ttp://www.bsava.com
CASE REPORT
A skeletal disorder in a dog resembling the Klippel–Feil Syndrome with Sprengel’s Deformity in humans G. Bertolini*, M. Trotta† and M. Caldin‡ *Diagnostic Imaging and Interventional Radiology, ‘San Marco’ Veterinary Clinic, Padova 35143, Italy †Molecular Biology and Genetics, ‘San Marco’ Veterinary Laboratory, Padova 35143, Italy ‡Diagnostic and Interventional Radiology Division, ‘San Marco’ Veterinary Clinic, Padova 35143, Italy
A five-year-old intact male golden retriever dog was evaluated for cervical pain and right hemiparesis. Clinical and computed tomography features suggested a caudal cervical instability and myelopathy due to a cervicoscapular malformation resembling the human Klippel–Feil Syndrome with Sprengel Deformity, a rare complex congenital disorder. Polymerase chain reaction (PCR) and direct sequencing of MEOX1, PAX1 and FGFR3 genes were performed in this dog to investigate a possible underlying genetic predisposition, but no mutations were detected in the coding regions of the three target genes evaluated. Other genes can be involved in this condition in dogs and require further investigation. This report describes a cervical vertebral fusion and complex scapular anomaly in a dog. The presence of an omovertebral bone should be considered in the setting of signs characteristic of myelopathy in dogs with or without obvious skeletal deformity. Journal of Small Animal Practice (2015) 56, 213–217 DOI: 10.1111/jsap.12268 Accepted: 14 July 2014; Published online: 5 September 2014
INTRODUCTION In humans, Klippel–Feil Syndrome (KFS) is defined as a rare skeletal disorder characterised by congenital fusion of any two of the seven cervical vertebrae (Gunderson et al. 1967; Tracy et al. 2004). Cervical vertebral fusion has been rarely described in dogs with disc extrusion (Bagley et al. 1993). Sprengel Deformity (SD) is the most frequently encountered congenital malformation of the scapula in humans (Harvey et al. 2012). In SD, the scapula on one or both sides is underdeveloped and abnormally high because of failure of the scapula to descend during embryonic development from its position in the neck to its normal position. A large fibrous, sometime endocondral so-called omovertebral bone lies in a strong fascial sheath, which extends from the scapula to the spinous processes, lamina or transverse processes of the cervical spine, most commonly at C4 to C7 (Williams 2003; Füllbier et al. 2010; Guillaume et al. 2012; Harvey et al. 2012). In humans, several cases of associated omovertebral bone with SD and KFS have been reported, but the true incidence and aetiology of these conditions is still not fully understood and no definitive disease-causing genes have yet been identified. Genetic mutation have been described and related to KFS based on Journal of Small Animal Practice
•
Vol 56
•
March 2015
•
analysis of mesenchyme homeobox 1 (MEOX1), paired box protein 1 (PAX1) and fibroblast growth factor receptor 3 (FGFR3) genes in humans (Bayrakli et al. 2013; Mohamed et al. 2013). This report describes imaging and genetic findings in a dog with a complex skeletal anomaly resembling an association between KFS and SD of humans.
CASE HISTORIES A five-year-old intact male golden retriever dog was evaluated because a sudden onset of cervical stiffness and abnormal gait. The history revealed that the dog had a right scapula deformity and a right head tilt observed at birth. The owner also reported that another three of six littermates had shown a more severe abnormality, including palatoschisis and rectovaginal fistula, and died after birth. The physical examination of the present dog revealed cervical pain and right-sided hemiparesis. Neurological examination also detected right sided head tilt, decreased postural reactions in both right thoracic and pelvic limbs, absent withdrawal reflex in the right thoracic limb, cervical hyperaesthesia and stiffness with decreased range of cervical rotation,
© 2014 British Small Animal Veterinary Association
213
G. Bertolini et al.
especially towards the right side. Neurological localisation of the lesion was considered likely to be at two different separate sites, in particular the right peripheral vestibular system and right side C6-T2 spinal cord segment. The most likely differential diagnoses for the peripheral vestibular syndrome was a congenital abnormality either in the middle-inner ear structure or vestibular nerve while a congenital abnormality, including vertebral malformation with secondary compressive myelopathy, degenerative disease, including disc disease and Wobbler syndrome, an
inflammatory/infectious disease were considered for the cervical spinal cord localisation. No clinically relevant abnormalities were present on complete blood count (CBC), serum biochemistry, serum protein electrophoresis, haemostasis profile and urinalysis. Once anaesthetised, the dog underwent 16-multidetectorrow computed tomography (CT) examination of brain, cervical spine, thoracic and abdominal evaluation. CT images showed multiple abnormalities of the skull, cervical spine and right scapula. There was an abnormal skull shape,
FIG 1. (A) Volume rendering of the skull (frontal-oblique view) showing the altered shape of the cranial vault. Note the asymmetry, with prominence of the left parietal bone (thick arrow) and the deviation of the sagittal cresta (thin arrow). (B) Thick-slab MIP (maximum intensity projection) of the skull from dorsal-oblique MPR (multiplanar reformation) of the original volume data. Ventral view showing the skull base. Note the asymmetry of the tympanic bullae (TB). Z, zigomatic process of the temporal bone; M, mandibula; B, brain. (C) Transverse view through the middle-inner ear. Note the asymmetry of the petrous part of the temporal bone with cochlear malformation (C) and internal acoustic meatus stenosis (thick arrows). TC, tympanic cavity. The asterisk in the left middle ear indicates the septum bullae. (D) Dorsal-oblique MPR of the inner ear. The right internal acoustic meatus (IAM) has a minor calibre than the left one. TTm, muscle tensor tympani
FIG 2 (A) Transverse view through the first cervical vertebra. Note the incomplete fusion of the vertebral body (arrows). OP, odontoid process of C2. (B) Mid sagittal MPR of the cervical spine. Note the complete fusion between C3 and C4 vertebral bodies and arches (long arrows); the increased space between C2-3 and C4-5; the partial fusion of the ventral portion of the bodies and spinous processes of C5 and C6 vertebras (short arrows). C7 is not visible in this slice, because it is displaced in a dorsal, right-lateral position. (C) Volume rendering of the cervico-thoracic spine, left lateral view, showing the dorsolateral displacement of the seventh cervical vertebra. Note the failure of fusion of the spinous processes of the first two thoracic vertebrae
214
Journal of Small Animal Practice
•
Vol 56
•
March 2015
•
© 2014 British Small Animal Veterinary Association
Cervicoscapular malformation in a dog
with an architectural asymmetry of the calvarium and internal cranial base. In particular, there was a deviation of the petrous part of the temporal bone, with anomalies of the structures forming the right inner ear (Fig 1). The atlas had two large dorsal and ventral clefts that corresponded to the normal positions of
sutures between the halves of the neural arch and the intercentrum. The vertebral arches from C4 to C7 showed failure of midline fusion; C3 and C4 vertebral bodies and arches appeared narrow and completely fused with absence of the articular processes and the intervertebral disc; C5 and C6 vertebral bodies
FIG 3. Volume rendered images of the cervico-thoracic spine of the dog, dorsal and ventral views (A, B). Note the complete fusion of the C3 and C4 vertebrae and the increased space between C4 and C5. The anomaly of the C5 vertebra partially fused with C6 and the dorsal, right-lateral dislocation of C7 leading to a spinal cord (sc) deviation (C). Again, note the incomplete fusion of the C1 vertebral body and the shortening and irregular shape of the second thoracic vertebral body. Transverse views from multiplanar reformation of the original data. (C) Image through the C5-6 intersomatic passage showing the stenosis of the spinal canal with left lateral deviation of the spinal cord (sc). (D) Note the abnormal shape of the vertebra having incomplete left arch and anomalous left arch and spinal process. (E) Anomalous conformation of C7. Note the presence of a sort of an articular process to the omovertebral bone of the scapula (OB)
FIG 4. (A) Volume rendered images of the thoracic spine and scapulae of the dog. The right scapula (rtS) is rotated and displaced medially and cranially respect to the left one (ltS). (B) Note the presence of an omovertebral bone (OB) between the right scapula and the cervico-thoracic columna (dotted area). (C) Thick-slab volume rendering of the caudal cervical spine showing its relationship with the omovertebral bone of the right scapula Journal of Small Animal Practice
•
Vol 56
•
March 2015
•
© 2014 British Small Animal Veterinary Association
215
G. Bertolini et al.
were partially fused through a ventral bony bridge and the arches were fused with each other but incompletely on the midline. There was a partial and asymmetric fusion between the C6 and C7 vertebral bodies with dorsal and right-lateral displacement of C7, resulting in a severe spinal stenosis and deviation (Figs 2 and 3). The right scapula was malpositioned and presented an aberrant bony structure extending from its caudal-medial aspect to C6 and C7 vertebrae (Fig 4). The remainder of the axial and appendicular skeleton was normal. Thorax (lungs and mediastinum) and abdominal scans showed no relevant abnormalities. On the basis of the clinical and imaging features, the diagnosis was of focal cervical compressive myelopathy due to a complex congenital cervicoscapular malformation, including incomplete ossification of the atlas, cervical vertebral fusion and unilateral scapular malformation, resembling KFS and SD in humans. Either conservative or surgical treatments were proposed, including the resection of the omovertebral bone of the scapula and spinal cord decompression. The owner elected for pain relief and strict cage rest, and did not consent to any surgical procedure. The dog demonstrated a rapid improvement and resolution of neurological signs in a few weeks, with exception of the right head tilt. Polymerase chain reaction (PCR) and direct sequencing of MEOX1, PAX1 and FGFR3 genes were performed to investigate a possible underlying genetic predisposition of the KFS-like syndrome in this dog. Genomic DNA was extracted from peripheral blood by using the High Pure Template Preparation Kit (Roche Italia, Milan, Italy). Canis lupus familiaris specific sequence for MEOX1, PAX1 and FGFR3 gene were retrieved from GenBank database (XM_843887, XM;_542866, XM_545926) and the Table 1. PCR primers sequence used for amplification and direct sequencing of MEOX1 gene Exon
Primer name
Primer sequence (5′-3′)
Annealing temperature
Exon 1
EX1 F1 EX1 F2 EX1 R1 EX1 R2 EX1 R3 EX2 F EX2 R EX3 F EX3 R
CTC CCT CTC CTC TCT CAC GTT TTT GAA AAG ACG GAG GCT CA TGT GGC CAG CTA CAC GTA TG GGC CTC TGA GAC AGG GAA GT AAG GTA GCT CCT GCC TTT GA AAG GAA AGG CTG CCC TGA GAA GGT TCA GGG AAG GGA AG GCC TGT GTC TCT GCC TCT CT GGG TAC GGG TCT CAG TCA GT
58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C
Exon 2 Exon 3
Table 2. PCR primers sequence used for amplification and direct sequencing of PAX1 gene Exon
Primer name
Primer sequence (5′-3′)
Annealing temperature
Exon 1
PAX EX1 F1 PAX EX1 F2 PAX EX1 R1 PAX EX1 R2 PAX EX2 F PAX EX2 R PAX EX3 F PAX EX3 R PAX EX4 F PAX EX4 R
CCCGCCTGTTTACTCTCGT CGTTGTACTTGTCGCAGACG TACAACGAGACGGGCTCCAT GAGGAAGATGTGACCCTCCA CTTTGGGCACCTCAGGAGT GGC GAG TCT TCC CTT CTC TT ACACGGGGATTCCCTAGC CTCTCTCTGCCACCTCGTC CCGGCTTCTTTCTTTAGCC TGCCCCTAGGAGGTGGAG
58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C
Exon 2 Exon 3 Exon 4
216
Table 3. PCR primers sequence used for amplification and direct sequencing of FGFR3 gene Primer name FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3
F1 R1 F2 R2 F3 R3 F4 R4 F5 R5 F6 R6 F7 R7 F8 R8 F9 R9 F10 R10 F11 R11 F12 R12
Primer sequence (5′-3′)
Annealing temperature
AGCCACATGTGAGGAAGGTC GACACCCACCGTCTCACC GTGAGACGGTGGGTGTCC CCGCTGAATGACACACACAT AGCACTGTGGGTCCTAGACG TCATACCTGCAGCACAGAGG GTGATTCTGGGACCATCGAG AGTGTACGTCTGCCGGATG AGCAGTGGAGCCTGGTCAT TACCACTTCTCCCCTGATGG ACACCCCCTTCTCCATTCTC CATGGCCAGGGCAAAGAG CTGGCGTCTCAGTCCCTTT CCCCAGGCCTAAGACACC CAAGCAGGTGTCCTTGGAGT CAGCACACATGGTCACATCA AGAGACCACCCAGGACAGG GCATACTCCACCAGCACGTA CTGGTGTCCTGTGCCTATCA CACATCACTCTGGTGGGTGT TCTCCATGGGGTCTGTTCA GAGTGCTCAGAAGGGGACTG AGGGTCATGGGAGGCAGT CACACCACCAGCAGCATAGT
58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C
primer design for PCR and direct sequencing was performed by using Primer3Software (Tables 1–3). The positive samples obtained by PCR were submitted for direct sequencing. No mutations were detected on the coding regions of the three target genes evaluated.
DISCUSSION This report describes a cervical vertebral fusion and complex scapular anomaly in a dog, with the presence of an omovertebral bone. From the clinical point of view, human patients with KFS and cervical stenosis may be at increased risk of sustaining a transient neurologic deficit after minor trauma. This is thought to be related to the fused segments and the resultant altered mechanical force transfer that makes the adjacent non-fused segments excessively mobile (Vaidyanathan et al. 2002; Adeleye et al. 2010; Füllbier et al. 2010). A similar mechanism has been hypothesised in dogs with cervical vertebral fusion previously reported (Bagley et al. 1993). In this dog, it was presumed that both the vertebral fusion with spinal canal deviation and stenosis and a possible cervical instability due to the complex cervicoscapular malformation might have contributed to the cervical spine injury and transient myelopathy. KFS and SD are often observed in association with each other and can be accompanied in varying degrees with other osseous or extra-osseous defects, including scoliosis, hemivertebrae, spina bifida, clavicular abnormalities, urogenital, cardiac, neurological, auditory, hindbrain, ocular, craniofacial, otolaryngeal, limb and digital anomalies (Williams 2003; Tracy et al. 2004; Harvey et al. 2012). In this case, other skeletal anomalies were found;
Journal of Small Animal Practice
•
Vol 56
•
March 2015
•
© 2014 British Small Animal Veterinary Association
Cervicoscapular malformation in a dog
an incomplete ossification of the atlas, cervico-thoracic scoliosis, and asymmetry of the basicranium with defective right inner ear osseous structures. The incomplete ossification of the atlas in dogs has been described with and without atlantoaxial subluxation and neurological signs (Lin et al. 2009; Warren-Smith et al. 2009; Parry et al. 2010). In this dog, there were no neurological signs related to craniocervical instability. Interestingly, as in this case, craniocervical junction anomalies have been recently reported in association with KFS in humans (Dilettoso 2012). In this dog, the petrous portion of the temporal bone asymmetries and right inner ear anomaly were noted, explaining the vestibular syndrome present from birth. Up to 50% of human patients with SD have hearing deficits which may be conductive, sensorineural, or mixed. Affected individuals may have microtia, stenosis of the external ear canal, malformation of ossicles, tympanic cavity or temporal bones, inner ear dysplasia, deformed internal acoustic canal or wide vestibular aqueduct (Yildirim et al. 2008). External and middle ear anomalies were not found at clinical and imaging evaluations of this case. Auditory tests were not performed to evaluate possible congenital deafness or minor auditory impairments. The dog had cervical occulta spina bifida, with non-union of the dorsal part of the vertebral arches and spinal processes from C4 to C7. Spina bifida has been described in association with KFS in humans, and has been very rarely described in the cervical spine of dogs (Furneaux et al. 1973; Arias et al. 2008). In a relatively recent report, a case series of dogs with manifesta or occulta spina bifida was reported and one of these dogs also had blocked thoracic vertebrae on necroscopy (Arias et al. 2008). A possible familial inheritance could be speculated in this case because of the family history, with several birth defects noted in the other littermates. Three different genes for detecting possible mutations causing KFS have been evaluated but none were detected. However, other genes may be involved in KFS in dogs and require further investigation. Clinically, an omovertebral bone with KFS-like syndrome should also be considered in cases with signs characteristic of myelopathy with or without obvious skeletal deformity. For such cases, further evaluations are warranted, including magnetic resonance imaging and cerebrospinal fluid examinations, to rule out other causes of myelopathy. Early diagnosis may prevent serious neurological damage. Imaging plays an essential role in detecting
Journal of Small Animal Practice
•
Vol 56
•
March 2015
•
the omovertebral bone and severe vertebral bone abnormalities that are often associated with it. Conflict of interest None of the authors of this article has a financial or personal relationship with other people or organisations that could inappropriately influence or bias the content of the paper. References Adeleye, A. O. & Akinyemi, R. O. (2010) Cervical Klippel-Feil syndrome predisposing an elderly African man to central cord myelopathy following minor trauma. African Health Science 10, 302-304 Arias, M. V. B., Marcasso, R. A., Margalho, F. N., et al. (2008) Spina bifida in three dogs. Brazilian Journal of Veterinary Pathology 1, 64-69 Bagley, R. S., Forrest, L. J., Cauzinille, L., et al. (1993) Cervical vertebral fusion and concurrent intervertebral disc extrusion in four dogs. Veterinary Radiology & Ultrasound 34, 336-339 Bayrakli, F., Guclu, B., Yakicier, C., et al. (2013) Mutation in MEOX1 gene causes a recessive Klippel-Feil syndrome subtype. BioMedCentral Genetic 14, 95 Dilettoso, S., Uccello, M., Dilettoso, A., et al. (2012) Duplicated odontoid process and atlas clefts associated to Klippel-Feil syndrome. Spine Journal 12, 449-450 Füllbier, L., Tanner, P., Henkes, H., et al. (2010). Omovertebral bone associated with Sprengel deformity and Klippel-Feil syndrome leading to cervical myelopathy. Journal of Neurosurgery: Spine 13, 224-228 Furneaux, R. W., Doige, C. E. & Kaye, M. M. (1973) syringomyelia and spina bifida occulta in a Samoyed dog. Canadian Veterinary Journal 14, 317-321 Guillaume, R., Nectoux, E., Bigot, J., et al. (2012) Congenital high scapula (Sprengel’s deformity): four cases. Diagnostic and Interventional Imaging 93, 878-883 Gunderson, C. H., Greenspan, R. H., Glaser, G. H., et al. (1967) The Klippel-Feil syndrome: genetic and clinical re-evaluation of cervical fusion. Medicine 46, 491-512 Harvey, E. J., Bernstein, M., Desy, N. M. et al. (2012) Sprengel deformity: pathogenesis and management. Journal of American Academy of Orthopeadic Surgeons 20, 177-186 Lin, J. L. & Coolman, B. R. (2009) Atlantoaxial subluxation in two dogs with cervical block vertebrae. Journal of American Animal Hospital Association 45, 305-310 Mohamed, J. Y., Faqeih, E., Alsiddiky, A., et al. (2013) Mutations in MEOX1, encoding mesenchyme homeobox 1, cause Klippel-Feil anomaly. American Journal of Human Genetic 92, 157-161 Parry, A. T., Upjohn, M. M., Schlegl, K., et al. (2010) Computed tomography variations in morphology of the canine atlas in dogs with and without atlantoaxial subluxation. Veterinary Radiology & Ultrasound 51, 596-600 Tracy, M. R., Dormans, J. P. & Kusumi, K. (2004) Klippel-Feil syndrome: clinical features and current understanding of etiology. Clinic Orthopeadics and Relative Research. 424, 183-190 Vaidyanathan, S., Hughes, P. L., Soni, B. M., et al. (2002) Klippel-Feil syndrome – the risk of cervical spinal cord injury: a case report. BioMedCentral Family Practice 3, 6 Warren-Smith, C. M., Kneissl, S., Benigni, L., et al. (2009) Incomplete ossification of the atlas in dogs with cervical signs. Veterinary Radiology & Ultrasound 50, 635-638 Williams, M. S. (2003) Developmental anomalies of the scapula-the “omo”st forgotten bone. American Journal of Medical Genetics 120A, 583-587 Yildirim, N., Arslanoglu, A., Mahirogullari, M., et al. (2008) Klippel–Feil syndrome and associated ear anomalies. American Journal of Otolaryngology 29, 319-325
© 2014 British Small Animal Veterinary Association
217
CASE REPORT
A skeletal disorder in a dog resembling the Klippel–Feil Syndrome with Sprengel’s Deformity in humans G. Bertolini*, M. Trotta† and M. Caldin‡ *Diagnostic Imaging and Interventional Radiology, ‘San Marco’ Veterinary Clinic, Padova 35143, Italy †Molecular Biology and Genetics, ‘San Marco’ Veterinary Laboratory, Padova 35143, Italy ‡Diagnostic and Interventional Radiology Division, ‘San Marco’ Veterinary Clinic, Padova 35143, Italy
A five-year-old intact male golden retriever dog was evaluated for cervical pain and right hemiparesis. Clinical and computed tomography features suggested a caudal cervical instability and myelopathy due to a cervicoscapular malformation resembling the human Klippel–Feil Syndrome with Sprengel Deformity, a rare complex congenital disorder. Polymerase chain reaction (PCR) and direct sequencing of MEOX1, PAX1 and FGFR3 genes were performed in this dog to investigate a possible underlying genetic predisposition, but no mutations were detected in the coding regions of the three target genes evaluated. Other genes can be involved in this condition in dogs and require further investigation. This report describes a cervical vertebral fusion and complex scapular anomaly in a dog. The presence of an omovertebral bone should be considered in the setting of signs characteristic of myelopathy in dogs with or without obvious skeletal deformity. Journal of Small Animal Practice (2015) 56, 213–217 DOI: 10.1111/jsap.12268 Accepted: 14 July 2014; Published online: 5 September 2014
INTRODUCTION In humans, Klippel–Feil Syndrome (KFS) is defined as a rare skeletal disorder characterised by congenital fusion of any two of the seven cervical vertebrae (Gunderson et al. 1967; Tracy et al. 2004). Cervical vertebral fusion has been rarely described in dogs with disc extrusion (Bagley et al. 1993). Sprengel Deformity (SD) is the most frequently encountered congenital malformation of the scapula in humans (Harvey et al. 2012). In SD, the scapula on one or both sides is underdeveloped and abnormally high because of failure of the scapula to descend during embryonic development from its position in the neck to its normal position. A large fibrous, sometime endocondral so-called omovertebral bone lies in a strong fascial sheath, which extends from the scapula to the spinous processes, lamina or transverse processes of the cervical spine, most commonly at C4 to C7 (Williams 2003; Füllbier et al. 2010; Guillaume et al. 2012; Harvey et al. 2012). In humans, several cases of associated omovertebral bone with SD and KFS have been reported, but the true incidence and aetiology of these conditions is still not fully understood and no definitive disease-causing genes have yet been identified. Genetic mutation have been described and related to KFS based on Journal of Small Animal Practice
•
Vol 56
•
March 2015
•
analysis of mesenchyme homeobox 1 (MEOX1), paired box protein 1 (PAX1) and fibroblast growth factor receptor 3 (FGFR3) genes in humans (Bayrakli et al. 2013; Mohamed et al. 2013). This report describes imaging and genetic findings in a dog with a complex skeletal anomaly resembling an association between KFS and SD of humans.
CASE HISTORIES A five-year-old intact male golden retriever dog was evaluated because a sudden onset of cervical stiffness and abnormal gait. The history revealed that the dog had a right scapula deformity and a right head tilt observed at birth. The owner also reported that another three of six littermates had shown a more severe abnormality, including palatoschisis and rectovaginal fistula, and died after birth. The physical examination of the present dog revealed cervical pain and right-sided hemiparesis. Neurological examination also detected right sided head tilt, decreased postural reactions in both right thoracic and pelvic limbs, absent withdrawal reflex in the right thoracic limb, cervical hyperaesthesia and stiffness with decreased range of cervical rotation,
© 2014 British Small Animal Veterinary Association
213
G. Bertolini et al.
especially towards the right side. Neurological localisation of the lesion was considered likely to be at two different separate sites, in particular the right peripheral vestibular system and right side C6-T2 spinal cord segment. The most likely differential diagnoses for the peripheral vestibular syndrome was a congenital abnormality either in the middle-inner ear structure or vestibular nerve while a congenital abnormality, including vertebral malformation with secondary compressive myelopathy, degenerative disease, including disc disease and Wobbler syndrome, an
inflammatory/infectious disease were considered for the cervical spinal cord localisation. No clinically relevant abnormalities were present on complete blood count (CBC), serum biochemistry, serum protein electrophoresis, haemostasis profile and urinalysis. Once anaesthetised, the dog underwent 16-multidetectorrow computed tomography (CT) examination of brain, cervical spine, thoracic and abdominal evaluation. CT images showed multiple abnormalities of the skull, cervical spine and right scapula. There was an abnormal skull shape,
FIG 1. (A) Volume rendering of the skull (frontal-oblique view) showing the altered shape of the cranial vault. Note the asymmetry, with prominence of the left parietal bone (thick arrow) and the deviation of the sagittal cresta (thin arrow). (B) Thick-slab MIP (maximum intensity projection) of the skull from dorsal-oblique MPR (multiplanar reformation) of the original volume data. Ventral view showing the skull base. Note the asymmetry of the tympanic bullae (TB). Z, zigomatic process of the temporal bone; M, mandibula; B, brain. (C) Transverse view through the middle-inner ear. Note the asymmetry of the petrous part of the temporal bone with cochlear malformation (C) and internal acoustic meatus stenosis (thick arrows). TC, tympanic cavity. The asterisk in the left middle ear indicates the septum bullae. (D) Dorsal-oblique MPR of the inner ear. The right internal acoustic meatus (IAM) has a minor calibre than the left one. TTm, muscle tensor tympani
FIG 2 (A) Transverse view through the first cervical vertebra. Note the incomplete fusion of the vertebral body (arrows). OP, odontoid process of C2. (B) Mid sagittal MPR of the cervical spine. Note the complete fusion between C3 and C4 vertebral bodies and arches (long arrows); the increased space between C2-3 and C4-5; the partial fusion of the ventral portion of the bodies and spinous processes of C5 and C6 vertebras (short arrows). C7 is not visible in this slice, because it is displaced in a dorsal, right-lateral position. (C) Volume rendering of the cervico-thoracic spine, left lateral view, showing the dorsolateral displacement of the seventh cervical vertebra. Note the failure of fusion of the spinous processes of the first two thoracic vertebrae
214
Journal of Small Animal Practice
•
Vol 56
•
March 2015
•
© 2014 British Small Animal Veterinary Association
Cervicoscapular malformation in a dog
with an architectural asymmetry of the calvarium and internal cranial base. In particular, there was a deviation of the petrous part of the temporal bone, with anomalies of the structures forming the right inner ear (Fig 1). The atlas had two large dorsal and ventral clefts that corresponded to the normal positions of
sutures between the halves of the neural arch and the intercentrum. The vertebral arches from C4 to C7 showed failure of midline fusion; C3 and C4 vertebral bodies and arches appeared narrow and completely fused with absence of the articular processes and the intervertebral disc; C5 and C6 vertebral bodies
FIG 3. Volume rendered images of the cervico-thoracic spine of the dog, dorsal and ventral views (A, B). Note the complete fusion of the C3 and C4 vertebrae and the increased space between C4 and C5. The anomaly of the C5 vertebra partially fused with C6 and the dorsal, right-lateral dislocation of C7 leading to a spinal cord (sc) deviation (C). Again, note the incomplete fusion of the C1 vertebral body and the shortening and irregular shape of the second thoracic vertebral body. Transverse views from multiplanar reformation of the original data. (C) Image through the C5-6 intersomatic passage showing the stenosis of the spinal canal with left lateral deviation of the spinal cord (sc). (D) Note the abnormal shape of the vertebra having incomplete left arch and anomalous left arch and spinal process. (E) Anomalous conformation of C7. Note the presence of a sort of an articular process to the omovertebral bone of the scapula (OB)
FIG 4. (A) Volume rendered images of the thoracic spine and scapulae of the dog. The right scapula (rtS) is rotated and displaced medially and cranially respect to the left one (ltS). (B) Note the presence of an omovertebral bone (OB) between the right scapula and the cervico-thoracic columna (dotted area). (C) Thick-slab volume rendering of the caudal cervical spine showing its relationship with the omovertebral bone of the right scapula Journal of Small Animal Practice
•
Vol 56
•
March 2015
•
© 2014 British Small Animal Veterinary Association
215
G. Bertolini et al.
were partially fused through a ventral bony bridge and the arches were fused with each other but incompletely on the midline. There was a partial and asymmetric fusion between the C6 and C7 vertebral bodies with dorsal and right-lateral displacement of C7, resulting in a severe spinal stenosis and deviation (Figs 2 and 3). The right scapula was malpositioned and presented an aberrant bony structure extending from its caudal-medial aspect to C6 and C7 vertebrae (Fig 4). The remainder of the axial and appendicular skeleton was normal. Thorax (lungs and mediastinum) and abdominal scans showed no relevant abnormalities. On the basis of the clinical and imaging features, the diagnosis was of focal cervical compressive myelopathy due to a complex congenital cervicoscapular malformation, including incomplete ossification of the atlas, cervical vertebral fusion and unilateral scapular malformation, resembling KFS and SD in humans. Either conservative or surgical treatments were proposed, including the resection of the omovertebral bone of the scapula and spinal cord decompression. The owner elected for pain relief and strict cage rest, and did not consent to any surgical procedure. The dog demonstrated a rapid improvement and resolution of neurological signs in a few weeks, with exception of the right head tilt. Polymerase chain reaction (PCR) and direct sequencing of MEOX1, PAX1 and FGFR3 genes were performed to investigate a possible underlying genetic predisposition of the KFS-like syndrome in this dog. Genomic DNA was extracted from peripheral blood by using the High Pure Template Preparation Kit (Roche Italia, Milan, Italy). Canis lupus familiaris specific sequence for MEOX1, PAX1 and FGFR3 gene were retrieved from GenBank database (XM_843887, XM;_542866, XM_545926) and the Table 1. PCR primers sequence used for amplification and direct sequencing of MEOX1 gene Exon
Primer name
Primer sequence (5′-3′)
Annealing temperature
Exon 1
EX1 F1 EX1 F2 EX1 R1 EX1 R2 EX1 R3 EX2 F EX2 R EX3 F EX3 R
CTC CCT CTC CTC TCT CAC GTT TTT GAA AAG ACG GAG GCT CA TGT GGC CAG CTA CAC GTA TG GGC CTC TGA GAC AGG GAA GT AAG GTA GCT CCT GCC TTT GA AAG GAA AGG CTG CCC TGA GAA GGT TCA GGG AAG GGA AG GCC TGT GTC TCT GCC TCT CT GGG TAC GGG TCT CAG TCA GT
58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C
Exon 2 Exon 3
Table 2. PCR primers sequence used for amplification and direct sequencing of PAX1 gene Exon
Primer name
Primer sequence (5′-3′)
Annealing temperature
Exon 1
PAX EX1 F1 PAX EX1 F2 PAX EX1 R1 PAX EX1 R2 PAX EX2 F PAX EX2 R PAX EX3 F PAX EX3 R PAX EX4 F PAX EX4 R
CCCGCCTGTTTACTCTCGT CGTTGTACTTGTCGCAGACG TACAACGAGACGGGCTCCAT GAGGAAGATGTGACCCTCCA CTTTGGGCACCTCAGGAGT GGC GAG TCT TCC CTT CTC TT ACACGGGGATTCCCTAGC CTCTCTCTGCCACCTCGTC CCGGCTTCTTTCTTTAGCC TGCCCCTAGGAGGTGGAG
58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C
Exon 2 Exon 3 Exon 4
216
Table 3. PCR primers sequence used for amplification and direct sequencing of FGFR3 gene Primer name FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3 FGFR3
F1 R1 F2 R2 F3 R3 F4 R4 F5 R5 F6 R6 F7 R7 F8 R8 F9 R9 F10 R10 F11 R11 F12 R12
Primer sequence (5′-3′)
Annealing temperature
AGCCACATGTGAGGAAGGTC GACACCCACCGTCTCACC GTGAGACGGTGGGTGTCC CCGCTGAATGACACACACAT AGCACTGTGGGTCCTAGACG TCATACCTGCAGCACAGAGG GTGATTCTGGGACCATCGAG AGTGTACGTCTGCCGGATG AGCAGTGGAGCCTGGTCAT TACCACTTCTCCCCTGATGG ACACCCCCTTCTCCATTCTC CATGGCCAGGGCAAAGAG CTGGCGTCTCAGTCCCTTT CCCCAGGCCTAAGACACC CAAGCAGGTGTCCTTGGAGT CAGCACACATGGTCACATCA AGAGACCACCCAGGACAGG GCATACTCCACCAGCACGTA CTGGTGTCCTGTGCCTATCA CACATCACTCTGGTGGGTGT TCTCCATGGGGTCTGTTCA GAGTGCTCAGAAGGGGACTG AGGGTCATGGGAGGCAGT CACACCACCAGCAGCATAGT
58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C 58°C
primer design for PCR and direct sequencing was performed by using Primer3Software (Tables 1–3). The positive samples obtained by PCR were submitted for direct sequencing. No mutations were detected on the coding regions of the three target genes evaluated.
DISCUSSION This report describes a cervical vertebral fusion and complex scapular anomaly in a dog, with the presence of an omovertebral bone. From the clinical point of view, human patients with KFS and cervical stenosis may be at increased risk of sustaining a transient neurologic deficit after minor trauma. This is thought to be related to the fused segments and the resultant altered mechanical force transfer that makes the adjacent non-fused segments excessively mobile (Vaidyanathan et al. 2002; Adeleye et al. 2010; Füllbier et al. 2010). A similar mechanism has been hypothesised in dogs with cervical vertebral fusion previously reported (Bagley et al. 1993). In this dog, it was presumed that both the vertebral fusion with spinal canal deviation and stenosis and a possible cervical instability due to the complex cervicoscapular malformation might have contributed to the cervical spine injury and transient myelopathy. KFS and SD are often observed in association with each other and can be accompanied in varying degrees with other osseous or extra-osseous defects, including scoliosis, hemivertebrae, spina bifida, clavicular abnormalities, urogenital, cardiac, neurological, auditory, hindbrain, ocular, craniofacial, otolaryngeal, limb and digital anomalies (Williams 2003; Tracy et al. 2004; Harvey et al. 2012). In this case, other skeletal anomalies were found;
Journal of Small Animal Practice
•
Vol 56
•
March 2015
•
© 2014 British Small Animal Veterinary Association
Cervicoscapular malformation in a dog
an incomplete ossification of the atlas, cervico-thoracic scoliosis, and asymmetry of the basicranium with defective right inner ear osseous structures. The incomplete ossification of the atlas in dogs has been described with and without atlantoaxial subluxation and neurological signs (Lin et al. 2009; Warren-Smith et al. 2009; Parry et al. 2010). In this dog, there were no neurological signs related to craniocervical instability. Interestingly, as in this case, craniocervical junction anomalies have been recently reported in association with KFS in humans (Dilettoso 2012). In this dog, the petrous portion of the temporal bone asymmetries and right inner ear anomaly were noted, explaining the vestibular syndrome present from birth. Up to 50% of human patients with SD have hearing deficits which may be conductive, sensorineural, or mixed. Affected individuals may have microtia, stenosis of the external ear canal, malformation of ossicles, tympanic cavity or temporal bones, inner ear dysplasia, deformed internal acoustic canal or wide vestibular aqueduct (Yildirim et al. 2008). External and middle ear anomalies were not found at clinical and imaging evaluations of this case. Auditory tests were not performed to evaluate possible congenital deafness or minor auditory impairments. The dog had cervical occulta spina bifida, with non-union of the dorsal part of the vertebral arches and spinal processes from C4 to C7. Spina bifida has been described in association with KFS in humans, and has been very rarely described in the cervical spine of dogs (Furneaux et al. 1973; Arias et al. 2008). In a relatively recent report, a case series of dogs with manifesta or occulta spina bifida was reported and one of these dogs also had blocked thoracic vertebrae on necroscopy (Arias et al. 2008). A possible familial inheritance could be speculated in this case because of the family history, with several birth defects noted in the other littermates. Three different genes for detecting possible mutations causing KFS have been evaluated but none were detected. However, other genes may be involved in KFS in dogs and require further investigation. Clinically, an omovertebral bone with KFS-like syndrome should also be considered in cases with signs characteristic of myelopathy with or without obvious skeletal deformity. For such cases, further evaluations are warranted, including magnetic resonance imaging and cerebrospinal fluid examinations, to rule out other causes of myelopathy. Early diagnosis may prevent serious neurological damage. Imaging plays an essential role in detecting
Journal of Small Animal Practice
•
Vol 56
•
March 2015
•
the omovertebral bone and severe vertebral bone abnormalities that are often associated with it. Conflict of interest None of the authors of this article has a financial or personal relationship with other people or organisations that could inappropriately influence or bias the content of the paper. References Adeleye, A. O. & Akinyemi, R. O. (2010) Cervical Klippel-Feil syndrome predisposing an elderly African man to central cord myelopathy following minor trauma. African Health Science 10, 302-304 Arias, M. V. B., Marcasso, R. A., Margalho, F. N., et al. (2008) Spina bifida in three dogs. Brazilian Journal of Veterinary Pathology 1, 64-69 Bagley, R. S., Forrest, L. J., Cauzinille, L., et al. (1993) Cervical vertebral fusion and concurrent intervertebral disc extrusion in four dogs. Veterinary Radiology & Ultrasound 34, 336-339 Bayrakli, F., Guclu, B., Yakicier, C., et al. (2013) Mutation in MEOX1 gene causes a recessive Klippel-Feil syndrome subtype. BioMedCentral Genetic 14, 95 Dilettoso, S., Uccello, M., Dilettoso, A., et al. (2012) Duplicated odontoid process and atlas clefts associated to Klippel-Feil syndrome. Spine Journal 12, 449-450 Füllbier, L., Tanner, P., Henkes, H., et al. (2010). Omovertebral bone associated with Sprengel deformity and Klippel-Feil syndrome leading to cervical myelopathy. Journal of Neurosurgery: Spine 13, 224-228 Furneaux, R. W., Doige, C. E. & Kaye, M. M. (1973) syringomyelia and spina bifida occulta in a Samoyed dog. Canadian Veterinary Journal 14, 317-321 Guillaume, R., Nectoux, E., Bigot, J., et al. (2012) Congenital high scapula (Sprengel’s deformity): four cases. Diagnostic and Interventional Imaging 93, 878-883 Gunderson, C. H., Greenspan, R. H., Glaser, G. H., et al. (1967) The Klippel-Feil syndrome: genetic and clinical re-evaluation of cervical fusion. Medicine 46, 491-512 Harvey, E. J., Bernstein, M., Desy, N. M. et al. (2012) Sprengel deformity: pathogenesis and management. Journal of American Academy of Orthopeadic Surgeons 20, 177-186 Lin, J. L. & Coolman, B. R. (2009) Atlantoaxial subluxation in two dogs with cervical block vertebrae. Journal of American Animal Hospital Association 45, 305-310 Mohamed, J. Y., Faqeih, E., Alsiddiky, A., et al. (2013) Mutations in MEOX1, encoding mesenchyme homeobox 1, cause Klippel-Feil anomaly. American Journal of Human Genetic 92, 157-161 Parry, A. T., Upjohn, M. M., Schlegl, K., et al. (2010) Computed tomography variations in morphology of the canine atlas in dogs with and without atlantoaxial subluxation. Veterinary Radiology & Ultrasound 51, 596-600 Tracy, M. R., Dormans, J. P. & Kusumi, K. (2004) Klippel-Feil syndrome: clinical features and current understanding of etiology. Clinic Orthopeadics and Relative Research. 424, 183-190 Vaidyanathan, S., Hughes, P. L., Soni, B. M., et al. (2002) Klippel-Feil syndrome – the risk of cervical spinal cord injury: a case report. BioMedCentral Family Practice 3, 6 Warren-Smith, C. M., Kneissl, S., Benigni, L., et al. (2009) Incomplete ossification of the atlas in dogs with cervical signs. Veterinary Radiology & Ultrasound 50, 635-638 Williams, M. S. (2003) Developmental anomalies of the scapula-the “omo”st forgotten bone. American Journal of Medical Genetics 120A, 583-587 Yildirim, N., Arslanoglu, A., Mahirogullari, M., et al. (2008) Klippel–Feil syndrome and associated ear anomalies. American Journal of Otolaryngology 29, 319-325
© 2014 British Small Animal Veterinary Association
217
