GENOMICS

11,

751-755

(19%)

SHORT COMMUNICATION A Substitution of Cysteine for Arginine 614 in the Ryanodine Receptor Is Potentially Causative of Human Malignant Hyperthermia ELIZABETH F. GILLARD,* KINYA OTSu,t JUNICHI FuJii,t*’ VIJAY K. KHANNA,t STELLA DE LEoN,t JEANETTE DERDEMEZI,$ BEVERLEY A. BRITT,$ CATHERINE L. DUFF,* RONALD G. WORTON,* AND DAVID H. MAcLmwvt~* *Department of Genetics, Hospital for Sick Children and Department of Medical Genetics, University of Toronto, 555 University Avenue, Toronto, Ontario, Canada M5G 7X8; tanting and Best Department of Medical Research, Charles H. Best Institute, University of Toronto, 172 College Street, Toronto, Ontario, Canada M5G lL6; and *Departments of Anaesthesia and Pharmacology, University of Toronto, CCRW-2834, Toronto General Hospital, 200 Elizabeth Street, Toronto, Ontario, Canada M5G 2C4 Received

May9,

1991;

Press, Inc.

Malignant hyperthermia (MH) is an autosomal dominant neuromuscular disease involving defects in calcium release (Britt, 1989). Exposure of MH-susceptible (MHS) individuals to inhalational anesthetics and skeletal muscle relaxants leads to sustained muscle contraction, a condition dependent on elevated sarcoplasmic free Ca2’. Attendant hypermetabolism, elevated temperature and blood salt, and pH imbalance can result in neurological, liver, and kidney damage and are potentially fatal unless the conditions are reversed. The primary MH defect is believed to lie in hypersensitive gating of the MHS Ca2+ release channels of human and porcine skeletal muscle sarcoplas’ Present address: Department of Biochemistry, Osaka sity Medical School, 2-2 Yamadaoka Suita 565, Japan. * To whom correspondence should be addressed.

June 25, 1991

mic reticulum (ryanodine receptors), since channel opening is facilitated and closing is inhibited (Endo et al., 1983; Ohnishi et aZ., 1983; Fill et aZ., 1990). The RYRl gene encoding the skeletal muscle ryanodine receptor (Zorzato et al., 1990) has been localized to human chromosome 19q13.1 (MacKenzie et aZ., 1990) and linked to mutations causing MH susceptibility in humans (MacLennan et al., 1990). Linkage studies (Harbitz et al., 1990) have also implicated the RYRI gene in the MHS phenotype in swine. We have, therefore, undertaken a systematic search for genetic alteration in the RYRl gene in both pig and human MHS individuals. In a study of MH swine, we found that replacement of Cl843 in the cDNA from an MH normal (MHN) pig with T1843 in the cDNA from an MHS pig was the only nucleotide substitution, of 18 observed, that resulted in an amino acid substitution (Fujii et al., 1991). This base substitution, leading to the replacement of arginine 615 with cysteine, was correlated with and likely to be causative of MH in over 450 animals from six breeds of pigs (maximum lod score of 101.75 at flrmu = 0.0 in 338 informative meioses; Fujii et aZ., 1991; Otsu et al., 1991). By analogy, the corresponding human mutation would be likely to predispose to at least one form of human MH. We now report that the corresponding base substitution and amino acid replacement occurs in a human MH family where its inheritance can be correlated with inheritance of MH susceptibility. We tested for the presence of the potential alteration (C1840-*T) in human genomic DNA by a combination of oligonucleotide probing, restriction endo-

Malignant hyperthermia (MH) is a devastating, potentially lethal response to anesthetics that occurs in genetically predisposed individuals. The skeletal muscle ryanodine receptor (RYRZ) gene has been linked to porcine and human ME. Furthermore, a Cys for Arg substitution tightly linked to, and potentially causative of, porcine MH has been identified in the ryanodine receptor. Analysis of 36 human families predisposed to malignant hyperthermia has revealed the presence, and cosegregation with phenotype, of the corresponding substitution in a single family. This substitution, by analogy to the findings in pig, may be causal for predisposition to MH in this family. o IBW Academic

revised

Univer-

751 All

Copyright 0 1991 rights of reproduction

OSSS-7543/91$3.00 by Academic Press, Inc. in any form reserved.

752

SHORT

A 1808 603

Primer

COMMUNICATION

Primer

1

TGCTCCCTGTGTGTGTGTAATGGTGTGGCTGT C S L C" C N G

Primer3

2

CCRACCAAGATCTTATTACTGAGAACTTGCTGCCTGGCCGTGAGCTTCTGCTGCAGACAAACCTCATCAACTATGTCACCAG Q T N L I NYVT N Q D L I T EN L L P G R E L L L

5’

I

ARG

I CYS

1925 642

A

D

~ H15-T

S

3

T/C

;z1 3’

--

r[I:

5

FIG. 1, (A) Nucleotide and deduced amino acid sequences of part of the exon in which the C1840+T alteration was located. The first line illustrates the location of the nucleotide alteration (boxed), the second and third lines illustrate the normal nucleotide and amino acid sequences numbered according to Zorzato et al. (15), and the fourth line illustrates the alteration in amino acid sequence resulting from the change in codon sequence (boxed). The locations of the forward and reverse primers (primers 1 and 2) used in PCR amplification of the 74-bp sequence surrounding C1840+T are indicated by overlining of the corresponding nucleotide sequences. The location in the nucleotide sequence of the reverse primer (primer 3) used for both amplification and direct sequencing of the 134-bp product is double-overlined. Alteration of the normal sequence GTAC 1840 to the mutant sequence GTAT1840 leads to the deletion of an RsaI restriction endonuclease site. (B) Detection of the C1840+T alteration by oligonucleotide hybridization. The autoradiograph shows the binding of two specific oligonucleotide probes, 17-C(h) and 15-T(h) to a 74-bp PCR-amplified product from genomic DNA of MHS individuals 29-3,15-2,32-3, and 40-4 (from top to bottom). Muscle biopsy contracture test results of these individuals are presented in Table 1. Oligonucleotide probe 17-C(h) detects the DNA sequence encoding arginine; oligonucleotide probe 15-T(h) detects the DNA sequence encoding cysteine. Both probes bind to DNA from individual 32-3 (third from the top) who is heterozygous for the C1840+T substitution. In the experiment of which this illustration forms a part, 14 normal and 15 MH individuals were tested. (C) Detection of the C1840+T alteration by detection of loss of an RsaI restriction endonuclease site in the 74-bp PCR product amplified from genomic DNA of individuals from family 32. Cleavage of the 74-bp product generates 41- and 33-bp fragments. Individuals 32-1,32-2, and 32-3 (lanes l-3) are heterozygous. Individuals 32-5 and 32-4 (lanes 4 and 5) are homozygous for the normal (cleaved) sequence. (D) Detection of the C1840+T alteration by direct sequencing using the reverse primer double-overlined in A. The sequence shown corresponds to the noncoding strand of individuals 32-l to 32-5 (lanes l-5 respectively). The position of C1840+T is indicated by an arrow and the codon corresponding to the substituted cysteine is indicated in bold type.

nuclease digestion, and single- and double-stranded DNA sequencing. Genomic DNA was isolated from blood of MHS and MHN individuals (Miller et al., 1988). A sequence of 74 bp between nucleotides 1808 and 1881 (Fig. 1A) was amplified by the polymerase chain reaction (Saiki et aZ., 1988) for analysis by either oligonucleotide hybridization or RsaI digestion, using 200-500 ng of genomic DNA and 100 ng of each primer. The forward primer (primer 1) (5’-GTTCCCTGTGTGTGTGTGCAATGGTG - 3’) corresponded to human RYRl cDNA nucleotides 1808 to 1831 with two mismatches (underlined) since the primer was of porcine origin; T for C at position 1809 and C for T at position 1824. The last 24 nucleotides of the reverse primer (primer 2) (5’-ATCTCTAGAGCCAGGGAGCAAGTTCTCAGTAAT-3’) were complementary to nucleotides 1858 to 1881 in human RYRl cDNA, while the first nine contained an XbaI restriction endonuclease site that facilitated subcloning. PCR reaction conditions were denaturation at 94°C for 40 s, annealing at 52°C for 2 min, and extension at 72°C for 3 min for 35 cycles with a final cycle of 7 min at 72°C in a DNA thermal cycler (Perkin-

Elmer Cetus) using a Mg2+ concentration of 1.5 mA4 in the buffer provided by Perkin-Elmer Cetus. Alternatively, amplification was performed in the buffer described by Kogan et al. (1987) under the following conditions: ramp to 94°C in 30 s, denaturation at 94°C for 40 s, ramp to 58°C in 30 s, annealing at 58°C for 1 min 30 s, ramp to 72°C in 30 s, and extension at 72°C for 2 min 30 s for 35 cycles with a final cycle of 7 min at 72°C in a DNA thermal cycler (Perkin-Elmer Cetus). For oligonucleotide hybridization analysis, thepresence or absence of the nucleotide substitution in these PCR products was tested by probing with allelespecific oligonucleotides (Fig. 1B). A 17-mer oligonucleotide sequence of the composition 5’-TGGCTGTACGCTCCAAC-3’ (probe 17-C(h)) and a 15-mer oligonucleotide of the composition 5’-GGCTGTATGCTCCAA-3’ (probe 15-T(h)) were synthesized, endlabeled with 32P, and used as hybridization probes to detect the presence of normal and mutant alleles, respectively. These probes were the human analogs of those used successfully for analysis of the corresponding substitution in swine (Fujii et al., 1991). Hy-

SHORT

COMMUNICATION

bridization analysis was as described previously (Fujii et aZ., 1991) except that washing was performed at 59°C for probe 17C(h) and 53’C for probe 15T(h). The restriction endonuclease analysis depended on the observation that the nucleotide substitution altered a restriction site in the DNA. Whereas in the pig the substitution both deletes aHinP1 restriction endonuclease site and creates a HgiAI site (Fujii et al., 1991), in human the alteration of the sequence GTAC1840 to GTAT1840 deletes an RsaI site. Thus digestion of the normal, but not the substituted, 74-bp PCR product with RsaI resulted in products of 41 and 33 bp (Fig. 1C). Restriction analysis was carried out using standard methods and products were separated in 20% polyacrylamide gels. For direct sequencing, a 136-bp product was PCRamplified as described above using the buffer of Kogan et al. (1987), with 100 ng of forward primer 1 and 100 ng of a reverse primer (primer 3) (B-ATCTCTAGACTGGTGGACATAGTTGATGAGG - 3’) (Fig. 1A). The last 24 nucleotides of the reverse primer were complementary to human RYRl cDNA nucleotides 1904 to 1925. The PCR products were purified from agarose according to Heery et al. (1990) and direct sequencing was performed as described by Winship (1989) using reverse primer 3. Screening of MHS and MHN individuals from each of 35 Canadian families predisposed to malignant hyperthermia with the oligonucleotide hybridization and/or RsaI digestion tests led to the identification of three heterozygotes for the C1840+T alteration, all within a single family (Figs. 1B and 1C). Thirty-nine unrelated normal (MHN) individuals were included in this analysis, representing 78 normal (Caucasian) chromosomes, none of which carried the substitution. The substitution in individual 32-3 from the affected family (family 32) was also confirmed by subcloning and single-strand sequencing of nine clones of the 74bp PCR product. Three of the nine clones showed the C to T substitution (data not shown). Further confirmation was provided by direct sequencing of an amplified 136-bp product in all five family members (Figs. 1A and 1D). Individuals 32-1, 32-2, and 32-3 carried the substitution while 32-4 and 32-5 did not. The proband in family 32, a 16-year-old healthy female with no family history of anesthetic problems, had experienced a previous uneventful tonsillectomy with ether as anesthetic. In 1975 she underwent arthroscopy of the right knee for recurrent patella dislocation. Premeditation was with 75 mg Demerol, 25 mg Phenergan, and 0.6 mg atropine; induction was with 250 mg sodium pentothal and 50 mg succinylcholine. Jaw rigidity developed immediately. She was ventilated with 100% 0, and 2% halothane. After 5 min, an additional 30 mg succinylcholine was administered, but masseter spasm continued. Meanwhile, a

753

skin incision had been made. The precordial stethoscope revealed tachycardia and arrhythmia. Halothane was discontinued, therefore, electrocardiogram and temperature monitoring were begun and the surgery was modified. A slight but rapid (0.5”C) increase in temperature was noted, although the electrocardiogram had returned to normal and stayed normal. Anesthesia was maintained with N,O/O, and innovar. Breathing was spontaneous. The remainder of the anesthetic and surgical course, together with testing in the recovery room, were uneventful. Other family members had all undergone previous anesthesia with halothane (but without succinylcholine), apparently without difficulty. Since succinylcholine potentiates halothane contractures in vitro, halothane plus succinylcholine provides a strong trigger that may be required to elicit an MH reaction when the C1840-*T substitution is present in the heterozygous state. Muscle biopsies of the vastus lateralis were performed on all family members during 1975-1977. Caffeine and halothane contracture tests were performed essentially as described previously (MacLennan et al., 1990), but at 22”C, necessitating correction to conform with current standards. The results are summarized in Table 1. The 1% halothane contracture test triggered a contracture in the proband’s sister. The halothane (H) test is the least sensitive test and was performed with 1% halothane rather than the more potent 3% halothane in current use. It is thus not surprising that only one individual was positive for this test. The caffeine (C) contracture test results demonstrate that the proband and her sister are susceptible to MH, her mother is on the borderline between MH susceptible and normal, and her father and brother are normal. The caffeine plus halothane (K) test results in the proband, her mother and her sister, are consistent with susceptibility to MH, whereas the results for her brother are considered normal and for her father indeterminate. The caffeine plus halothane test is the most sensitive, but attempts to define a unique cutoff between susceptible and normal values result in many false positives. It is thus necessary to define an indeterminate range where individuals are best left undefined. The proband’s father falls into this category. An individual is considered susceptible if at least one test is positive. On the basis of the contracture tests, the proband, her mother and sister, are considered to be MH susceptible, and her father and brother to be normal. Thus, the three individuals diagnosed as MH sensitive are the three who have the Cys for Arg substitution. The existence of additional substitutions in this family that may contribute to the phenotype cannot be excluded. No such differences were observed, however, in the RYRl cDNA from an MH pig where the

754

SHORT

COMMUNICATION

TABLE Muscle

Individual 32-l 32-2 32-3 32-4 32-5 29-3 15-2 40-4

(Mother) (Sister) (Proband) (Father) (Brother) (unrelated) (unrelated) (unrelated)

1% Halothane cd 0 0.8 0 0 0 0.4 0 0.6

biopsy

1 contracture

Caffeine ww

(plus

4.05 2.15 3.25 8.75 6.00 3.30 2.35 2.70

test Caffeine halothane) bw 0.13 0.05 0.22 0.39 0.53 0.18 0.08 0.25

Diagnosis

Arg to Cys substitution

(C)K HCK RCK N N HCK CK HCK

Yes Yes Yes No No No No No

Note. Halothane, caffeine, and halothane plus caffeine contracture test results on muscle biopsies are indicated for each member of family 32 plus the three unrelated individuals described in Fig. 1B. Contractures resulting in less than 0.3 g tension in 1% halothane indicate normality (N) and greater than 0.3 g tension indicate susceptibility (H). Recorded doses of caffeine are those required to raise the resting muscle tension by 1 g in the absence or presence of 1% halothane. Doses of greater than 4 mZ~4 caffeine in the caffeine test indicate normality; doses lower than 4 mZkf indicate susceptibility (C). A borderline result is indicated in parentheses. Doses of caffeine greater than 0.5 m&f caffeine in the presence of halothane indicate normality in the caffeine plus halothane test; doses of less than 0.35 mM caffeine in the presence of halothane indicate susceptibility (K), while those between 0.35 and 0.5 mA4 caffeine are considered indeterminate (1, 9). R indicates an MH reaction.

Cys for Arg substitution alone appears to account for the phenotype (F’ujii et al., 1991). In a companion study (Otsu et al., 1991), none of 197 heterozygous (N/n) pigs with the corresponding mutation responded to a halothane challenge in a manner indistinguishable from their homozygous affected (n/n) siblings. By analogy with the MH pig, a human heterozygous for the substitution of Cys for Arg 614 might be predicted to have a mild phenotype with only a rare response to halothane alone, in line with the weak response to halothane observed in family 32. Conversely a human homozygous for the substitution might be predicted to have a more severe phenotype, corresponding to the 94% of n/n pigs that responded to a halothane challenge with fulminant MH (Otsu et al., 1991). Humans with a more severe phenotype, in families with dominant, chromosome 19 linked segregation for predisposition to MH, might be expected to be heterozygous for mutations in the RYRl gene more deleterious than the nucleotide substitution reported here. A major goal in human MH research is development of a noninvasive and accurate test for this genetic disease that can be carried out prior to anesthesia. The first step in the development of such a genetic test is the identification of mutations in the responsible gene. The identification of the Cys for Arg 614 substitution in the ryanodine receptor and its cosegregation with susceptibility to MH provides a strong motive for continuing the detailed systematic search for alterations in the RYRl gene in individuals predisposed to MH, on the assumption that this and other mutations in this gene are a major cause of MH.

ACKNOWLEDGMENTS

corresponding

We are grateful to Dr. P. J. O’Brien for helpful advice and discussion. This work was supported by grants to D.H.M. and R.G.W. from the Muscular Dystrophy Association of Canada (MDAC) and the Medical Research Council of Canada and by a grant to B.A.B. from the Malignant Hyperthermia Association (Canada). J.F. was a Postdoctoral Fellow of the MDAC.

REFERENCES 1.

BRI’IT, B. A. (1989). The North American Caffeine halothane contracture test. In “Malignant Hyperthermia: Current concepts” (M. A. Nalda Fe&e, S. Gottmann, and H. J. Khambatta, Eds.), pp. 53-69. Normed Verlag, Madrid.

2.

ENDO, M., YAGI, S., ISHIZUKA, T., HORIUTI, K., K~GA, Y., AND OMAHA, K. (1983). Changes in the Ca-induced Ca release mechanism in sarcoplasmic reticulum from a patient with malignant hyperthermia. Bhned. Res. 4: 83-92.

3.

FILL, M., CORONADO, R., MICKELEJON, J. R., VIL~EN, J., MA, J., JACOBSON, B. A., AND LOUIS, C. F. (1990). Abnormal ryanodine receptor channels in malignant hyperthermia. Biophys.

J. 60: 471-475. 4.

F~JII, J., OTSU, K., ZOIUATO, F., V. K., WELLER, J., O’BRIEN, P. J., (1991). Identification of a mutation receptor that is associated with Science 253: 448-451.

DE LEON, S., KHANNA, AND MACLENNAN, D. H. in the porcine ryanodine malignant hyperthermia.

5.

HARBITZ, I., CHOWDHARY, B. THOMSEN, P., DAVIES, W., KAIJFMAN, U., KRAN, S., G~~TAv~~oN, I., CHRISTRNSEN, K., AND HAUGE, J. (1990). Assignment of the porcine calcium release channel gene, a candidate for the malignant hyperthermia locus, to the 6pll-q21 segment of chromosome 6.

6.

HEERY, method

Genomics S: 243-248.

7.

D. M., GANNON, F., AND POWELL, R. (1990). A simple for subcloning DNA fragments from gel slices. Trends Genet. B: 173. KOGAN, S. C., DOHERTY, M., AND GITSCHIER, J. (1987). An

SHORT

8.

9.

10. 11.

COMMUNICATION

improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences. N. En@. J. Med. 317: 985-990. MACKENZIE, A. E., KORNELUK, R. G., ZORZATO, F., FUJII, J., PHILLIPS, M., ILES, D., WIERINGA, B., Ln BLOND, S., BAILLY, J., WILLARD, H. F., DUFF, C., WORTON, R. G. AND MAC&NNAN, D. H. (1990). The human ryanodine receptor gene, its mapping to 19q13.1, placement in a chromosome 19 linkage group, and exclusion as the gene causing myotonic dystrophy. Am. J. Hum. Genet. 46: 1082-1089. MACLENNAN, D. H., DUFF, C., ZORZATO, F., FUJII, J., PHILLIPS, M., KORNELUK, R. G., FRODIS, W., BR~I-~, B. A., AND WORTON, R. G. (1990). Ryanodine receptor gene is a candidate for predisposition to malignant hyperthermia. Nature 343: 559-561. MILLER, S. A., DYKES, D. D., AND POLESKY, H. F. (1988). A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16: 1215. OHNISHI, S. T., TAYLOR, S., AND GRONERT, G. A. (1983). Calcium-induced Ca’+ release from sarcoplasmic reticulum of

12.

13.

14. 15.

755

pigs susceptible to malignant hyperthermia. FEBS L.&t. 161: 103-107. OTSU, K., KHANNA, V. K., ARCHIBALD, A. L., AND MACLENNAN, D. H. (1991). Cosegregation of porcine malignant hyperthermia and a probable causal mutation in the skeletal muscle ryanodine receptor gene in backcross families. Gerwmies 11: 744-750. SAIKI, R. K., GELFAND, D. H., STOFFEL, S., SCHARF, S. J., HIGUCHI, R., HORN, G. T., MULLIS, K. B., AM) ERLICH, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-494. WINSHIP, P. R. (1989). An improved method for directly sequencing PCR amplified material using dimethyl sulphoxide. Nucleic Acids Res. 17: 1266. ZORZATO, F., FUJII, J., OTSU, K., PHILLIPS, M., GREEN, N. M., LAI, F. A., MEISSNER, G., AND MACLENNAN, D. H. (1990). Molecular cloning of cDNA encoding human and rabbit forms of the Ca2+ release channel (ryanodine receptor) of skeletal muscle sarcoplasmic reticulum. J. Biol. Chem. 266: 22442256.