Analyst View Article Online
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
PAPER
View Journal | View Issue
Cite this: Analyst, 2014, 139, 5209
A supersandwich electrochemiluminescence immunosensor based on mimic-intramolecular interaction for sensitive detection of proteins† Ying He, Yaqin Chai,* Ruo Yuan,* Haijun Wang, Lijuan Bai and Ni Liao An electrochemiluminescence (ECL) immunoassay protocol was developed based on mimicintramolecular interaction for sensitive detection of prostate specific antigen (PSA). It was constructed by integrating
the
ECL
luminophore
(tris(4,40 -dicarboxylicacid-2,20 -bipyridyl)-ruthenium(II)dichloride
(Ru(dcbpy)32+)) and coreactant (histidine) into the supersandwich DNA structure. This strategy was more effective in amplifying the ECL signal by shortening the electronic transmission distance, improving the ECL luminous stability and enhancing the ECL luminous efficiency. The ECL matrices denoted as MWCNTs@PDA–AuNPs were fabricated through spontaneous oxidative polymerization of dopamine (DA) on multiwalled carbon nanotubes (MWCNTs) and reducing HAuCl4 to produce gold nanoparticles (AuNPs) by DA simultaneously. Then, the prepared matrices were applied to bind capture antibodies. Moreover, supersandwich Ab2 bioconjugate was designed using a PAMAM dendrimer to immobilize the detection antibody and supersandwich DNA structure. The PAMAM dendrimer, with a plurality of secondary and tertiary amine groups, not only facilitated high-density immobilization of the detection antibody and supersandwich DNA structure, but also greatly amplified the ECL signal of Ru(dcbpy)32+. Received 3rd June 2014 Accepted 21st July 2014
The supersandwich DNA structure contained multiple Ru(dcbpy)32+ and histidine, further amplifying the ECL signal. The proposed supersandwich immunosensor showed high sensitivity with a detection limit of 4.2 fg mL1 and a wide linear range of 0.01 pg mL1–40.00 ng mL1. With the excellent stability,
DOI: 10.1039/c4an01002g
satisfying precision and reproducibility, the proposed immunosensor indicates promising practicability for
www.rsc.org/analyst
clinical diagnosis.
Introduction Electrochemiluminescence (ECL) involves the generation of species at electrode surfaces followed by electron transfer reactions to form excited states that emit light. Owing to its intrinsic advantages of high sensitivity and wide range of analytes, ECL has received considerable attention in biosensing applications.1 Among the various existing ECL systems, coreactant ECL with the advantages of the highest ECL efficiency, fast response, and favorable compatibility has been used in a wide range of analytical applications, including clinical diagnostics, environmental assays and biowarfare agent detection.2 Tris(4,40 -dicarboxylicacid-2,20 -bipyridyl)-ruthenium(II)dichloride (Ru(dcbpy)32+), due to its low-lying metal-to-ligand charge transfer (MLCT) excited state, wide application range of pH and long excited-state life times, is used as the luminophore here.3
Education Ministry Key Laboratory on Luminescence and Real-Time Analytical Chemistry, College of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715, People's Republic of China. E-mail: [email protected]; [email protected]; Fax: +86-23-68253172; Tel: +86-23-68252277 † Electronic supplementary 10.1039/c4an01002g
information
(ESI)
This journal is © The Royal Society of Chemistry 2014
available.
See
DOI:
Recently, some amine compounds have been developed as coreactants to signicantly enhance the ECL signal of Ru(bpy)32+ and its derivatives.4 Histidine (a-amino-b-(4-imidazolyl) propionic acid) is an a-amino acid with an imidazole group. The signal amplication efficiency of histidine is very high among 21 amino acids.5 Furthermore, a distinct character of histidine is that it can enhance the stability of antibodies.6 All these peculiar and excellent properties allow histidine to serve as an effective coreactant of Ru(dcbpy)32+. Up until now, almost all commercial ECL analytical instruments were based on coreactant ECL, but some disadvantages still exist. In intermolecular interaction ECL, coreactant is usually needed in vast molar excess and is consumed in the oxidation process. The large excess of coreactant also causes some increased background.7 Compared with intermolecular interaction ECL, intramolecular interaction ECL can generate ECL in a much more efficient way, and the dosage of the coreactant can be signicantly lowered.8 However, unfortunately, the synthetic process of the conjugate ruthenium complex in intramolecular interaction ECL is difficult, costly and time-consuming. Nanomaterials are very attractive due to their unique properties in optical, electrical, catalytic and magnetic aspects. Spontaneous self-assembly of polymers incorporating adhesion
Analyst, 2014, 139, 5209–5214 | 5209
View Article Online
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
Analyst
and other functions shows the virtue of integration of individual components, which have potential applications in nanoelectronic devices, nanosensors and catalysts.9 Dopamine (DA), a catecholamine, can be spontaneously polymerized into polydopamine (PDA) and form adhesive coatings on almost all the organic and inorganic surfaces.10 Therefore, MWCNTs are easily coated with the reactive PDA. Moreover, DA has also been used as a reducing agent for the synthesis of noble metal nanoparticles.11 Thus, the ECL matrices MWCNTs@PDA– AuNPs were successfully prepared in this work. The PAMAM dendrimer is a nanoscopic spherical macromolecule with repeating dendritic branching and possesses numerous chain ends that can be easily functionalized. It has been extensively investigated for biomedical applications such as gene therapy, drug delivery and bioimaging purposes. The carboxyl-terminated PAMAM dendrimer is of particular interest because the multiple functional sites available for reaction on its surface facilitates high-density immobilization of antibodies and efficient capture of probe DNA. Moreover, there are a plurality of secondary and tertiary amine groups in the PAMAM dendrimer that can greatly amplify the ECL signal of Ru(dcbpy)32+.12 In this work, a mimic-intramolecular interaction ECL was constructed by the combination of ECL luminophore (Ru(dcbpy)32+) and coreactant (histidine) in the supersandwich DNA structure. The ECL matrices MWCNTs@PDA–AuNPs were used to immobilize capture PSA antibodies (Ab1). When antigens were present, the sandwiched immunocomplex could be formed between the immobilized Ab1 and the supersandwich Ab2 bioconjugates. The supersandwich Ab2 bioconjugates were designed using a PAMAM dendrimer to immobilize detection PSA antibodies (Ab2) and auxiliary probe I (A1). The A1 immediately hybridized to the complementary region on the Ru(dcbpy)32+ modied auxiliary probe II (Ru-A2), and continuous hybridization reactions between alternating histidinemodied auxiliary probe I (His-A1) and Ru-A2 led to long DNA concatamers. As a result, the long DNA concatamers contained multiple Ru-A2 and His-A1. Moreover, this strategy made the electronic transmission distance shorter, resulting in a more effective amplication of the ECL signal.13 Accordingly, we can achieve a simple and ultrasensitive biosensor for protein detection.
Experimental Reagents Prostate specic antigen (PSA) and anti-PSA standard solutions, carcinoembryonic antigen (CEA), and alpha-fetoprotein antigen (AFP) were received from Biocell (Zhengzhou, China). Tris (4,40 -dicarboxylicacid-2,20 -bipyridyl)-ruthenium(II)dichloride (Ru(dcbpy)32+), bovine serum albumin (BSA, 96–99%), N-(3dimethylaminopropyl)-N0 -ethylcarbodiimide hydrochloride (EDC), hemoglobin (Hb), N-hydroxysuccinimide (NHS) and HAuCl4$4H2O were purchased from Sigma-Aldrich (St. Louis, MO, USA). Carboxyl-terminated polyamidoamine (PAMAM) dendrimer G3.5 was purchased from Weihai CY Dendrimer Technology Co., Ltd. (Weihai, China). Multiwalled carbon nanotubes (MWCNTs) (>95% purity) were purchased from
5210 | Analyst, 2014, 139, 5209–5214
Paper
Chengdu Organic Chemicals Co., Ltd. of the Chinese Academy of Science (Chengdu, China). Dopamine (DA) was obtained from Chemical Reagent Co. (Chongqing, China). Histidine was purchased from Kangda Amino Acid (Shanghai, China). Tris(hydroxymethyl)aminomethane (TRIS) was purchased from Roche (Switzerland). Phosphate-buffered solutions (PBS, pH 7.4, 0.1 M) were prepared using 0.1 M Na2HPO4, 0.1 M KH2PO4 and 0.1 M KCl. Ferricyanide solutions (Fe(CN)63/4, 5.0 mM, pH 7.4) were obtained by dissolving potassium ferricyanide and potassium ferrocyanide in PBS (pH 7.4). Auxiliary probe I (A1): 50 –NH2–ACGAAAGATAGCCACTCGTA TTCATCACTGGACCGATACGCGACATATCGTGCCAATTAG-30 and Auxiliary probe II (A2): 50 –NH2–TGACATTTGCTCGATTCCTA TACGAGTGGCTATCTTTCGTCTAATTGGCACGATATGTCG-3 0 were purchased from TaKaRa (Dalian, China). The serum specimens were obtained from Da Ping Hospital (Chongqing, China). All chemicals were analytical grade and used without further purication. The doubly distilled water used was puried through a Millipore system.
Apparatus MPI-A ECL analyzer (Xi'an Remax Electronic Science & Technology Co. Ltd., Xi'an, China) was used to measure the ECL signals with the voltage of the photomultiplier tube (PMT) set at 800 V in the process of detection. Cyclic voltammetry (CV) measurements were carried out with a CHI 600d electrochemistry workstation (Shanghai CH Instruments, China). UV-visible absorption spectra were obtained from a UV-vis spectrophotometer (Lambda 17, Perkin-Elmer, USA). All experiments were performed with a conventional three-electrode system: an Ag/ AgCl (sat. KCl) reference electrode, a platinum wire counter electrode and the modied glassy carbon electrode (GCE) as the working electrode. The morphologies of nanoparticles were estimated from a scanning electron microscope (SEM, S-4800, Hitachi Instrument, Japan).
Preparation of MWCNTs@PDA–AuNPs composites Firstly, MWCNTs were carboxyl-functionalized and shortened by reuxing in a mixture of concentrated H2SO4–HNO3 (1 : 3, v/v) for 40 min at 100 C, followed by washing to neutrality with doubly distilled water.14 The functionalized MWCNTs were coated with PDA as follows: 10.0 mg functionalized MWCNTs were dispersed into 2.0 mg mL1 DA solution (TRIS buffer, pH 8.5) and sonicated for 10 min in an ice water bath. Aer that, the mixtures were incubated in the dark at room temperature for 36 h. The obtained brown suspension was washed with doubly distilled water 3 times to obtain MWCNTs@PDA composites.15 Then, 10 mg of MWCNTs@PDA was added into 10 mL of 1.4 mM HAuCl4 solution. This mixture was mildly stirred at room temperature for 2 h. Then, the resultant reddish-brown precipitate was collected by centrifugation and rinsed with doubly distilled water.16 Fig. 1 shows the scanning electron microscopy (SEM) image of the nanoparticles and Fig. S1† shows the UV-vis absorption spectra of the nanoparticles.
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
Paper
Analyst
SEM images of carboxylic MWCNTs (A), MWCNTs@PDA (B), MWCNTs@PDA–AuNPs and (C).
Fig. 1
Preparation of Ab2–PAMAM–A1 The Ab2–PAMAM–A1 was synthesized briey by the following steps. First, 40 mg EDC and 10 mg NHS were successively added into 2 mL of 0.8 pM PAMAM dendrimer solution to activate the carboxyl groups of the PAMAM dendrimer. EDC and NHS were used as coupling agents, which catalyzed the formation of amide bonds between the carboxyl of the PAMAM dendrimer and the amino of Ab2 and A1. Following that, 100 mL of 17 mM A1 and 200 mL of PSA antibody (Ab2) were added to the solution under continuous and slow stirring for about 2 h at 4 C. Aer the reaction, the unreacted reagents were removed by using a 50 000 molecular weight cut-off dialysis membrane with PBS buffer (0.1 M, pH 7.4) overnight at 4 C. Subsequently, the obtained solution was diluted to 1 mL with PBS buffer (pH 7.4); thus, the Ab2–PAMAM–A1 was obtained. Preparation of supersandwich Ab2 bioconjugates Firstly, 40 mg EDC and 10 mg NHS were successively added into 2 mL of 6.45 mM Ru(dcbpy)32+ solution to activate the carboxyl groups of Ru(dcbpy)32+. Following that, 100 mL of 17.8 mM A2 was added to the solution under continuous and slow stirring at 4 C for about 2 h to form Ru-A2. Superuous Ru(dcbpy)32+ could be removed by washing in the preparation of the immunosensor. Secondly, the carboxyl groups of 2 mL of 6.45 mM histidine solution were activated by the same method. Then, 100 mL of 17 mM A1 was added to the solution under continuous and slow stirring for about 2 h at 4 C to form His-A1. Superuous histidine could be removed by washing in the preparation of the immunosensor. Aer that, Ab2–PAMAM–A1 and RuA2, were mixed with His-A1, and gently stirred at room temperature for 50 min. The resultant complex was centrifuged and washed several times with washing buffer. The obtained supersandwich Ab2 bioconjugates were redispersed in PBS buffer (0.1 M, pH 7.4) and stored at 4 C for further use. Fabrication of the ECL immunosensor The schematic diagram of the preparation of the ECL immunosensor is shown in Scheme 1. Firstly, the GCE (F ¼ 4 mm) was successively polished with 0.3 and 0.05 mm alumina slurry to obtain a mirror-like surface. Then, it was cleaned chemically by immersing it in 8 M HNO3 solution for 30 s. Aer being rinsed thoroughly with water and ethanol in an ultrasonic bath, the GCE was allowed to dry at room temperature.
This journal is © The Royal Society of Chemistry 2014
Scheme 1
The schematic diagrams of the immunosensor.
Subsequently, 5 mL MWCNTs@PDA–AuNPs was coated on the electrode and air-dried at room temperature. Then, 15 mL capture PSA antibody (Ab1) was placed on the electrode surface, and was allowed to incubate for 8 h at 4 C. Next, the immunosensor was thoroughly cleaned with washing buffer to remove the physical adsorbed Ab1, and then incubated with 15 mL BSA (1.0 wt%) solution for 1 h to block the non-specic binding sites on the surface, followed by washing with washing buffer. Ultimately, the obtained immunosensor was stored at 4 C when not in use. Experimental measurements The measurement was based on a sandwich immunoassay method. Before measurement, the proposed immunosensor was incubated with 15 mL PSA standard solutions at different concentrations for 20 min at room temperature. Next, the modied electrode was incubated in supersandwich Ab2 bioconjugates solution for 50 min at room temperature. Finally, the resultant immunosensor was washed by similar washing steps as above and investigated with a MPI-A ECL analyzer in 3 mL PBS buffer (0.1 M, pH 7.4) at room temperature.
Results and discussion Characterization of different nanomaterials Fig. 1 shows the scanning electron microscopy (SEM) images of different nanocomposites. As shown in Fig. 1A, the image of the MWCNTs displayed a well-dispersed tubular structure. Compared with MWCNTs, the surface of MWCNTs@PDA became fatter (Fig. 1B), which indicated that MWCNTs had
Analyst, 2014, 139, 5209–5214 | 5211
View Article Online
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
Analyst
been coated with a PDA lm. Aer being treated with HAuCl4, many bright spots of 25 nm were observed to be adhered individually on nanotubes (Fig. 1C). These bright spots indicated that HAuCl4 was successfully reduced to AuNPs by DA. Furthermore, UV-visible absorption spectroscopy was used to evaluate the surface functionalization by PDA and AuNPs (see ESI, Fig. S1†). By the same token, the characteristics of the as-synthesized supersandwich Ab2 bioconjugates were also investigated (Fig. 2). There was an absorption peak at 260 nm for the prepared Ab2–PAMAM–A1, originating from DNA molecules (Fig. 2(A)).17,18 However, no absorption peak of Ab2 antibodies was observed. The reason might be the fact that the amount of the immobilized antibodies on the PAMAM dendrimer was relatively little. Aer incubation with Ru-A2 and His-A1, three new absorption peaks appeared at 465, 344 and 302 nm, which were attributed to the presence of Ru(dcbpy)32+.19 There was a new absorption peak appeared at 210 nm, which was attributed to the presence of histidine.20–22 Moreover, it can be seen that the absorption peaks increased with the increasing concentration of Ru-A2 and His-A1 (Fig. 2(B)) owing to a consequence of the Ab2–PAMAM–A1 hybridization chain reaction with Ru-A2 and histidine-A1.
Optimization of detection conditions We considered the possible experimental variables that mediated the ECL signal value, including solution pH, immunoreaction time and DNA hybridization reaction time. In the double antibody sandwich-type immunoassays, temperature and time for the antigen–antibody interaction greatly inuenced the sensitivity of the developed immunoassay. Considering the practical application of the proposed immunosensor, all experiments were carried out at room temperature. Following that, the study of pH inuence on the ECL detection was conducted in the range of 5.5–10.0. As shown in the ESI (Fig. S2(A)†), the ECL response gradually increased from pH 5.5 to 7.4, and then changed steadily from 7.4 to 9.0, and subsequently the ECL response rapidly decreased at pH values higher than 9.0. Taking this into consideration, the optimum pH was chosen as 7.4. The reason may be that the highly acidic or alkaline surroundings damaged the immobilized protein and was not favorable to the ECL reaction.23 The immunoreaction
Fig. 2 UV-vis absorption spectra of (A) Ab2–PAMAM–A1 and Ab2– PAMAM–A1–Ru-A2–His-A1; and (B) Ab2–PAMAM–A1 after incubation with various concentrations of Ru-A2 + His-A1 (0.1, 0.3, 0.4, 0.5, and 0.7 mM from bottom to top) for 50 min at room temperature.
5212 | Analyst, 2014, 139, 5209–5214
Paper
time was investigated between 5 and 40 min. As shown in the ESI (Fig. S2(B)†), the ECL response increased with the length of incubation time, and tended to level off aer 20 min. Longer incubation time had no signicant effect on the ECL response.; therefore, the optimum interaction time was considered to be 20 min. The comparison of different Ab2 bioconjugates In order to clarify the mimic-intramolecular ECL mechanism was more efficient than intermolecular, an experiment to compare the luminous efficiency of two immunosensing strategies was designed and conducted. The kinetic behaviors of the modied electrodes (GCE/MWCNTs@PDA–AuNPs/BSA/PSA/ Ab2–PAMAM–A1) were studied by monitoring the ECL response as a function of incubation time with two different mixtures ((a) Ru-A2 + A1 + histidine and (b) Ru-A2 + His-A1). The concentration of histidine in (a) was 6.45 mM, and same amount of histidine was used in the synthetic process of His-A1 (b). As shown in Fig. 3, the ECL response increased with the increasing hybridization reaction time. Compared with (a), the optimal time in (b) appeared earlier, and the ECL signal was much higher. The reason might be the fact that the electronic transmission of the mimic-intramolecular interaction ECL is more effective. Therefore, a reaction time of 50 min was chosen as the optimum reaction time for the hybridization reaction in this experiment. We also explored the effect of the PAMAM dendrimer, histidine and supersandwich structure on the ECL signal (see ESI, Fig. S3†). Characteristics of the ECL immunosensor The fabrication process of the ECL immunosensor was characterized by cyclic voltammogram (CV) experiments. Welldened redox peaks of [Fe(CN)6]3/4 were obtained at bare GCE (Fig. 4, curve a). When MWCNTs@PDA–AuNPs was coated on the electrode, the peak current of the modied electrode decreased a little (curve b), demonstrating that it as an excellent conducting material for accelerating electron transfer. Subsequently, the peak decreased gradually with the immobilizing of
Fig. 3 ECL profiles of GCE/MWCNTs@PDA–AuNPs/BSA/PSA/Ab2– PAMAM–A1 after incubation with (a) Ru-A2 + A1 + histidine and (b) RuA2 + His-A1 as a function of time.
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
Paper
Fig. 4 CVs of (a) the bare GCE; (b) GCE/MWCNTs@PDA–AuNPs; (c) GCE/MWCNTs@PDA–AuNPs/Ab1; (d) GCE/MWCNTs@PDA–AuNPs/ Ab1/PSA; (e) GCE/MWCNTs@ PDA–AuNPs/Ab1/BSA/PSA; and (f) GCE/ MWCNTs@PDA–AuNPs/Ab1/BSA/PSA/Ab2–PAMAM–A1–Ru-A2–HisA1 in 5 mM [Fe(CN)6]3/4 with a scanning potential from 0.2 to 0.6 V and at a scan rate of 100 mV s1.
Ab1 (curve c), BSA (curve d), PSA (curve e), supersandwich Ab2 bioconjugate (curve f), which suggested a big molecular protein retarded the electron transport. To gain a better understanding of the fabrication process, electrochemical impedance spectroscopy (EIS) was also performed at different modied electrodes (see ESI, Fig. S4†). ECL detection of PSA with immunosensor Under the optimal experimental conditions, the sensitivity and the quantitative range of the proposed ECL immunosensor were subjected to solutions with different concentration of PSA. As expected, the intensity of the ECL increased gradually with the increase in the concentration of PSA (Fig. 5, curves a–i). The
ECL profiles of the proposed ECL immunosensor in different concentrations of PSA (ng mL1) (a) 0.00001, (b) 0.0001, (c) 0.001, (d) 0.01, (e) 0.1, (f) 1.0, (g) 4.0, (h) 20 and (i) 40. The inset is the logarithmic calibration curve for PSA detection in PBS (0.1 M, pH 7.4). Fig. 5
This journal is © The Royal Society of Chemistry 2014
Analyst
calibration curve of ECL intensity versus the logarithm of PSA concentrations is presented in the inset of Fig. 3. There was a good linear relationship between ECL intensity and the logarithm of PSA concentrations ranged from 0.01 pg mL1 to 40 ng mL1. The regression equation was I ¼ 1014.1 log cPSA + 5670.3 with a correlation coefficient of 0.9987 (where I is the ECL intensity (a.u.), and cPSA is the concentration of PSA). The amplication factors of this proposed immunosensor may be as follows: rstly, the supersandwich structure can bring numerous histidine and Ru(dcbpy)32+ closer to the electrode surface to produce the signicantly amplied signal; secondly, the PAMAM dendrimer as an excellent coreactant of Ru(dcbpy)32+ facilitated high-density immobilization of Ab2 and A1, which pronouncedly amplied the ECL signal of Ru(dcbpy)32+; thirdly, this strategy made the electronic transmission distance shorter, achieving a more effective amplication of the ECL signal. Thus, the PSA could be detected at levels down to 4.2 fg mL1, which was much lower than those of previous electrochemical (0.14 ng mL1),24 photolithographic (0.25 ng mL1),25 colorimetric (0.03 ng mL1)26 and MEMS (50.0 fg mL1)27 immunoassays.
Stability, selectivity and reproducibility of the immunosensor The ECL intensities of the immunosensor remained at a comparatively stable value (1.0% variation) during consecutive cyclic potential scanning for 16 cycles (Fig. 6A), indicating a good stability for ECL detection. To evaluate the specicity of the detection method, some proteins such as CEA, AFP, Hb were employed for control studies. The immunosensor was incubated with 1 ng mL1 PSA containing different interfering agents such as AFP and CEA. No remarkable change of ECL in intensity was observed in comparison with that in the presence of PSA only. The immunosensor was also incubated with 20 ng mL1 CEA, AFP, Hb solution. Almost no signal change was obtained when compared with the blank. As shown in Fig. 6B, all these results indicated that the proposed immunosensor had a high selectivity.
Fig. 6 (A) The stability of the proposed ECL immunosensor incubated with 1 ng mL1 PSA under consecutive cyclic potential scans for 16 cycles. (B) The selectivity of the proposed ECL immunosensor. (a) Blank, (b) CEA (20 ng mL1), (c) a mixture containing CEA (20 ng mL1), AFP (20 ng mL1), Hb (20 ng mL1), (d) PSA (1 ng mL1), (e) a mixture containing PSA (1 ng mL1), CEA (20 ng mL1), (f) a mixture containing PSA (1 ng mL1), AFP (20 ng mL1) and (g) a mixture containing PSA (1 ng mL1), CEA (20 ng mL1), AFP (20 ng mL1). Scanning from 0.2 to 1.25 V at a scan rate of 100 mV s1.
Analyst, 2014, 139, 5209–5214 | 5213
View Article Online
Analyst Table 1
Paper Recovery results of the proposed immunosensor in human
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
serum
Sample number
Added (ng mL1)
Found (ng mL1)
RSD (%)
Recovery (%)
1 2 3 4 5
0.01 0.10 4.00 20.00 40.00
0.01019 0.1065 3.731 16.78 37.04
0.6879 2.848 1.844 2.298 4.214
100.2 100.6 99.51 99.54 101.8
The reproducibility of the proposed immunosensor for PSA was evaluated by carrying out assays with ve equally prepared electrodes. The relative standard deviation (RSD) of the interassay precision was 1.75%, which was assessed by assaying 0.1 ng mL1 PSA with 5 immunosensors made at the same electrode in batches. Similarly, the intra-assay was 1.50%, which was evaluated from the response to 0.1 ng mL1 CEA at 5 different electrodes in the same batch. Thus, the reproducibility of the proposed immunosensor was satisfying. The feasibility of the proposed ECL immunosensor for clinical applications was monitored by a standard addition method. This experiment was performed by spiking various levels of PSA standards into normal human sera, which were diluted with PBS (0.1 M, pH 7.4) to suitable concentrations. The results showed satisfactory recoveries in the range of 99.5– 101.8% (Table 1), exhibiting a optional scheme for determination of proteins in clinical analysis.
Conclusions In conclusion, a mimic-intramolecular interaction ECL was constructed by combining both the ECL luminophore and coreactant in the supersandwich DNA structure. Compared with those commonly used coreactant ECL systems, the dosage of the coreactant can be signicantly lowered and the preparation process was simpler in mimic-intramolecular interaction ECL. In addition, the employment of the PAMAM dendrimer not only facilitated high-density immobilization of detection antibody and supersandwich DNA structure, but also amplied the ECL signal of Ru(dcbpy)32+. Therefore, this amplication methodology was simple, indicating promising practicability in disease diagnostics.
Acknowledgements This work was nancially supported by the NNSF of China (21275119, 21075100), the Ministry of Education of China (Project 708073), the Natural Science Foundation of Chongqing City (CSTC-2011BA7003), the Specialized Research Fund for the Doctoral Program of Higher Education (20100182110015) and the Postgraduate Science and Technology Innovation Program of Southwest China University (grant no. XDJK2012A004, XDJK2013A008).
5214 | Analyst, 2014, 139, 5209–5214
Notes and references 1 K. N. Swanick, S. Ladouceur, E. Zysman-Colman and Z. F. Ding, Chem. Commun., 2012, 48, 3179–3181; M. M. Richter, Chem. Rev., 2004, 104, 3003. 2 G. M. Nie, Z. M. Bai, W. Y. Yu and J. Chen, Biomacromolecules, 2013, 14, 834. 3 S. G. Sun, Y. Yang, F. Y. Liu, J. L. Fan, J. Kehr, L. C. Sun and X. J. Peng, Dalton Trans., 2010, 39, 8626. 4 S. Y. Deng and H. X. Ju, Analyst, 2013, 138, 43. 5 L. He, K. A. Cox and N. D. Danielson, Anal. Lett., 1990, 23, 195. 6 B. Chen, R. Bautista, K. Yu, G. A. Zapata, M. G. Mulkerrin and S. M. Chamow, Pharm. Res., 2003, 20, 1952. 7 S. G. Sun, Y. Yang, F. Y. Liu, J. L. Fan, X. J. Peng, J. Kehr and L. C. Sun, Dalton Trans., 2009, 38, 7969. 8 S. G. Sun, Y. Yang, F. Y. Liu, Y. Pang, J. L. Fan, L. C. Sun and X. J. Peng, Anal. Chem., 2009, 81, 10227. 9 I. Ocsoy, B. Gulbakan, M. I. Shukoor, X. L. Xiong, T. Chen, D. H. Powell and W. H. Tan, ACS Nano, 2013, 7, 417. 10 J. Zhang, W. P. Zhang, T. Bao and Z. L. Chen, Analyst, 2014, 139, 242. 11 B. Fei, B. T. Qian, Z. Y. Yang, R. H. Wang, W. C. Liu, C. L. Mak and J. H. Xin, Carbon, 2008, 46, 1792. 12 P. Perez-Tejeda, R. Prado-Gotor and E. M. Grueso, Inorg. Chem., 2012, 51, 10825–10831. 13 W. D. Cao, J. P. Ferrance, J. Demas and J. P. Landers, J. Am. Chem. Soc., 2006, 128, 7572. 14 Y. S. Tang, J. W. Gu and J. Kong, J. Xi'an Shiyou Univ., 2009, 24, 67. 15 G. F. Wang, H. Huang, G. Zhang, X. J. Zhang, B. Fang and L. Wang, Langmuir, 2011, 27, 1224. 16 H. Y. Liu, S. M. Xu, Z. M. He, A. P. Deng and J. J. Zhu, Anal. Chem., 2013, 85, 3385. 17 P. Uma Maheswari and M. Palaniandavar, J. Inorg. Biochem., 2004, 98, 219. 18 B. Zhang, B. Q. Liu, D. P. Tang, R. Niessner, G. N. Chen and D. Knopp, Anal. Chem., 2012, 84, 5392. 19 M. K. Nazeeruddin, S. M. Zakeeruddin, R. Humphry-Baker, M. Jirousek, P. Liska, N. Vlachopoulos, V. Shklover, C. H. Fischer and M. Gr¨ atzel, Inorg. Chem., 1999, 38, 6298. 20 S. A. Asher and J. L. Murtaugh, Appl. Spectrosc., 1988, 42, 83. 21 K. Hermann and D. Abeck, J. Chromatogr A, 2001, 750, 71. 22 D. Syamala, V. Rajendran, R. K. Natarajan and S. M. Babu, Cryst. Growth Des., 2007, 7, 1695. 23 M. Zhang, W. J. Dai, M. Yan, S. G. Ge, J. H. Yu, X. R. Song and W. Xu, Analyst, 2012, 137, 2112; A. W. Knight and G. M. Greenway, Analyst, 1996, 121, R101–R106. 24 J. Liu, C. Y. Lu, H. Zhou, J. J. Xu, Z. H. Wang and H. Y. Chen, Chem. Commun., 2013, 49, 6602. 25 C. Li, M. Curreli, H. Lin, B. Lei, F. N. Ishikawa, R. Datar, R. J. Cote, M. E. Thompson and C. W. Zhou, J. Am. Chem. Soc., 2005, 127, 12484. 26 Z. Q. Gao, M. D. Xu, L. Hou, G. N. Chen and D. P. Tang, Anal. Chem., 2013, 85, 6945. 27 P. S. Waggoner, M. Varshney and H. G. Craighead, Lab Chip, 2009, 9, 3095.
This journal is © The Royal Society of Chemistry 2014
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
PAPER
View Journal | View Issue
Cite this: Analyst, 2014, 139, 5209
A supersandwich electrochemiluminescence immunosensor based on mimic-intramolecular interaction for sensitive detection of proteins† Ying He, Yaqin Chai,* Ruo Yuan,* Haijun Wang, Lijuan Bai and Ni Liao An electrochemiluminescence (ECL) immunoassay protocol was developed based on mimicintramolecular interaction for sensitive detection of prostate specific antigen (PSA). It was constructed by integrating
the
ECL
luminophore
(tris(4,40 -dicarboxylicacid-2,20 -bipyridyl)-ruthenium(II)dichloride
(Ru(dcbpy)32+)) and coreactant (histidine) into the supersandwich DNA structure. This strategy was more effective in amplifying the ECL signal by shortening the electronic transmission distance, improving the ECL luminous stability and enhancing the ECL luminous efficiency. The ECL matrices denoted as MWCNTs@PDA–AuNPs were fabricated through spontaneous oxidative polymerization of dopamine (DA) on multiwalled carbon nanotubes (MWCNTs) and reducing HAuCl4 to produce gold nanoparticles (AuNPs) by DA simultaneously. Then, the prepared matrices were applied to bind capture antibodies. Moreover, supersandwich Ab2 bioconjugate was designed using a PAMAM dendrimer to immobilize the detection antibody and supersandwich DNA structure. The PAMAM dendrimer, with a plurality of secondary and tertiary amine groups, not only facilitated high-density immobilization of the detection antibody and supersandwich DNA structure, but also greatly amplified the ECL signal of Ru(dcbpy)32+. Received 3rd June 2014 Accepted 21st July 2014
The supersandwich DNA structure contained multiple Ru(dcbpy)32+ and histidine, further amplifying the ECL signal. The proposed supersandwich immunosensor showed high sensitivity with a detection limit of 4.2 fg mL1 and a wide linear range of 0.01 pg mL1–40.00 ng mL1. With the excellent stability,
DOI: 10.1039/c4an01002g
satisfying precision and reproducibility, the proposed immunosensor indicates promising practicability for
www.rsc.org/analyst
clinical diagnosis.
Introduction Electrochemiluminescence (ECL) involves the generation of species at electrode surfaces followed by electron transfer reactions to form excited states that emit light. Owing to its intrinsic advantages of high sensitivity and wide range of analytes, ECL has received considerable attention in biosensing applications.1 Among the various existing ECL systems, coreactant ECL with the advantages of the highest ECL efficiency, fast response, and favorable compatibility has been used in a wide range of analytical applications, including clinical diagnostics, environmental assays and biowarfare agent detection.2 Tris(4,40 -dicarboxylicacid-2,20 -bipyridyl)-ruthenium(II)dichloride (Ru(dcbpy)32+), due to its low-lying metal-to-ligand charge transfer (MLCT) excited state, wide application range of pH and long excited-state life times, is used as the luminophore here.3
Education Ministry Key Laboratory on Luminescence and Real-Time Analytical Chemistry, College of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715, People's Republic of China. E-mail: [email protected]; [email protected]; Fax: +86-23-68253172; Tel: +86-23-68252277 † Electronic supplementary 10.1039/c4an01002g
information
(ESI)
This journal is © The Royal Society of Chemistry 2014
available.
See
DOI:
Recently, some amine compounds have been developed as coreactants to signicantly enhance the ECL signal of Ru(bpy)32+ and its derivatives.4 Histidine (a-amino-b-(4-imidazolyl) propionic acid) is an a-amino acid with an imidazole group. The signal amplication efficiency of histidine is very high among 21 amino acids.5 Furthermore, a distinct character of histidine is that it can enhance the stability of antibodies.6 All these peculiar and excellent properties allow histidine to serve as an effective coreactant of Ru(dcbpy)32+. Up until now, almost all commercial ECL analytical instruments were based on coreactant ECL, but some disadvantages still exist. In intermolecular interaction ECL, coreactant is usually needed in vast molar excess and is consumed in the oxidation process. The large excess of coreactant also causes some increased background.7 Compared with intermolecular interaction ECL, intramolecular interaction ECL can generate ECL in a much more efficient way, and the dosage of the coreactant can be signicantly lowered.8 However, unfortunately, the synthetic process of the conjugate ruthenium complex in intramolecular interaction ECL is difficult, costly and time-consuming. Nanomaterials are very attractive due to their unique properties in optical, electrical, catalytic and magnetic aspects. Spontaneous self-assembly of polymers incorporating adhesion
Analyst, 2014, 139, 5209–5214 | 5209
View Article Online
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
Analyst
and other functions shows the virtue of integration of individual components, which have potential applications in nanoelectronic devices, nanosensors and catalysts.9 Dopamine (DA), a catecholamine, can be spontaneously polymerized into polydopamine (PDA) and form adhesive coatings on almost all the organic and inorganic surfaces.10 Therefore, MWCNTs are easily coated with the reactive PDA. Moreover, DA has also been used as a reducing agent for the synthesis of noble metal nanoparticles.11 Thus, the ECL matrices MWCNTs@PDA– AuNPs were successfully prepared in this work. The PAMAM dendrimer is a nanoscopic spherical macromolecule with repeating dendritic branching and possesses numerous chain ends that can be easily functionalized. It has been extensively investigated for biomedical applications such as gene therapy, drug delivery and bioimaging purposes. The carboxyl-terminated PAMAM dendrimer is of particular interest because the multiple functional sites available for reaction on its surface facilitates high-density immobilization of antibodies and efficient capture of probe DNA. Moreover, there are a plurality of secondary and tertiary amine groups in the PAMAM dendrimer that can greatly amplify the ECL signal of Ru(dcbpy)32+.12 In this work, a mimic-intramolecular interaction ECL was constructed by the combination of ECL luminophore (Ru(dcbpy)32+) and coreactant (histidine) in the supersandwich DNA structure. The ECL matrices MWCNTs@PDA–AuNPs were used to immobilize capture PSA antibodies (Ab1). When antigens were present, the sandwiched immunocomplex could be formed between the immobilized Ab1 and the supersandwich Ab2 bioconjugates. The supersandwich Ab2 bioconjugates were designed using a PAMAM dendrimer to immobilize detection PSA antibodies (Ab2) and auxiliary probe I (A1). The A1 immediately hybridized to the complementary region on the Ru(dcbpy)32+ modied auxiliary probe II (Ru-A2), and continuous hybridization reactions between alternating histidinemodied auxiliary probe I (His-A1) and Ru-A2 led to long DNA concatamers. As a result, the long DNA concatamers contained multiple Ru-A2 and His-A1. Moreover, this strategy made the electronic transmission distance shorter, resulting in a more effective amplication of the ECL signal.13 Accordingly, we can achieve a simple and ultrasensitive biosensor for protein detection.
Experimental Reagents Prostate specic antigen (PSA) and anti-PSA standard solutions, carcinoembryonic antigen (CEA), and alpha-fetoprotein antigen (AFP) were received from Biocell (Zhengzhou, China). Tris (4,40 -dicarboxylicacid-2,20 -bipyridyl)-ruthenium(II)dichloride (Ru(dcbpy)32+), bovine serum albumin (BSA, 96–99%), N-(3dimethylaminopropyl)-N0 -ethylcarbodiimide hydrochloride (EDC), hemoglobin (Hb), N-hydroxysuccinimide (NHS) and HAuCl4$4H2O were purchased from Sigma-Aldrich (St. Louis, MO, USA). Carboxyl-terminated polyamidoamine (PAMAM) dendrimer G3.5 was purchased from Weihai CY Dendrimer Technology Co., Ltd. (Weihai, China). Multiwalled carbon nanotubes (MWCNTs) (>95% purity) were purchased from
5210 | Analyst, 2014, 139, 5209–5214
Paper
Chengdu Organic Chemicals Co., Ltd. of the Chinese Academy of Science (Chengdu, China). Dopamine (DA) was obtained from Chemical Reagent Co. (Chongqing, China). Histidine was purchased from Kangda Amino Acid (Shanghai, China). Tris(hydroxymethyl)aminomethane (TRIS) was purchased from Roche (Switzerland). Phosphate-buffered solutions (PBS, pH 7.4, 0.1 M) were prepared using 0.1 M Na2HPO4, 0.1 M KH2PO4 and 0.1 M KCl. Ferricyanide solutions (Fe(CN)63/4, 5.0 mM, pH 7.4) were obtained by dissolving potassium ferricyanide and potassium ferrocyanide in PBS (pH 7.4). Auxiliary probe I (A1): 50 –NH2–ACGAAAGATAGCCACTCGTA TTCATCACTGGACCGATACGCGACATATCGTGCCAATTAG-30 and Auxiliary probe II (A2): 50 –NH2–TGACATTTGCTCGATTCCTA TACGAGTGGCTATCTTTCGTCTAATTGGCACGATATGTCG-3 0 were purchased from TaKaRa (Dalian, China). The serum specimens were obtained from Da Ping Hospital (Chongqing, China). All chemicals were analytical grade and used without further purication. The doubly distilled water used was puried through a Millipore system.
Apparatus MPI-A ECL analyzer (Xi'an Remax Electronic Science & Technology Co. Ltd., Xi'an, China) was used to measure the ECL signals with the voltage of the photomultiplier tube (PMT) set at 800 V in the process of detection. Cyclic voltammetry (CV) measurements were carried out with a CHI 600d electrochemistry workstation (Shanghai CH Instruments, China). UV-visible absorption spectra were obtained from a UV-vis spectrophotometer (Lambda 17, Perkin-Elmer, USA). All experiments were performed with a conventional three-electrode system: an Ag/ AgCl (sat. KCl) reference electrode, a platinum wire counter electrode and the modied glassy carbon electrode (GCE) as the working electrode. The morphologies of nanoparticles were estimated from a scanning electron microscope (SEM, S-4800, Hitachi Instrument, Japan).
Preparation of MWCNTs@PDA–AuNPs composites Firstly, MWCNTs were carboxyl-functionalized and shortened by reuxing in a mixture of concentrated H2SO4–HNO3 (1 : 3, v/v) for 40 min at 100 C, followed by washing to neutrality with doubly distilled water.14 The functionalized MWCNTs were coated with PDA as follows: 10.0 mg functionalized MWCNTs were dispersed into 2.0 mg mL1 DA solution (TRIS buffer, pH 8.5) and sonicated for 10 min in an ice water bath. Aer that, the mixtures were incubated in the dark at room temperature for 36 h. The obtained brown suspension was washed with doubly distilled water 3 times to obtain MWCNTs@PDA composites.15 Then, 10 mg of MWCNTs@PDA was added into 10 mL of 1.4 mM HAuCl4 solution. This mixture was mildly stirred at room temperature for 2 h. Then, the resultant reddish-brown precipitate was collected by centrifugation and rinsed with doubly distilled water.16 Fig. 1 shows the scanning electron microscopy (SEM) image of the nanoparticles and Fig. S1† shows the UV-vis absorption spectra of the nanoparticles.
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
Paper
Analyst
SEM images of carboxylic MWCNTs (A), MWCNTs@PDA (B), MWCNTs@PDA–AuNPs and (C).
Fig. 1
Preparation of Ab2–PAMAM–A1 The Ab2–PAMAM–A1 was synthesized briey by the following steps. First, 40 mg EDC and 10 mg NHS were successively added into 2 mL of 0.8 pM PAMAM dendrimer solution to activate the carboxyl groups of the PAMAM dendrimer. EDC and NHS were used as coupling agents, which catalyzed the formation of amide bonds between the carboxyl of the PAMAM dendrimer and the amino of Ab2 and A1. Following that, 100 mL of 17 mM A1 and 200 mL of PSA antibody (Ab2) were added to the solution under continuous and slow stirring for about 2 h at 4 C. Aer the reaction, the unreacted reagents were removed by using a 50 000 molecular weight cut-off dialysis membrane with PBS buffer (0.1 M, pH 7.4) overnight at 4 C. Subsequently, the obtained solution was diluted to 1 mL with PBS buffer (pH 7.4); thus, the Ab2–PAMAM–A1 was obtained. Preparation of supersandwich Ab2 bioconjugates Firstly, 40 mg EDC and 10 mg NHS were successively added into 2 mL of 6.45 mM Ru(dcbpy)32+ solution to activate the carboxyl groups of Ru(dcbpy)32+. Following that, 100 mL of 17.8 mM A2 was added to the solution under continuous and slow stirring at 4 C for about 2 h to form Ru-A2. Superuous Ru(dcbpy)32+ could be removed by washing in the preparation of the immunosensor. Secondly, the carboxyl groups of 2 mL of 6.45 mM histidine solution were activated by the same method. Then, 100 mL of 17 mM A1 was added to the solution under continuous and slow stirring for about 2 h at 4 C to form His-A1. Superuous histidine could be removed by washing in the preparation of the immunosensor. Aer that, Ab2–PAMAM–A1 and RuA2, were mixed with His-A1, and gently stirred at room temperature for 50 min. The resultant complex was centrifuged and washed several times with washing buffer. The obtained supersandwich Ab2 bioconjugates were redispersed in PBS buffer (0.1 M, pH 7.4) and stored at 4 C for further use. Fabrication of the ECL immunosensor The schematic diagram of the preparation of the ECL immunosensor is shown in Scheme 1. Firstly, the GCE (F ¼ 4 mm) was successively polished with 0.3 and 0.05 mm alumina slurry to obtain a mirror-like surface. Then, it was cleaned chemically by immersing it in 8 M HNO3 solution for 30 s. Aer being rinsed thoroughly with water and ethanol in an ultrasonic bath, the GCE was allowed to dry at room temperature.
This journal is © The Royal Society of Chemistry 2014
Scheme 1
The schematic diagrams of the immunosensor.
Subsequently, 5 mL MWCNTs@PDA–AuNPs was coated on the electrode and air-dried at room temperature. Then, 15 mL capture PSA antibody (Ab1) was placed on the electrode surface, and was allowed to incubate for 8 h at 4 C. Next, the immunosensor was thoroughly cleaned with washing buffer to remove the physical adsorbed Ab1, and then incubated with 15 mL BSA (1.0 wt%) solution for 1 h to block the non-specic binding sites on the surface, followed by washing with washing buffer. Ultimately, the obtained immunosensor was stored at 4 C when not in use. Experimental measurements The measurement was based on a sandwich immunoassay method. Before measurement, the proposed immunosensor was incubated with 15 mL PSA standard solutions at different concentrations for 20 min at room temperature. Next, the modied electrode was incubated in supersandwich Ab2 bioconjugates solution for 50 min at room temperature. Finally, the resultant immunosensor was washed by similar washing steps as above and investigated with a MPI-A ECL analyzer in 3 mL PBS buffer (0.1 M, pH 7.4) at room temperature.
Results and discussion Characterization of different nanomaterials Fig. 1 shows the scanning electron microscopy (SEM) images of different nanocomposites. As shown in Fig. 1A, the image of the MWCNTs displayed a well-dispersed tubular structure. Compared with MWCNTs, the surface of MWCNTs@PDA became fatter (Fig. 1B), which indicated that MWCNTs had
Analyst, 2014, 139, 5209–5214 | 5211
View Article Online
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
Analyst
been coated with a PDA lm. Aer being treated with HAuCl4, many bright spots of 25 nm were observed to be adhered individually on nanotubes (Fig. 1C). These bright spots indicated that HAuCl4 was successfully reduced to AuNPs by DA. Furthermore, UV-visible absorption spectroscopy was used to evaluate the surface functionalization by PDA and AuNPs (see ESI, Fig. S1†). By the same token, the characteristics of the as-synthesized supersandwich Ab2 bioconjugates were also investigated (Fig. 2). There was an absorption peak at 260 nm for the prepared Ab2–PAMAM–A1, originating from DNA molecules (Fig. 2(A)).17,18 However, no absorption peak of Ab2 antibodies was observed. The reason might be the fact that the amount of the immobilized antibodies on the PAMAM dendrimer was relatively little. Aer incubation with Ru-A2 and His-A1, three new absorption peaks appeared at 465, 344 and 302 nm, which were attributed to the presence of Ru(dcbpy)32+.19 There was a new absorption peak appeared at 210 nm, which was attributed to the presence of histidine.20–22 Moreover, it can be seen that the absorption peaks increased with the increasing concentration of Ru-A2 and His-A1 (Fig. 2(B)) owing to a consequence of the Ab2–PAMAM–A1 hybridization chain reaction with Ru-A2 and histidine-A1.
Optimization of detection conditions We considered the possible experimental variables that mediated the ECL signal value, including solution pH, immunoreaction time and DNA hybridization reaction time. In the double antibody sandwich-type immunoassays, temperature and time for the antigen–antibody interaction greatly inuenced the sensitivity of the developed immunoassay. Considering the practical application of the proposed immunosensor, all experiments were carried out at room temperature. Following that, the study of pH inuence on the ECL detection was conducted in the range of 5.5–10.0. As shown in the ESI (Fig. S2(A)†), the ECL response gradually increased from pH 5.5 to 7.4, and then changed steadily from 7.4 to 9.0, and subsequently the ECL response rapidly decreased at pH values higher than 9.0. Taking this into consideration, the optimum pH was chosen as 7.4. The reason may be that the highly acidic or alkaline surroundings damaged the immobilized protein and was not favorable to the ECL reaction.23 The immunoreaction
Fig. 2 UV-vis absorption spectra of (A) Ab2–PAMAM–A1 and Ab2– PAMAM–A1–Ru-A2–His-A1; and (B) Ab2–PAMAM–A1 after incubation with various concentrations of Ru-A2 + His-A1 (0.1, 0.3, 0.4, 0.5, and 0.7 mM from bottom to top) for 50 min at room temperature.
5212 | Analyst, 2014, 139, 5209–5214
Paper
time was investigated between 5 and 40 min. As shown in the ESI (Fig. S2(B)†), the ECL response increased with the length of incubation time, and tended to level off aer 20 min. Longer incubation time had no signicant effect on the ECL response.; therefore, the optimum interaction time was considered to be 20 min. The comparison of different Ab2 bioconjugates In order to clarify the mimic-intramolecular ECL mechanism was more efficient than intermolecular, an experiment to compare the luminous efficiency of two immunosensing strategies was designed and conducted. The kinetic behaviors of the modied electrodes (GCE/MWCNTs@PDA–AuNPs/BSA/PSA/ Ab2–PAMAM–A1) were studied by monitoring the ECL response as a function of incubation time with two different mixtures ((a) Ru-A2 + A1 + histidine and (b) Ru-A2 + His-A1). The concentration of histidine in (a) was 6.45 mM, and same amount of histidine was used in the synthetic process of His-A1 (b). As shown in Fig. 3, the ECL response increased with the increasing hybridization reaction time. Compared with (a), the optimal time in (b) appeared earlier, and the ECL signal was much higher. The reason might be the fact that the electronic transmission of the mimic-intramolecular interaction ECL is more effective. Therefore, a reaction time of 50 min was chosen as the optimum reaction time for the hybridization reaction in this experiment. We also explored the effect of the PAMAM dendrimer, histidine and supersandwich structure on the ECL signal (see ESI, Fig. S3†). Characteristics of the ECL immunosensor The fabrication process of the ECL immunosensor was characterized by cyclic voltammogram (CV) experiments. Welldened redox peaks of [Fe(CN)6]3/4 were obtained at bare GCE (Fig. 4, curve a). When MWCNTs@PDA–AuNPs was coated on the electrode, the peak current of the modied electrode decreased a little (curve b), demonstrating that it as an excellent conducting material for accelerating electron transfer. Subsequently, the peak decreased gradually with the immobilizing of
Fig. 3 ECL profiles of GCE/MWCNTs@PDA–AuNPs/BSA/PSA/Ab2– PAMAM–A1 after incubation with (a) Ru-A2 + A1 + histidine and (b) RuA2 + His-A1 as a function of time.
This journal is © The Royal Society of Chemistry 2014
View Article Online
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
Paper
Fig. 4 CVs of (a) the bare GCE; (b) GCE/MWCNTs@PDA–AuNPs; (c) GCE/MWCNTs@PDA–AuNPs/Ab1; (d) GCE/MWCNTs@PDA–AuNPs/ Ab1/PSA; (e) GCE/MWCNTs@ PDA–AuNPs/Ab1/BSA/PSA; and (f) GCE/ MWCNTs@PDA–AuNPs/Ab1/BSA/PSA/Ab2–PAMAM–A1–Ru-A2–HisA1 in 5 mM [Fe(CN)6]3/4 with a scanning potential from 0.2 to 0.6 V and at a scan rate of 100 mV s1.
Ab1 (curve c), BSA (curve d), PSA (curve e), supersandwich Ab2 bioconjugate (curve f), which suggested a big molecular protein retarded the electron transport. To gain a better understanding of the fabrication process, electrochemical impedance spectroscopy (EIS) was also performed at different modied electrodes (see ESI, Fig. S4†). ECL detection of PSA with immunosensor Under the optimal experimental conditions, the sensitivity and the quantitative range of the proposed ECL immunosensor were subjected to solutions with different concentration of PSA. As expected, the intensity of the ECL increased gradually with the increase in the concentration of PSA (Fig. 5, curves a–i). The
ECL profiles of the proposed ECL immunosensor in different concentrations of PSA (ng mL1) (a) 0.00001, (b) 0.0001, (c) 0.001, (d) 0.01, (e) 0.1, (f) 1.0, (g) 4.0, (h) 20 and (i) 40. The inset is the logarithmic calibration curve for PSA detection in PBS (0.1 M, pH 7.4). Fig. 5
This journal is © The Royal Society of Chemistry 2014
Analyst
calibration curve of ECL intensity versus the logarithm of PSA concentrations is presented in the inset of Fig. 3. There was a good linear relationship between ECL intensity and the logarithm of PSA concentrations ranged from 0.01 pg mL1 to 40 ng mL1. The regression equation was I ¼ 1014.1 log cPSA + 5670.3 with a correlation coefficient of 0.9987 (where I is the ECL intensity (a.u.), and cPSA is the concentration of PSA). The amplication factors of this proposed immunosensor may be as follows: rstly, the supersandwich structure can bring numerous histidine and Ru(dcbpy)32+ closer to the electrode surface to produce the signicantly amplied signal; secondly, the PAMAM dendrimer as an excellent coreactant of Ru(dcbpy)32+ facilitated high-density immobilization of Ab2 and A1, which pronouncedly amplied the ECL signal of Ru(dcbpy)32+; thirdly, this strategy made the electronic transmission distance shorter, achieving a more effective amplication of the ECL signal. Thus, the PSA could be detected at levels down to 4.2 fg mL1, which was much lower than those of previous electrochemical (0.14 ng mL1),24 photolithographic (0.25 ng mL1),25 colorimetric (0.03 ng mL1)26 and MEMS (50.0 fg mL1)27 immunoassays.
Stability, selectivity and reproducibility of the immunosensor The ECL intensities of the immunosensor remained at a comparatively stable value (1.0% variation) during consecutive cyclic potential scanning for 16 cycles (Fig. 6A), indicating a good stability for ECL detection. To evaluate the specicity of the detection method, some proteins such as CEA, AFP, Hb were employed for control studies. The immunosensor was incubated with 1 ng mL1 PSA containing different interfering agents such as AFP and CEA. No remarkable change of ECL in intensity was observed in comparison with that in the presence of PSA only. The immunosensor was also incubated with 20 ng mL1 CEA, AFP, Hb solution. Almost no signal change was obtained when compared with the blank. As shown in Fig. 6B, all these results indicated that the proposed immunosensor had a high selectivity.
Fig. 6 (A) The stability of the proposed ECL immunosensor incubated with 1 ng mL1 PSA under consecutive cyclic potential scans for 16 cycles. (B) The selectivity of the proposed ECL immunosensor. (a) Blank, (b) CEA (20 ng mL1), (c) a mixture containing CEA (20 ng mL1), AFP (20 ng mL1), Hb (20 ng mL1), (d) PSA (1 ng mL1), (e) a mixture containing PSA (1 ng mL1), CEA (20 ng mL1), (f) a mixture containing PSA (1 ng mL1), AFP (20 ng mL1) and (g) a mixture containing PSA (1 ng mL1), CEA (20 ng mL1), AFP (20 ng mL1). Scanning from 0.2 to 1.25 V at a scan rate of 100 mV s1.
Analyst, 2014, 139, 5209–5214 | 5213
View Article Online
Analyst Table 1
Paper Recovery results of the proposed immunosensor in human
Published on 21 July 2014. Downloaded by University of Texas Libraries on 19/10/2014 06:00:33.
serum
Sample number
Added (ng mL1)
Found (ng mL1)
RSD (%)
Recovery (%)
1 2 3 4 5
0.01 0.10 4.00 20.00 40.00
0.01019 0.1065 3.731 16.78 37.04
0.6879 2.848 1.844 2.298 4.214
100.2 100.6 99.51 99.54 101.8
The reproducibility of the proposed immunosensor for PSA was evaluated by carrying out assays with ve equally prepared electrodes. The relative standard deviation (RSD) of the interassay precision was 1.75%, which was assessed by assaying 0.1 ng mL1 PSA with 5 immunosensors made at the same electrode in batches. Similarly, the intra-assay was 1.50%, which was evaluated from the response to 0.1 ng mL1 CEA at 5 different electrodes in the same batch. Thus, the reproducibility of the proposed immunosensor was satisfying. The feasibility of the proposed ECL immunosensor for clinical applications was monitored by a standard addition method. This experiment was performed by spiking various levels of PSA standards into normal human sera, which were diluted with PBS (0.1 M, pH 7.4) to suitable concentrations. The results showed satisfactory recoveries in the range of 99.5– 101.8% (Table 1), exhibiting a optional scheme for determination of proteins in clinical analysis.
Conclusions In conclusion, a mimic-intramolecular interaction ECL was constructed by combining both the ECL luminophore and coreactant in the supersandwich DNA structure. Compared with those commonly used coreactant ECL systems, the dosage of the coreactant can be signicantly lowered and the preparation process was simpler in mimic-intramolecular interaction ECL. In addition, the employment of the PAMAM dendrimer not only facilitated high-density immobilization of detection antibody and supersandwich DNA structure, but also amplied the ECL signal of Ru(dcbpy)32+. Therefore, this amplication methodology was simple, indicating promising practicability in disease diagnostics.
Acknowledgements This work was nancially supported by the NNSF of China (21275119, 21075100), the Ministry of Education of China (Project 708073), the Natural Science Foundation of Chongqing City (CSTC-2011BA7003), the Specialized Research Fund for the Doctoral Program of Higher Education (20100182110015) and the Postgraduate Science and Technology Innovation Program of Southwest China University (grant no. XDJK2012A004, XDJK2013A008).
5214 | Analyst, 2014, 139, 5209–5214
Notes and references 1 K. N. Swanick, S. Ladouceur, E. Zysman-Colman and Z. F. Ding, Chem. Commun., 2012, 48, 3179–3181; M. M. Richter, Chem. Rev., 2004, 104, 3003. 2 G. M. Nie, Z. M. Bai, W. Y. Yu and J. Chen, Biomacromolecules, 2013, 14, 834. 3 S. G. Sun, Y. Yang, F. Y. Liu, J. L. Fan, J. Kehr, L. C. Sun and X. J. Peng, Dalton Trans., 2010, 39, 8626. 4 S. Y. Deng and H. X. Ju, Analyst, 2013, 138, 43. 5 L. He, K. A. Cox and N. D. Danielson, Anal. Lett., 1990, 23, 195. 6 B. Chen, R. Bautista, K. Yu, G. A. Zapata, M. G. Mulkerrin and S. M. Chamow, Pharm. Res., 2003, 20, 1952. 7 S. G. Sun, Y. Yang, F. Y. Liu, J. L. Fan, X. J. Peng, J. Kehr and L. C. Sun, Dalton Trans., 2009, 38, 7969. 8 S. G. Sun, Y. Yang, F. Y. Liu, Y. Pang, J. L. Fan, L. C. Sun and X. J. Peng, Anal. Chem., 2009, 81, 10227. 9 I. Ocsoy, B. Gulbakan, M. I. Shukoor, X. L. Xiong, T. Chen, D. H. Powell and W. H. Tan, ACS Nano, 2013, 7, 417. 10 J. Zhang, W. P. Zhang, T. Bao and Z. L. Chen, Analyst, 2014, 139, 242. 11 B. Fei, B. T. Qian, Z. Y. Yang, R. H. Wang, W. C. Liu, C. L. Mak and J. H. Xin, Carbon, 2008, 46, 1792. 12 P. Perez-Tejeda, R. Prado-Gotor and E. M. Grueso, Inorg. Chem., 2012, 51, 10825–10831. 13 W. D. Cao, J. P. Ferrance, J. Demas and J. P. Landers, J. Am. Chem. Soc., 2006, 128, 7572. 14 Y. S. Tang, J. W. Gu and J. Kong, J. Xi'an Shiyou Univ., 2009, 24, 67. 15 G. F. Wang, H. Huang, G. Zhang, X. J. Zhang, B. Fang and L. Wang, Langmuir, 2011, 27, 1224. 16 H. Y. Liu, S. M. Xu, Z. M. He, A. P. Deng and J. J. Zhu, Anal. Chem., 2013, 85, 3385. 17 P. Uma Maheswari and M. Palaniandavar, J. Inorg. Biochem., 2004, 98, 219. 18 B. Zhang, B. Q. Liu, D. P. Tang, R. Niessner, G. N. Chen and D. Knopp, Anal. Chem., 2012, 84, 5392. 19 M. K. Nazeeruddin, S. M. Zakeeruddin, R. Humphry-Baker, M. Jirousek, P. Liska, N. Vlachopoulos, V. Shklover, C. H. Fischer and M. Gr¨ atzel, Inorg. Chem., 1999, 38, 6298. 20 S. A. Asher and J. L. Murtaugh, Appl. Spectrosc., 1988, 42, 83. 21 K. Hermann and D. Abeck, J. Chromatogr A, 2001, 750, 71. 22 D. Syamala, V. Rajendran, R. K. Natarajan and S. M. Babu, Cryst. Growth Des., 2007, 7, 1695. 23 M. Zhang, W. J. Dai, M. Yan, S. G. Ge, J. H. Yu, X. R. Song and W. Xu, Analyst, 2012, 137, 2112; A. W. Knight and G. M. Greenway, Analyst, 1996, 121, R101–R106. 24 J. Liu, C. Y. Lu, H. Zhou, J. J. Xu, Z. H. Wang and H. Y. Chen, Chem. Commun., 2013, 49, 6602. 25 C. Li, M. Curreli, H. Lin, B. Lei, F. N. Ishikawa, R. Datar, R. J. Cote, M. E. Thompson and C. W. Zhou, J. Am. Chem. Soc., 2005, 127, 12484. 26 Z. Q. Gao, M. D. Xu, L. Hou, G. N. Chen and D. P. Tang, Anal. Chem., 2013, 85, 6945. 27 P. S. Waggoner, M. Varshney and H. G. Craighead, Lab Chip, 2009, 9, 3095.
This journal is © The Royal Society of Chemistry 2014
