genes. Int J Endocrinol 2012;2012:147893. 26 Sykiotis GP, Plummer L, Hughes VA, Au M, Durrani S, Nayak-Young S, Dwyer AA, Quinton R, Hall JE, Gusella JF, et al: Oligogenic basis of isolated gonadotropin-releasing hormone deficiency. Proc Natl Acad Sci USA 2010;107:15140–15144. 27 Houang M, Gourmelen M, Moatti L, Le BY, Garabedian EN, Denoyelle F: Hypogonadotrophic hypogonadism associated with prelingual deafness due to a connexin 26 gene mutation. J Pediatr Endocrinol Metab 2002; 15:219–223. 28 Riahi Z, Hammami H, Ouragini H, Messai H, Zainine R, Bouyacoub Y, Romdhane L, Essaid D, Kefi R, Rhimi M, et al: Update of the spectrum of GJB2 gene mutations in Tunisian families with autosomal recessive nonsyndromic hearing loss. Gene 2013;525:1–4. 29 Romdhane L, Abdelhak S: Genetic diseases in the Tunisian population. Am J Med Genet A 2011;155A:238–267. 30 Marin S, Casano-Sancho P, Villarreal-Pena N, Sebastiani G, Pinillos S, Perez-Duenas B, Hwa V, Rosenfeld RG, Ibanez L: Triple A syndrome in a patient with genetic growth hormone insensitivity: phenotypic effects of two genetic disorders. Horm Res Paediatr 2012; 77:63–68. 31 Ismail AF, Mohamed S, Ezz-Elregal M, Talat I, Muthurajan S, Fouda A: Associations with hypoglycemia are useful: a case report of Allgrove syndrome. Turk J Gastroenterol 2012; 23:608–609. 32 Bizzarri C, Benevento D, Terzi C, Huebner A, Cappa M: Triple A (Allgrove) syndrome: an unusual association with syringomyelia. Ital J Pediatr 2013;39:39. 33 Moschos MM, Margetis I, Koehler K, Gatzioufas Z, Huebner A: New ophthalmic features in a family with triple A syndrome. Int Ophthalmol 2011;31:239–243. 34 Dumic M, Barisic N, Rojnic-Putarek N, Kusec V, Stanimirovic A, Koehler K, Huebner A: Two siblings with triple A syndrome and novel mutation presenting as hereditary polyneuropathy. Eur J Pediatr 2011;170:393–396. 35 Mokni N, Younes S, Chebel S, Marzouk K, Huebner A, Ayadi A, Sfar MT: Sclérose latérale amyotrophique et syndrome d’Allgrove chez deux familles. JCC Open 2013;1:49–53. 36 Dodé C, Teixeira L, Levilliers J, Fouveaut C, et al: Kallmann syndrome: mutations in the genes encoding prokineticin-2 and prokineticin receptor-2. PLoS Genet 2006;2:e175.
Horm Res Paediatr 2014;82:338–343 DOI: 10.1159/000365888
343
Downloaded by: UCSF Library & CKM 169.230.243.252 - 12/8/2014 9:22:13 AM
3 Handschug K, Sperling S, Yoon SJ, Hennig S, Clark AJ, Huebner A: Triple A syndrome is caused by mutations in AAAS, a new WDrepeat protein gene. Hum Mol Genet 2001;10: 283–290. 4 Cooper DN, Ball EV, Krawczak M: The human gene mutation database. Nucleic Acids Res 1998;26:285–287. 5 Sarathi V, Shah NS: Triple-A syndrome. Adv Exp Med Biol 2010;685:1–8. 6 Genin E, Tullio-Pelet A, Begeot F, Lyonnet S, Abel L: Estimating the age of rare disease mutations: the example of Triple-A syndrome. J Med Genet 2004;41:445–449. 7 Tullio-Pelet A, Salomon R, Hadj-Rabia S, Mugnier C, de Laet MH, Chaouachi B, Bakiri F, Brottier P, Cattolico L, Penet C, et al: Mutant WD-repeat protein in triple-A syndrome. Nat Genet 2000;26:332–335. 8 Hadj-Rabia S, Salomon R, Pelet A, Penet C, Rotschild A, de Laet MH, Chaouachi B, Hannachi R, Bakiri F, Brauner R, et al: Linkage disequilibrium in inbred North African families allows fine genetic and physical mapping of triple A syndrome. Eur J Hum Genet 2000; 8:613–620. 9 Young J: Approach to the male patient with congenital hypogonadotropic hypogonadism. J Clin Endocrinol Metab 2012; 97: 707– 718. 10 Brioude F, Bouligand J, Trabado S, Francou B, Salenave S, Kamenicky P, Brailly-Tabard S, Chanson P, Guiochon-Mantel A, Young J: Non-syndromic congenital hypogonadotropic hypogonadism: clinical presentation and genotype-phenotype relationships. Eur J Endocrinol 2010;162:835–851. 11 Pitteloud N, Zhang C, Pignatelli D, Li JD, Raivio T, Cole LW, Plummer L, JacobsonDickman EE, Mellon PL, Zhou QY, Crowley WF Jr: Loss-of-function mutation in the prokineticin 2 gene causes Kallmann syndrome and normosmic idiopathic hypogonadotropic hypogonadism. Proc Natl Acad Sci USA 2007;104:17447–17452. 12 Reynaud R, Barlier A, Vallette-Kasic S, Saveanu A, Guillet MP, Simonin G, Enjalbert A, Valensi P, Brue T: An uncommon phenotype with familial central hypogonadism caused by a novel PROP1 gene mutant truncated in the transactivation domain. J Clin Endocrinol Metab 2005;90:4880–4887. 13 Miller SA, Dykes DD, Polesky HF: A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.
