Journal of Virological Methods 203 (2014) 81–87
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
A single-tube nucleotide isolation reagent for the quantitative PCR detection of virus in body fluids Hong Liu a , Yuansheng Wu b , Cuihua Liu a , Jinyang He a,∗ a b
Tropical Medicine Institute, Guangzhou University of Chinese Medicine, Guangzhou 510405, China The Second Affiliated Hospital, Guangzhou University of Chinese Medicine, Guangzhou 510405, China
a b s t r a c t Article history: Received 14 September 2013 Received in revised form 2 January 2014 Accepted 10 January 2014 Available online 8 April 2014 Keywords: Viruses Nucleotides Isolation and purification Polymerase chain reaction
A high-salt reagent composed of guanidinium thiocyanate, guanidine hydrochloride, urea, sodium citrate, and other compounds was designed for the single-tube isolation of viral nucleotides from body fluids. The single-tube reagent was used for the extraction of SIV RNA and HBV DNA from standard virus stock dilutions and virus-positive samples. The sensitivity and reproducibility of the single-tube reagent were analysed via quantitative PCR assays. The results revealed that the single-tube reagent can facilitate quantitative PCR-mediated detection in a reaction system with a 25-l volume using only 100 l of a body fluid sample and reaches a sensitivity of up to 50 copies/ml. The low coefficients of variance of both the HBV and SIV standard stock results indicate the excellent reproducibility of the single-tube reagent. A Bland–Altman analysis of the assay results from the SIV- and HBV-positive samples revealed that the single-tube reagent can precisely extract both RNA and DNA viral nucleotides from virus-positive samples. All of the isolation steps were performed in a single tube and were completed in no more than 35 min. The only major equipment required is a high-speed freezing centrifuge. The single-tube reagent is economical and easy to use and does not require any complex equipment. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Molecular diagnostic techniques for viral testing have experienced rapid development in recent decades (Hayden and Persing, 2001) and have been introduced in the majority of laboratories as primary methods for the diagnosis of human viral diseases. The use of the polymerase chain reaction (PCR), particularly real-time PCR (Van Belkum and Niesters, 1995), for virus detection, genotyping, and quantitation has several advantages, including high sensitivity, reproducibility, and a broad dynamic range (Ebner et al., 2005, 2006). A large number of qualitative and quantitative molecular assays for viruses, which are typically based on PCR technology, have been developed (Perandin et al., 2007; Ghaffari et al., 2008). However, the sensitivity and reproducibility of the PCR assay strategy not only depends on the PCR itself but also is highly dependent on the nucleotide extraction method (Ho et al., 2012). Several types of nucleotide extraction strategies have been used previously. The Trizol reagent is a classic RNA extraction reagent that has been widely used for viral RNA extraction (Verhofstede et al., 1996; Fransen et al., 1998). However, the Trizol method
has a low reproducibility because it requires changing the reaction tube during the extraction period (Verhofstede et al., 1996). There are also other commercial virus extraction kits that use magnetic beads, which allows the automated processing of samples, including the mixing, incubation, and reaction steps. However, the magnetic beads and the automated processing system are expensive and not suitable for small-scale nucleotide extraction. Other commercial RNA isolation kits, such as the NA Pure LC Total Nucleic Acid Isolation kit (Roche Diagnostics) and the automated Cobas AmpliPrep kit (Roche Diagnostics), are also expensive (Lee et al., 2008; Alp and Hascelik, 2009). Therefore, a simple, highly reproducible, highly sensitive, low-cost strategy for virus nucleotide extraction is needed. In this study, a single-tube viral nucleotide extraction reagent, which can extract viral RNA or DNA from serum, plasma, or other cell-free body fluids in a single centrifugal tube, was developed. Using the single-tube reagent, the RNA/DNA extraction protocol can be completed in no more than 35 min.
2. Materials and methods ∗ Corresponding author at: Tropical Medicine Institute, Guangzhou University of Chinese Medicine, No. 12, Jichang Road, Guangzhou 510405, China. Tel.: +86 20 36585475. E-mail address: [email protected] (J. He). 0166-0934/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2014.01.004
2.1. Single-tube reagent preparation To prepare 100 ml of the single-tube reagent, 63.8 g of guanidinium thiocyanate was first diluted in DEPC-treated deionised
82
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
water at 70 ◦ C and shaken until it was completely dissolved in a volume of no more than 80 ml. Then, 19.1 g of guanidine hydrochloride and 12 g of urea were added to the dissolved fluid, and the mixture was heated at 70 ◦ C and shaken until it was completely dissolved. The final concentrations of the guanidinium thiocyanate, guanidine hydrochloride, and urea were 5.4 M, 2 M, and 2 M, respectively. The following reagents were then added: 0.7% sodium lauryl sarcosinate, 25 mmol/l sodium citrate, 2% (V/V) 2-mercaptoethanol, and 20 g/l glycogen. The entire reagent mixture was shaken until completely dissolved and then filtered through a 0.45-m membrane. 2.2. Simian immunodeficiency virus (SIV) and hepatitis B virus (HBV) standards SIVmac239 standard virus with a viral load of 1 × 108 copies/ml was obtained from Dr. Marx at the Aaron Diamond AIDS Research Centre. The HBV standard virus is a HBV-positive serum sample received from the clinical laboratory of the First Affiliated Hospital of the Guangzhou University of Chinese Medicine. The viral load of the HBV-positive serum sample was 3.6 × 109 copies/ml, as determined using a HBV standard provided by the National Research Centre for Certified Reference Materials of China. 2.3. Nucleotide extraction protocol The protocol using the single-tube reagent is the following: 300 l of extraction fluid was added to a 1.5-ml tube. Then, 100 l of plasma or a cell-free body fluid sample was added to the extraction fluid and vortex. Incubate at room temperature for 10 min. 400 l of isopropanol were added and vortex for 15 s. Centrifuge at 15,600 × g for 15 min at room temperature. Discard the supernatant by overturning the tube once. Centrifuge the tube for 30 s at room temperature to concentrate the remaining fluid to the tube wall. A pipette was used to remove the remaining fluid, being careful not to touch the precipitate. 800 l of 50% isopropanol were added and centrifuge at 15,600 × g and 4 ◦ C for 5 min. Discard the supernatant by overturning the tube once. Centrifuge the tube for 30 s at room temperature to concentrate the remaining fluid to the tube wall. A pipette was used to remove the remaining fluid, being careful to not touch the precipitate. Then, 8 l of deionised water (for viral DNA extraction) were added to dissolve the viral DNA or 8 l of the reverse transcription reaction mixture (1.6 l of 5× reaction buffer, 0.4 l of 250 nM reverse primer, and the dNTP mixture (10 mM of each, all from Fermentas UAB, Vilnius, Lithuania) for viral RNA extraction) were added to perform reverse transcription. For the Trizol extraction of viral RNA, 300 l of Trizol were added to a 1.5-ml tube, 100 l of plasma sample were added to the fluid, and vortex. Incubate at room temperature for 15 min. 80 l of chloroform were added, and vortex. Incubate at room temperature for 10 min. Centrifuge at 15,600 × g and 4 ◦ C for 10 min. Transfer the supernatant to a new 1.5-ml tube (approximately 200 l), 200 l of isopropanol were added, vortex, and incubate in a −20 ◦ C freezer for 30 min. Centrifuge at 15,600 × g and 4 ◦ C for 10 min. Discard the supernatant, and 800 l of 75% ethanol were added. Centrifuge at 15,600 × g and 4 ◦ C for 5 min. Discard the supernatant. Centrifuge the tube for 30 s at room temperature to concentrate the remaining fluid to the tube wall. A pipette was used to remove the remaining fluid, being careful not to touch the precipitate. Then, 8 l of the reverse transcription reaction mixture were added for reverse transcription. For HBV DNA extraction, the HBV DNA extraction kit (polyethylene glycol method) from a commercial HBV viral load quantitative PCR kit was used (DaAn Gene Co., Ltd., Sun Yat-sen University). Briefly, 100 l of the DNA concentrate solution was added to a 1.5-ml tube. 100 l of the plasma sample were added, mix completely, and centrifuge at 15,600 × g and 4 ◦ C for 10 min. Discard
the supernatant, 20 l of DNA extraction solution was added to the precipitate, and mix completely. Incubate at 100 ◦ C for 10 min, and then centrifuge at 15,600 × g and 4 ◦ C for 5 min. The supernatant can be directly used for PCR testing. 2.4. Quantitative PCR A reaction system with a 25-l volume was used for quantitative PCR. The primer and probe sequences for SIV are the following: SIV sense primer, GGAGGAAATTACCCAGTACAACAAAT; SIV antisense primer, CCTGAAATCCTGGCACTACTTCT; and SIV probe, FAM-ACTATGTCCACCTGCCATTAAGCCCGAGA-TAMRA. The primer and probe sequences for HBV are the following: HBV sense primer, TGTCTGCGGCGTTTTATCATCT; HBV antisense primer, GGTTGTTGATGATCCTGGAATTGG; and HBV probe, FAMCCTGCTGCTATGCCTCATCTTCTTGTTGGTTC-TAMRA. The reaction system consisted of 0.25 l of 250 nM sense primer, 0.25 l of 250 nM antisense primer, 0.2 l of 250 nM probe, 9.8 l of deionised water, 12.5 l of quantitative PCR MasterMix, and 2 l of the DNA or cDNA sample. The reaction tube was incubated in an ABI7300 quantitative PCR thermocycler for amplification under the following conditions: 94 ◦ C for 10 min and 40 cycles of 94 ◦ C for 15 s and 60 ◦ C for 1 min. The data were analysed using the ABI7300 software. 2.5. SIV and HBV standard virus testing The SIV standard virus was serially diluted in foetal bovine serum to produce eight concentrations ranging from 5 to 5 × 107 copies/ml. Additionally, two samples of foetal bovine serum and deionised water were used as negative controls. All of the diluted samples were subjected to the SIV RNA extraction protocol using the single-tube reagent or the Trizol reagent. Reverse transcription was performed by adding 8 l of the reverse transcription reaction mixture to the RNA precipitate. The reaction conditions were 42 ◦ C for 60 min and 70 ◦ C for 10 min. Two microlitres of cDNA were used for the quantitative PCR of SIV. The HBV standard virus was also diluted in foetal bovine serum to produce nine concentrations ranging from 5 to 5 × 108 copies/ml. The negative control samples were the same as those used for the SIV standard virus test. HBV extraction was performed on all of the diluted samples using the ST reagent or the HBV DNA extraction kit. Two microlitres of HBV DNA were used for the quantitative PCR assays of HBV. 2.6. Inter-assay and intra-assay evaluations For the intra-assay evaluation, the SIV and HBV standard viruses were diluted to produce seven concentrations ranging from 50 to 5 × 107 copies/ml and eight concentrations ranging from 50 to 5 × 108 copies/ml, respectively. Each concentration was replicated eight times. Additionally, for each SIV RNA and HBV DNA extraction, two 100-l foetal bovine serum samples were included as negative controls. All of the extracted standard SIV RNA and negative control samples were reverse transcribed simultaneously, and a subsequent quantitative PCR assay was conducted to complete a single trial. The extracted HBV DNA samples were directly subjected to quantitative PCR for the intra-assay analysis. For the inter-assay evaluation, the extracted SIV and HBV standard viruses were also diluted to produce eight concentrations identical to those used for the intra-assay evaluation. The diluted SIV and HBV standard virus samples were used in the extraction assay, and eight trials of the assay were performed. Only one sample at each concentration was included in each extraction assay. Quantitative PCR was then performed to complete the assay. The data from the intra-assay and inter-assay evaluations were collected,
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
83
Fig. 1. Amplification plots of the quantitation of SIV standard virus through real-time reverse transcriptase PCR.
and the mean Ct values, standard deviations (S.D.), and coefficients of variance (CV) were calculated. 2.7. Evaluation of SIV-positive plasma and HBV-positive serum samples Fifty HBV-positive serum samples were obtained from the Third Affiliated Hospital of Sun Yat-sen University. Fifty SIV-positive plasma samples were drawn from rhesus macaques of Chinese origin that were used in an experiment of non-human primates infected with SIVmac239. The protocols and procedures included in the Animal Care and Welfare Act were approved by the Institutional Animal Care and Use Committee (IACUC) of the Chinese Academy of Sciences. Each of the HBV serum samples was extracted in triplicate using both the single-tube reagent and the HBV DNA extraction kit. Nucleotide extraction was performed for each of the SIV plasma samples virus in triplicate using both the single-tube reagent and the Trizol reagent. The Ct values were analysed to compare the different methods for the nucleotide extraction of HBVand SIV-positive samples. 2.8. Statistical analysis The statistical analysis was performed using the Medcalc9.6.2.0 software. Student’s t-test with 95% confidence bounds was used for comparisons between two groups, and an Altman–Bland plot was used for the analysis of the consistency of different nucleotide extraction methods for the virus-positive clinical samples. 3. Results 3.1. SIV standard virus quantitation A 10-fold dilution series of SIV, ranging from 5 to 5 × 107 copies/ml, was extracted with both the single-tube reagent and the Trizol reagent and was then examined via quantitative PCR to determine the sensitivity of the detection of SIV RNA using the single-tube reagent. The results were analysed based on the Ct values (the cycle in which a target sequence is first detected). The single-tube reagent can be used for the detection of 50–5 × 107 copies/ml. The SIV samples were diluted to 5 copies/ml could not be detected, i.e., the values obtained were similar to
those obtained with the negative controls (Figs. 1 and 2). For the Trizol reagent, the lowest level of detection is 500 copies/ml, and the correlation coefficient did not reach 0.9, even with repeated trials (data not shown). Fig. 1 indicates each copy number corresponding to the eight amplification plots. The dynamic range of the SIV assay was calculated to be 50–5 × 107 copies/ml, and the corresponding Ct values ranged from 35.478 ± 0.459 for 50 copies to 15.169 ± 0.108 for 5 × 107 copies. The amplification plot displays the values of DeltaRn on the y-axis (where Rn is the fluorescence emission intensity of the reporter dye normalised to a passive reference, and DeltaRn is the Rn of a non-reacted sample subtracted from the Rn of the reaction), and the cycle number is shown on the x-axis. The standard curve graph displayed in Fig. 2 was produced using the ABI7300 software and shows the Ct values on the y-axis and the log value of the input amounts on the x-axis. The slope is −3.485591, and the correlation coefficient is 0.994885. The intercept is 41.871677. 3.2. HBV standard virus quantification The HBV standard virus was serially diluted to concentrations ranging from 5 to 5 × 108 /ml. The diluted HBV samples were extracted with both the single-tube reagent and the HBV DNA extraction kit. The HBV DNA samples were examined via quantitative PCR to determine the sensitivity to detect HBV DNA extracted using the single-tube reagent. The results were analysed based on the Ct values (the cycle in which a target sequence is first detected). The single-tube reagent can be used for the detection of 50–5 × 108 copies/ml. The HBV samples at concentrations of 5 copies/ml and 5 × 109 /ml could not be detected, producing values similar to those obtained with the negative controls (Figs. 3 and 4). The lowest level of detection of the HBV DNA extraction kit is 500 copies/ml, and the correlation coefficient reaches 0.992. Fig. 3 indicates each copy number corresponding to the eight amplification plots. The dynamic range of the HBV assay was calculated to be 50–5 × 108 copies/ml, and the corresponding Ct values ranged from 37.984 ± 0.277 for 50 copies to 16.355 ± 0.299 for 5 × 108 copies. The amplification plot displays the DeltaRn values on the y-axis and the cycle number on the x-axis. The standard curve graph displayed in Fig. 4 was produced using ABI7300 software and plots the Ct values on the y-axis and
84
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
Fig. 2. Standard curve of the data shown in Fig. 1.
Fig. 3. Amplification plots of the quantification of HBV standard virus through real-time reverse transcriptase PCR.
Fig. 4. Standard curve of the data shown in Fig. 3.
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
85
Table 1 The Intra assay and Interassay of SIV testing with the single tube reagent. Samples assays
Virus copies
Mean Ct
S.D.
CV%
SIV Intra-assay
5e1 5e2 5e3 5e4 5e5 5e6 5e7
35.478 32.727 29.31 25.651 21.833 18.247 15.169
0.483 0.661 0.325 0.341 0.557 0.348 0.108
1.36 2.02 1.11 1.33 2.55 1.91 0.71
SIV Inter-assay
5e1 5e2 5e3 5e4 5e5 5e6 5e7
35.867 33.251 29.884 26.341 22.574 18.871 15.327
1.256 1.154 0.854 0.684 0.694 0.587 0.725
3.502 3.471 2.858 2.597 3.074 3.111 4.730
Each of the dilutions was assayed eight times per run for Intra-assay and eight assay runs for Interassay. The mean values of Ct, standard deviations (S.D.), and coefficients of variation (CV) were calculated. Fig. 5. Bland–Altman plot of the SIV copy numbers obtained using the single-tube and Trizol extraction methods.
the log value of the input amounts on the x-axis. The slope is −3.230945, and the correlation coefficient is 0.992335. The intercept is 44.635262.
3.3. Inter-assay and intra-assay analyses For the SIV intra-assay validation, the mean Ct values corresponding to the SIV standard virus dilutions ranged from 15.169 to 35.478. The highest coefficient of variance was 2.55%. For the inter-assay validation, the mean Ct values corresponding to the SIV standard virus dilutions ranged from 15.327 to 35.867. The highest coefficient of variance was 3.502%. No Ct values were obtained from the negative controls. These data are shown in Table 1. For the HBV intra-assay validation, the mean Ct values corresponding to the HBV standard virus dilutions ranged from 16.355 to 37.984. The highest coefficient of variance was 2.40%. For the inter-assay validation, the mean Ct values corresponding to the HBV standard virus dilutions ranged from 16.287 to 38.684, and the highest coefficient of variance was 4.113%. No Ct values were obtained from the negative controls. These data are shown in Table 2.
3.4. Examination of SIV-positive plasma and HBV-positive serum samples The SIV-positive plasma samples were extracted using both the single-tube reagent and the Trizol reagent in triplicate, and quantitative PCR assays were then performed. Similarly, the HBV-positive serum samples were extracted using both the single-tube reagent and the HBV DNA extraction kit (Kit) in triplicate, and quantitative PCR assays were then performed. The quantitative PCR data were analysed using the Bland–Altman method. The results revealed that 12 of the 50 differences in the different SIV copy numbers were greater than 0.5 log10 , and four of the differences were greater than 1 log10 (Fig. 5). However, the differences in the HBV copy numbers between the single-tube reagent group and the HBV extraction kit group were all less than 0.5 log10 (Fig. 6). The mean difference in the different SIV copy numbers between the single-tube and the Trizol methods was 0.169, and the standard deviation was 0.583. In contrast, the mean difference in the different HBV copy numbers between the single-tube and HBV extraction kit methods was 0.006, and the standard deviation was 0.127. The analysis of the CT values revealed that the mean differences were 3.631 for the SIV samples and 3.091 for the HBV samples, and the corresponding standard deviations were 2.019 and 0.877 (Table 3).
Table 2 The Intra-assay and Inter-assay of HBV. Samples
Virus copies
Mean Ct
S.D.
CV%
HBV Intra-assay
5e1 5e2 5e3 5e4 5e5 5e6 5e7 5e8
37.984 36.43 33.272 29.804 26.338 22.864 19.504 16.355
0.277 0.428 0.473 0.337 0.433 0.497 0.468 0.299
0.73 1.17 1.42 1.13 1.64 2.17 2.40 1.83
HBV Inter-assay
5e1 5e2 5e3 5e4 5e5 5e6 5e7 5e8
38.684 35.927 32.846 28.957 25.648 22.454 19.864 16.287
1.364 1.234 1.351 0.675 0.775 0.852 0.778 0.669
3.526 3.438 4.113 2.331 3.022 3.794 3.917 4.108
Each of the dilutions was assayed eight times per run for Intra-assay and eight assay runs for Interassay. The mean values of Ct, standard deviations (S.D.), and coefficients of variation (CV) were calculated.
Fig. 6. Bland–Altman plot of the HBV copy numbers obtained using the single-tube and the Kit extraction methods.
86
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
Table 3 Mean differences (SD) between viral loads measured by quantitative PCR with the different nucleotide isolation methods. Comparison of nucleotide isolation methods (virus)
Mean (SD) difference of viral loads (log10 copies/ml)
Mean (SD) difference of viral loads (CT value)
ST vs Trizol (SIV) ST vs HBV extraction kit (HBV)
−0.169 (0.583) 0.006 (0.127)
3.631 (2.019) 3.091 (0.877)
Fig. 5 shows that three of the 50 results were outside the “mean ± 1.96 SD” interval. The most discordant results were measured at 4.67 log10 copies/ml and 3.13 log10 copies/ml using the single-tube reagent and the Trizol reagent extraction methods, respectively. The mean difference in the SIV copy number (log10 copies/ml) between the single-tube and Trizol RNA extraction methods is 0.169, and the standard deviation is 0.583 (Table 3). The corresponding mean difference in Ct values is 3.631, and the standard deviation is 3.019 (Table 3). Twelve of the 50 differences were greater than 0.5 log10 , and four were greater than 1 log10 . Fig. 6 shows that no results were outside the “mean ± 1.96 SD” interval. The most discordant results were measured at 5.76 log10 copies/ml and 5.51 log10 copies/ml using the single-tube reagent and the HBV extraction kit reagent extraction methods, respectively. The mean difference in the HBV copy number (log10 copies/ml) between the single-tube and Kit extraction methods is 0.006, and the standard deviation is 0.127 (Table 3). The corresponding mean difference in Ct values is 3.091, and the standard deviation is 0.877 (Table 3). No difference was greater than 0.5 log10 . 4. Discussion Real-time PCR offers significant improvements for the quantification of viral load because of its enormous dynamic range, which can accommodate at least eight log10 copies of the nucleic acid template (Ishiguro et al., 1995; Abe et al., 1999; Kimura et al., 1999; Ryncarz et al., 1999; Locatelli et al., 2000; Monopoeho et al., 2000; Moody et al., 2000; Alexandersen et al., 2001; Brechtbuehl et al., 2001; Gruber et al., 2001; Najioullah et al., 2001). Real-time PCR has been reported to be at least as sensitive as the Southern blot assay (Capone et al., 2001). The analytical sensitivity of commercial PCR assays for human immunodeficiency virus (HIV) is currently as low as 20 copies/ml using 1 ml of the plasma sample (Sizmann et al., 2010). However, this high sensitivity was primarily achieved through an improvement of the nucleotide preparation technique because there is the PCR step cannot be improved markedly. Therefore, the nucleotide preparation technique is critical to the sensitivity of the PCR-mediated detection of virus. Using the same sample volume, a smaller nucleotide volume resulted in a more sensitive PCR-mediated virus detection. The single-tube reagent can use 8 l of the reverse transcription reagent or deionised water to dilute the nucleotide precipitate, resulting in a high sensitivity for virus detection. Then, 2 l of cDNA or DNA was added to the 25-l PCR, which resulted in a sensitivity of 50 copies/ml. In the present study, we used the singletube reagent to extract SIV from plasma and HBV from serum as examples of RNA and DNA viruses, respectively. Compared with the Trizol reagent, the single-tube reagent provided higher sensitivity for SIV RNA extraction, with a range of detection of 50–5 × 107 copies/ml. In contrast, the range of detection using the Trizol reagent is 500–5 × 107 copies/ml. Thus, the sensitivity of the single-tube reagent is tenfold higher than that of the Trizol reagent for SIV RNA extraction. Compared with the HBV DNA extraction kit, the single-tube reagent provides higher sensitivity for HBV DNA extraction, with a range of detection of 50–5 × 108 copies/ml. In addition, the dynamic range of the HBV DNA extraction kit is 500–5 × 108 copies/ml. Thus, the sensitivity using the single-tube
reagent is also tenfold higher than the HBV DNA extraction kit for HBV DNA extraction. Theoretically, the reproducibility of nucleotide extraction correlated with every sample processing step. If the nucleotide is lost in any of the extraction steps, the reproducibility will decrease. The Trizol reagent requires changing the reaction tube during the RNA extraction process, which results in RNA loss. Therefore, the use of the Trizol reagent for virus RNA isolation has been reported to provide low reproducibility (Verhofstede et al., 1996). In the present study, the single-tube reagent was designed for a single-tube protocol; namely, all of the extraction steps can be performed in a single tube. Thus, no nucleotide will be lost throughout the extraction process, ensuring excellent reproducibility. In the present study, using the single-tube reagent, the intra-assay CV of the SIV copy number measurement was found to be lower than 2.55%, and the inter-assay CV was lower than 4.73%, which indicates that both the intra-assay and inter-assay analyses indicate excellent reproducibility, as determined using eight samples at the same concentration. The intra-assay CV for the HBV copy number measurement was found to be lower than 2.4%, and the inter-assay CV was lower than 4.113%. Therefore, the use of the single-tube reagent can produce excellent reproducibility for virus detection through quantitative PCR. In the present study, the Trizol reagent was also used for SIV RNA isolation from standard virus dilutions, and the results were compared with those obtained using the single-tube reagent. The results revealed that the correlation coefficient cannot reach 0.9, despite the use of repeated trials (data not shown). Therefore, the reproducibility obtained using the Trizol reagent is low. Using the HBV DNA extraction kit to isolate HBV DNA, the HBV correlation coefficient of the quantitative PCR assay reaches 0.992, which indicates high reproducibility. This increased reproducibility may be due to the fact that the HBV DNA extraction kit is also a single-tube protocol. The single-tube reagent was also used to extract nucleotides from SIV-positive plasma and HBV-positive serum samples. The Trizol reagent and HBV extraction kit were used as the control extraction methods for SIV RNA and HBV DNA extraction, respectively. The results indicate that the single-tube reagent appeared to be a better nucleotide extraction reagent for the measurement of the viral load of both RNA and DNA viruses. First, 12 of the 50 differences in the SIV copy number were greater than 0.5 log10 , and four were higher 1 log10 , indicating that there are large differences between the single-tube reagent and Trizol extraction methods. However, none of the differences in the HBV copy number were higher 0.5 log10 , indicating that the difference between the use of the single-tube reagent and the HBV extraction kit is low. Second, the sensitivity of quantitative PCR using single-tube reagent extraction reaches 50 copies/ml for the analysis of both SIV and HBV standard viruses. However, the sensitivities of the Trizol method for SIV RNA extraction and the HBV extraction kit method for HBV DNA extraction are 500 copies/ml. Third, the analysis of the Ct values obtained using the SIV and HBV quantitative PCR assays also indicates that the Ct values quantified from samples obtained using the single-tube reagent are lower than those obtained using the Trizol reagent and the HBV extraction kit. Fourth, the intra-assay and inter-assay CV analyses of the SIV and HBV samples using the single-tube reagent revealed excellent reproducibility. Therefore,
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
the single-tube reagent is suitable for both RNA and DNA virus extraction from cell-free fluid and provides better reproducibility and sensitivity than the commonly used nucleotide extraction reagents. The single-tube reagent is composed of guanidinium isothiocyanate, guanidine hydrochloride, urea, and other compounds and utilises the high-salt principle for the denaturation and precipitation of viral nucleotides (Thomas, 1993). The combination of these three types of salts into a cocktail for denaturation may be responsible for its high sensitivity. Additionally, all of the ingredients in the single-tube reagent are economical, and the reagent is easy to prepare. Moreover, the equipment required for the viral nucleotide extraction is only a high-speed freezing centrifuge. The stability of the single-tube reagent was observed at 25 ◦ C, 4 ◦ C, and −20 ◦ C for one year and at 37 ◦ C for four weeks. The results revealed that precipitation will occur at both 4 ◦ C and −20 ◦ C; however, if it is completely dissolved by incubation at 70 ◦ C for 10 min, the single-tube reagent can maintain its viral nucleotide extraction sensitivity and reproducibility throughout the one-year observation period. If incubated at 25 ◦ C, the single-tube reagent remains stable for six months, and if incubated at 37 ◦ C, it remains stable throughout the four weeks of observation (data not shown). 5. Conclusions This study describes a single-tube reagent and a single-tube protocol for viral nucleotide extraction that is suitable for both virus DNA and RNA extraction from serum or plasma and, theoretically, from other cell-free body fluids. This reagent/protocol can be coupled with quantitative PCR and reach a detection sensitivity as high as 50 copies/ml using only 100 l of sample and provides excellent reproducibility. The preparation costs are low, and the protocol is simple. The reagent is stable at 20 ◦ C for six months and at 4 ◦ C and −20 ◦ C for more than one year. The single-tube reagent is particularly suitable for laboratories that lack automated equipment and can be used to attain ultra-sensitive and excellent reproducibility in the measurements of viral load. Acknowledgements This research was sponsored by two grants from the National Natural Science Foundation of China (Nos. 81001490 and 81173252). The work was performed in the Laboratory of Clinical and Basic Study at Guangzhou University of Chinese Medicine. We thank Dr. GuoLi Lin for providing the HBV-positive serum and the related clinical data. References Abe, A., Inoue, K., Tanaka, T., Kato, J., Kajiyama, N., Kawaguchi, R., Tanaka, S., Yoshiba, M., Kohara, M., 1999. Quantitation of hepatitis B virus genomic DNA by real-time detection PCR. J. Clin. Microbiol. 37, 2899–2903. Alexandersen, S., Oleksiewicz, M.B., Donaldson, A.I., 2001. The early pathogenesis of foot-and-mouth disease in pigs infected by contact: a quantitative time-course study using TaqMan RT-PCR. J. Gen. Virol. 82, 747–755.
87
Alp, A., Hascelik, G., 2009. Comparison of 3 nucleic acid isolation methods for the quantitation of HIV-1 RNA by Cobas Taqman real-time polymerase chain reaction system. Diagn. Microbiol. Infect. Dis. 63 (4), 365–371. Brechtbuehl, K., Whalley, S.A., Dusheiko, G.M., Saunders, N.A., 2001. A rapid real-time quantitative polymerase chain reaction for hepatitis B virus. J. Virol. Methods 93, 105–113. Capone, R.B., Pai, S.I., Koch, W.M., Gillison, M.L., 2001. Detection and quantitation of human papillomavirus (HPV) DNA in the sera of patients with HPV-associated head and neck squamous cell carcinoma. Clin. Cancer Res. 6, 4171–4175. Ebner, K., Suda, M., Watzinger, F., Lion, T., 2005. Molecular detection and quantitative analysis of the entire spectrum of human adenoviruses by a two-reaction realtime PCR assay. J. Clin. Microbiol. 43, 3049–3053. Ebner, K., Rauch, M., Preuner, S., Lion, T., 2006. Typing of human adenoviruses in specimens from immunosupressed patients by PCR-fragment length analysis and real-time quantitative PCR. J. Clin. Microbiol. 44, 2808–2815. Fransen, K., Mortier, D., Heyndrickx, L., Verhofstede, C., Janssens, W., van der Groen, G., 1998. Isolation of HIV-1 RNA from plasma: evaluation of seven different methods for extraction (part two)? J. Virol. Methods 76 (1–2), 153–157. Ghaffari, S.H., Obeidi, N., Dehghan, M., Alimoghaddan, K., Gharehbaghian, A., Ghavamzadeh, A., 2008. Monitoring of cytomegalovirus reactivation in bone marrow tranplant recipients by real-time PCR. Pathol. Oncol. Res. 14, 399–409. Gruber, F., Falkner, F.G., Dorner, F., Hämmerle, T., 2001. Quantitation of viral DNA by real-time PCR applying duplex amplification, internal standardization and two-colour fluorescence detection. Appl. Environ. Microbiol. 67, 2837–2839. Hayden, R., Persing, D.H., 2001. Diagnostic molecular microbiology review. Curr. Clin. Top. Infect. Dis. 21, 323–348. Ho, N.T., Fan, A., Klapperich, C.M., Cabodi, M., 2012. Sample concentration and purification for point-of-care diagnostics. In: Conf. Proc. IEEE Eng. Med. Biol. Soc, pp. 2396–2399. Ishiguro, T., Saitoh, J., Yawata, H., Yamagishi, H., Iwasaki, S., Mitoma, Y., 1995. Homogeneous quantitative assay of hepatitis C virus RNA by polymerase chain reaction in the presence of a fluorescent intercalater. Anal. Biochem. 229, 207–213. Lee, W.C., Lien, K.Y., Lee, G.B., Lei, H.Y., 2008. An integrated microfluidic system using magnetic beads for virus detection. Diagn. Microbiol. Infect. Dis. 60 (1), 51–58. Locatelli, G., Santoro, F., Veglia, F., Gobbi, A., Lusso, P., Malnati, M.S., 2000. Realtime quantitative PCR for human herpesvirus 6 DNA. J. Clin. Microbiol. 38, 4042–4048. Kimura, H., Morita, M., Yabuta, Y., Kuzushima, K., Kato, K., Kojima, S., Matsuyama, T., Morishima, T., 1999. Quantitative analysis of Epstein-Barr virus load by using a real-time PCR assay. J. Clin. Microbiol. 37, 132–136. Monopoeho, S., Mignotte, B., Schwartzbrod, L., Marechal, V., Nicolas, J.-C., Billaudel, S., Férré, V., 2000. Quantitation of enterovirus RNA in sludge samples using single tube real-time RT-PCR. Biotechniques 29, 88–93. Moody, A., Sellers, S., Bumstead, N., 2000. Measuring infectious bursal disease virus RNA in blood by multiplex real-time quantitative RT–PCR. J. Virol. Methods 85, 55–64. Najioullah, F., Thouvenot, D., Lina, B., 2001. Development of a real-time PCR procedure including an internal control for the measurement of HCMV viral load. J. Virol. Methods 92, 55–64. Perandin, F., Cariani, E., Pollara, C.P., Manca, N., 2007. Comparison of commercial and in-house real-time PCR assays for quantitation of Epstein-Barr virus (EBV) DNA in plasma. BMC Microbiol. 7, 22. Ryncarz, A.J., Goddard, J., Wald, A., Huang, M.-L., Roizman, B., Corey, L., 1999. Development of a high-throughput quantitative assay for detecting herpes simplex virus DNA in clinical samples. J. Clin. Microbiol. 37, 1941–1947. Sizmann, D., Glaubitz, J., Simon, C.O., Goedel, S., Buergisser, P., Drogan, D., Hesse, M., Kröh, M., Simmler, P., Dewald, M., Gilsdorf, M., Fuerst, M., Ineichen, R., Kirn, A., Pasche, P., Wang, Z., Weisshaar, S., Young, K., Haberhausen, G., Babiel, R., 2010. Improved HIV-1 RNA quantitation by COBAS AmpliPrep/COBAS TaqMan HIV-1 Test, v2.0 using a novel dual-target approach. J. Clin. Virol. 49, 41–46. Thomas, R., 1993. The denaturation of DNA. Gene 135 (1–2), 77–79. Van Belkum, A., Niesters, H.G., 1995. Nucleic acid amplification and related techniques in microbiological diagnosis and epidemiology. Cell. Mol. Biol. 41, 615–623. Verhofstede, C., Fransen, K., Marissens, D., Verhelst, R., van der Groen, G., Lauwers, S., Zissis, G., Plum, J., 1996. Isolation of HIV-1 RNA from plasma: evaluation of eight different extraction methods. J. Virol. Methods 60 (2), 155–159.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
A single-tube nucleotide isolation reagent for the quantitative PCR detection of virus in body fluids Hong Liu a , Yuansheng Wu b , Cuihua Liu a , Jinyang He a,∗ a b
Tropical Medicine Institute, Guangzhou University of Chinese Medicine, Guangzhou 510405, China The Second Affiliated Hospital, Guangzhou University of Chinese Medicine, Guangzhou 510405, China
a b s t r a c t Article history: Received 14 September 2013 Received in revised form 2 January 2014 Accepted 10 January 2014 Available online 8 April 2014 Keywords: Viruses Nucleotides Isolation and purification Polymerase chain reaction
A high-salt reagent composed of guanidinium thiocyanate, guanidine hydrochloride, urea, sodium citrate, and other compounds was designed for the single-tube isolation of viral nucleotides from body fluids. The single-tube reagent was used for the extraction of SIV RNA and HBV DNA from standard virus stock dilutions and virus-positive samples. The sensitivity and reproducibility of the single-tube reagent were analysed via quantitative PCR assays. The results revealed that the single-tube reagent can facilitate quantitative PCR-mediated detection in a reaction system with a 25-l volume using only 100 l of a body fluid sample and reaches a sensitivity of up to 50 copies/ml. The low coefficients of variance of both the HBV and SIV standard stock results indicate the excellent reproducibility of the single-tube reagent. A Bland–Altman analysis of the assay results from the SIV- and HBV-positive samples revealed that the single-tube reagent can precisely extract both RNA and DNA viral nucleotides from virus-positive samples. All of the isolation steps were performed in a single tube and were completed in no more than 35 min. The only major equipment required is a high-speed freezing centrifuge. The single-tube reagent is economical and easy to use and does not require any complex equipment. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Molecular diagnostic techniques for viral testing have experienced rapid development in recent decades (Hayden and Persing, 2001) and have been introduced in the majority of laboratories as primary methods for the diagnosis of human viral diseases. The use of the polymerase chain reaction (PCR), particularly real-time PCR (Van Belkum and Niesters, 1995), for virus detection, genotyping, and quantitation has several advantages, including high sensitivity, reproducibility, and a broad dynamic range (Ebner et al., 2005, 2006). A large number of qualitative and quantitative molecular assays for viruses, which are typically based on PCR technology, have been developed (Perandin et al., 2007; Ghaffari et al., 2008). However, the sensitivity and reproducibility of the PCR assay strategy not only depends on the PCR itself but also is highly dependent on the nucleotide extraction method (Ho et al., 2012). Several types of nucleotide extraction strategies have been used previously. The Trizol reagent is a classic RNA extraction reagent that has been widely used for viral RNA extraction (Verhofstede et al., 1996; Fransen et al., 1998). However, the Trizol method
has a low reproducibility because it requires changing the reaction tube during the extraction period (Verhofstede et al., 1996). There are also other commercial virus extraction kits that use magnetic beads, which allows the automated processing of samples, including the mixing, incubation, and reaction steps. However, the magnetic beads and the automated processing system are expensive and not suitable for small-scale nucleotide extraction. Other commercial RNA isolation kits, such as the NA Pure LC Total Nucleic Acid Isolation kit (Roche Diagnostics) and the automated Cobas AmpliPrep kit (Roche Diagnostics), are also expensive (Lee et al., 2008; Alp and Hascelik, 2009). Therefore, a simple, highly reproducible, highly sensitive, low-cost strategy for virus nucleotide extraction is needed. In this study, a single-tube viral nucleotide extraction reagent, which can extract viral RNA or DNA from serum, plasma, or other cell-free body fluids in a single centrifugal tube, was developed. Using the single-tube reagent, the RNA/DNA extraction protocol can be completed in no more than 35 min.
2. Materials and methods ∗ Corresponding author at: Tropical Medicine Institute, Guangzhou University of Chinese Medicine, No. 12, Jichang Road, Guangzhou 510405, China. Tel.: +86 20 36585475. E-mail address: [email protected] (J. He). 0166-0934/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2014.01.004
2.1. Single-tube reagent preparation To prepare 100 ml of the single-tube reagent, 63.8 g of guanidinium thiocyanate was first diluted in DEPC-treated deionised
82
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
water at 70 ◦ C and shaken until it was completely dissolved in a volume of no more than 80 ml. Then, 19.1 g of guanidine hydrochloride and 12 g of urea were added to the dissolved fluid, and the mixture was heated at 70 ◦ C and shaken until it was completely dissolved. The final concentrations of the guanidinium thiocyanate, guanidine hydrochloride, and urea were 5.4 M, 2 M, and 2 M, respectively. The following reagents were then added: 0.7% sodium lauryl sarcosinate, 25 mmol/l sodium citrate, 2% (V/V) 2-mercaptoethanol, and 20 g/l glycogen. The entire reagent mixture was shaken until completely dissolved and then filtered through a 0.45-m membrane. 2.2. Simian immunodeficiency virus (SIV) and hepatitis B virus (HBV) standards SIVmac239 standard virus with a viral load of 1 × 108 copies/ml was obtained from Dr. Marx at the Aaron Diamond AIDS Research Centre. The HBV standard virus is a HBV-positive serum sample received from the clinical laboratory of the First Affiliated Hospital of the Guangzhou University of Chinese Medicine. The viral load of the HBV-positive serum sample was 3.6 × 109 copies/ml, as determined using a HBV standard provided by the National Research Centre for Certified Reference Materials of China. 2.3. Nucleotide extraction protocol The protocol using the single-tube reagent is the following: 300 l of extraction fluid was added to a 1.5-ml tube. Then, 100 l of plasma or a cell-free body fluid sample was added to the extraction fluid and vortex. Incubate at room temperature for 10 min. 400 l of isopropanol were added and vortex for 15 s. Centrifuge at 15,600 × g for 15 min at room temperature. Discard the supernatant by overturning the tube once. Centrifuge the tube for 30 s at room temperature to concentrate the remaining fluid to the tube wall. A pipette was used to remove the remaining fluid, being careful not to touch the precipitate. 800 l of 50% isopropanol were added and centrifuge at 15,600 × g and 4 ◦ C for 5 min. Discard the supernatant by overturning the tube once. Centrifuge the tube for 30 s at room temperature to concentrate the remaining fluid to the tube wall. A pipette was used to remove the remaining fluid, being careful to not touch the precipitate. Then, 8 l of deionised water (for viral DNA extraction) were added to dissolve the viral DNA or 8 l of the reverse transcription reaction mixture (1.6 l of 5× reaction buffer, 0.4 l of 250 nM reverse primer, and the dNTP mixture (10 mM of each, all from Fermentas UAB, Vilnius, Lithuania) for viral RNA extraction) were added to perform reverse transcription. For the Trizol extraction of viral RNA, 300 l of Trizol were added to a 1.5-ml tube, 100 l of plasma sample were added to the fluid, and vortex. Incubate at room temperature for 15 min. 80 l of chloroform were added, and vortex. Incubate at room temperature for 10 min. Centrifuge at 15,600 × g and 4 ◦ C for 10 min. Transfer the supernatant to a new 1.5-ml tube (approximately 200 l), 200 l of isopropanol were added, vortex, and incubate in a −20 ◦ C freezer for 30 min. Centrifuge at 15,600 × g and 4 ◦ C for 10 min. Discard the supernatant, and 800 l of 75% ethanol were added. Centrifuge at 15,600 × g and 4 ◦ C for 5 min. Discard the supernatant. Centrifuge the tube for 30 s at room temperature to concentrate the remaining fluid to the tube wall. A pipette was used to remove the remaining fluid, being careful not to touch the precipitate. Then, 8 l of the reverse transcription reaction mixture were added for reverse transcription. For HBV DNA extraction, the HBV DNA extraction kit (polyethylene glycol method) from a commercial HBV viral load quantitative PCR kit was used (DaAn Gene Co., Ltd., Sun Yat-sen University). Briefly, 100 l of the DNA concentrate solution was added to a 1.5-ml tube. 100 l of the plasma sample were added, mix completely, and centrifuge at 15,600 × g and 4 ◦ C for 10 min. Discard
the supernatant, 20 l of DNA extraction solution was added to the precipitate, and mix completely. Incubate at 100 ◦ C for 10 min, and then centrifuge at 15,600 × g and 4 ◦ C for 5 min. The supernatant can be directly used for PCR testing. 2.4. Quantitative PCR A reaction system with a 25-l volume was used for quantitative PCR. The primer and probe sequences for SIV are the following: SIV sense primer, GGAGGAAATTACCCAGTACAACAAAT; SIV antisense primer, CCTGAAATCCTGGCACTACTTCT; and SIV probe, FAM-ACTATGTCCACCTGCCATTAAGCCCGAGA-TAMRA. The primer and probe sequences for HBV are the following: HBV sense primer, TGTCTGCGGCGTTTTATCATCT; HBV antisense primer, GGTTGTTGATGATCCTGGAATTGG; and HBV probe, FAMCCTGCTGCTATGCCTCATCTTCTTGTTGGTTC-TAMRA. The reaction system consisted of 0.25 l of 250 nM sense primer, 0.25 l of 250 nM antisense primer, 0.2 l of 250 nM probe, 9.8 l of deionised water, 12.5 l of quantitative PCR MasterMix, and 2 l of the DNA or cDNA sample. The reaction tube was incubated in an ABI7300 quantitative PCR thermocycler for amplification under the following conditions: 94 ◦ C for 10 min and 40 cycles of 94 ◦ C for 15 s and 60 ◦ C for 1 min. The data were analysed using the ABI7300 software. 2.5. SIV and HBV standard virus testing The SIV standard virus was serially diluted in foetal bovine serum to produce eight concentrations ranging from 5 to 5 × 107 copies/ml. Additionally, two samples of foetal bovine serum and deionised water were used as negative controls. All of the diluted samples were subjected to the SIV RNA extraction protocol using the single-tube reagent or the Trizol reagent. Reverse transcription was performed by adding 8 l of the reverse transcription reaction mixture to the RNA precipitate. The reaction conditions were 42 ◦ C for 60 min and 70 ◦ C for 10 min. Two microlitres of cDNA were used for the quantitative PCR of SIV. The HBV standard virus was also diluted in foetal bovine serum to produce nine concentrations ranging from 5 to 5 × 108 copies/ml. The negative control samples were the same as those used for the SIV standard virus test. HBV extraction was performed on all of the diluted samples using the ST reagent or the HBV DNA extraction kit. Two microlitres of HBV DNA were used for the quantitative PCR assays of HBV. 2.6. Inter-assay and intra-assay evaluations For the intra-assay evaluation, the SIV and HBV standard viruses were diluted to produce seven concentrations ranging from 50 to 5 × 107 copies/ml and eight concentrations ranging from 50 to 5 × 108 copies/ml, respectively. Each concentration was replicated eight times. Additionally, for each SIV RNA and HBV DNA extraction, two 100-l foetal bovine serum samples were included as negative controls. All of the extracted standard SIV RNA and negative control samples were reverse transcribed simultaneously, and a subsequent quantitative PCR assay was conducted to complete a single trial. The extracted HBV DNA samples were directly subjected to quantitative PCR for the intra-assay analysis. For the inter-assay evaluation, the extracted SIV and HBV standard viruses were also diluted to produce eight concentrations identical to those used for the intra-assay evaluation. The diluted SIV and HBV standard virus samples were used in the extraction assay, and eight trials of the assay were performed. Only one sample at each concentration was included in each extraction assay. Quantitative PCR was then performed to complete the assay. The data from the intra-assay and inter-assay evaluations were collected,
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
83
Fig. 1. Amplification plots of the quantitation of SIV standard virus through real-time reverse transcriptase PCR.
and the mean Ct values, standard deviations (S.D.), and coefficients of variance (CV) were calculated. 2.7. Evaluation of SIV-positive plasma and HBV-positive serum samples Fifty HBV-positive serum samples were obtained from the Third Affiliated Hospital of Sun Yat-sen University. Fifty SIV-positive plasma samples were drawn from rhesus macaques of Chinese origin that were used in an experiment of non-human primates infected with SIVmac239. The protocols and procedures included in the Animal Care and Welfare Act were approved by the Institutional Animal Care and Use Committee (IACUC) of the Chinese Academy of Sciences. Each of the HBV serum samples was extracted in triplicate using both the single-tube reagent and the HBV DNA extraction kit. Nucleotide extraction was performed for each of the SIV plasma samples virus in triplicate using both the single-tube reagent and the Trizol reagent. The Ct values were analysed to compare the different methods for the nucleotide extraction of HBVand SIV-positive samples. 2.8. Statistical analysis The statistical analysis was performed using the Medcalc9.6.2.0 software. Student’s t-test with 95% confidence bounds was used for comparisons between two groups, and an Altman–Bland plot was used for the analysis of the consistency of different nucleotide extraction methods for the virus-positive clinical samples. 3. Results 3.1. SIV standard virus quantitation A 10-fold dilution series of SIV, ranging from 5 to 5 × 107 copies/ml, was extracted with both the single-tube reagent and the Trizol reagent and was then examined via quantitative PCR to determine the sensitivity of the detection of SIV RNA using the single-tube reagent. The results were analysed based on the Ct values (the cycle in which a target sequence is first detected). The single-tube reagent can be used for the detection of 50–5 × 107 copies/ml. The SIV samples were diluted to 5 copies/ml could not be detected, i.e., the values obtained were similar to
those obtained with the negative controls (Figs. 1 and 2). For the Trizol reagent, the lowest level of detection is 500 copies/ml, and the correlation coefficient did not reach 0.9, even with repeated trials (data not shown). Fig. 1 indicates each copy number corresponding to the eight amplification plots. The dynamic range of the SIV assay was calculated to be 50–5 × 107 copies/ml, and the corresponding Ct values ranged from 35.478 ± 0.459 for 50 copies to 15.169 ± 0.108 for 5 × 107 copies. The amplification plot displays the values of DeltaRn on the y-axis (where Rn is the fluorescence emission intensity of the reporter dye normalised to a passive reference, and DeltaRn is the Rn of a non-reacted sample subtracted from the Rn of the reaction), and the cycle number is shown on the x-axis. The standard curve graph displayed in Fig. 2 was produced using the ABI7300 software and shows the Ct values on the y-axis and the log value of the input amounts on the x-axis. The slope is −3.485591, and the correlation coefficient is 0.994885. The intercept is 41.871677. 3.2. HBV standard virus quantification The HBV standard virus was serially diluted to concentrations ranging from 5 to 5 × 108 /ml. The diluted HBV samples were extracted with both the single-tube reagent and the HBV DNA extraction kit. The HBV DNA samples were examined via quantitative PCR to determine the sensitivity to detect HBV DNA extracted using the single-tube reagent. The results were analysed based on the Ct values (the cycle in which a target sequence is first detected). The single-tube reagent can be used for the detection of 50–5 × 108 copies/ml. The HBV samples at concentrations of 5 copies/ml and 5 × 109 /ml could not be detected, producing values similar to those obtained with the negative controls (Figs. 3 and 4). The lowest level of detection of the HBV DNA extraction kit is 500 copies/ml, and the correlation coefficient reaches 0.992. Fig. 3 indicates each copy number corresponding to the eight amplification plots. The dynamic range of the HBV assay was calculated to be 50–5 × 108 copies/ml, and the corresponding Ct values ranged from 37.984 ± 0.277 for 50 copies to 16.355 ± 0.299 for 5 × 108 copies. The amplification plot displays the DeltaRn values on the y-axis and the cycle number on the x-axis. The standard curve graph displayed in Fig. 4 was produced using ABI7300 software and plots the Ct values on the y-axis and
84
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
Fig. 2. Standard curve of the data shown in Fig. 1.
Fig. 3. Amplification plots of the quantification of HBV standard virus through real-time reverse transcriptase PCR.
Fig. 4. Standard curve of the data shown in Fig. 3.
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
85
Table 1 The Intra assay and Interassay of SIV testing with the single tube reagent. Samples assays
Virus copies
Mean Ct
S.D.
CV%
SIV Intra-assay
5e1 5e2 5e3 5e4 5e5 5e6 5e7
35.478 32.727 29.31 25.651 21.833 18.247 15.169
0.483 0.661 0.325 0.341 0.557 0.348 0.108
1.36 2.02 1.11 1.33 2.55 1.91 0.71
SIV Inter-assay
5e1 5e2 5e3 5e4 5e5 5e6 5e7
35.867 33.251 29.884 26.341 22.574 18.871 15.327
1.256 1.154 0.854 0.684 0.694 0.587 0.725
3.502 3.471 2.858 2.597 3.074 3.111 4.730
Each of the dilutions was assayed eight times per run for Intra-assay and eight assay runs for Interassay. The mean values of Ct, standard deviations (S.D.), and coefficients of variation (CV) were calculated. Fig. 5. Bland–Altman plot of the SIV copy numbers obtained using the single-tube and Trizol extraction methods.
the log value of the input amounts on the x-axis. The slope is −3.230945, and the correlation coefficient is 0.992335. The intercept is 44.635262.
3.3. Inter-assay and intra-assay analyses For the SIV intra-assay validation, the mean Ct values corresponding to the SIV standard virus dilutions ranged from 15.169 to 35.478. The highest coefficient of variance was 2.55%. For the inter-assay validation, the mean Ct values corresponding to the SIV standard virus dilutions ranged from 15.327 to 35.867. The highest coefficient of variance was 3.502%. No Ct values were obtained from the negative controls. These data are shown in Table 1. For the HBV intra-assay validation, the mean Ct values corresponding to the HBV standard virus dilutions ranged from 16.355 to 37.984. The highest coefficient of variance was 2.40%. For the inter-assay validation, the mean Ct values corresponding to the HBV standard virus dilutions ranged from 16.287 to 38.684, and the highest coefficient of variance was 4.113%. No Ct values were obtained from the negative controls. These data are shown in Table 2.
3.4. Examination of SIV-positive plasma and HBV-positive serum samples The SIV-positive plasma samples were extracted using both the single-tube reagent and the Trizol reagent in triplicate, and quantitative PCR assays were then performed. Similarly, the HBV-positive serum samples were extracted using both the single-tube reagent and the HBV DNA extraction kit (Kit) in triplicate, and quantitative PCR assays were then performed. The quantitative PCR data were analysed using the Bland–Altman method. The results revealed that 12 of the 50 differences in the different SIV copy numbers were greater than 0.5 log10 , and four of the differences were greater than 1 log10 (Fig. 5). However, the differences in the HBV copy numbers between the single-tube reagent group and the HBV extraction kit group were all less than 0.5 log10 (Fig. 6). The mean difference in the different SIV copy numbers between the single-tube and the Trizol methods was 0.169, and the standard deviation was 0.583. In contrast, the mean difference in the different HBV copy numbers between the single-tube and HBV extraction kit methods was 0.006, and the standard deviation was 0.127. The analysis of the CT values revealed that the mean differences were 3.631 for the SIV samples and 3.091 for the HBV samples, and the corresponding standard deviations were 2.019 and 0.877 (Table 3).
Table 2 The Intra-assay and Inter-assay of HBV. Samples
Virus copies
Mean Ct
S.D.
CV%
HBV Intra-assay
5e1 5e2 5e3 5e4 5e5 5e6 5e7 5e8
37.984 36.43 33.272 29.804 26.338 22.864 19.504 16.355
0.277 0.428 0.473 0.337 0.433 0.497 0.468 0.299
0.73 1.17 1.42 1.13 1.64 2.17 2.40 1.83
HBV Inter-assay
5e1 5e2 5e3 5e4 5e5 5e6 5e7 5e8
38.684 35.927 32.846 28.957 25.648 22.454 19.864 16.287
1.364 1.234 1.351 0.675 0.775 0.852 0.778 0.669
3.526 3.438 4.113 2.331 3.022 3.794 3.917 4.108
Each of the dilutions was assayed eight times per run for Intra-assay and eight assay runs for Interassay. The mean values of Ct, standard deviations (S.D.), and coefficients of variation (CV) were calculated.
Fig. 6. Bland–Altman plot of the HBV copy numbers obtained using the single-tube and the Kit extraction methods.
86
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
Table 3 Mean differences (SD) between viral loads measured by quantitative PCR with the different nucleotide isolation methods. Comparison of nucleotide isolation methods (virus)
Mean (SD) difference of viral loads (log10 copies/ml)
Mean (SD) difference of viral loads (CT value)
ST vs Trizol (SIV) ST vs HBV extraction kit (HBV)
−0.169 (0.583) 0.006 (0.127)
3.631 (2.019) 3.091 (0.877)
Fig. 5 shows that three of the 50 results were outside the “mean ± 1.96 SD” interval. The most discordant results were measured at 4.67 log10 copies/ml and 3.13 log10 copies/ml using the single-tube reagent and the Trizol reagent extraction methods, respectively. The mean difference in the SIV copy number (log10 copies/ml) between the single-tube and Trizol RNA extraction methods is 0.169, and the standard deviation is 0.583 (Table 3). The corresponding mean difference in Ct values is 3.631, and the standard deviation is 3.019 (Table 3). Twelve of the 50 differences were greater than 0.5 log10 , and four were greater than 1 log10 . Fig. 6 shows that no results were outside the “mean ± 1.96 SD” interval. The most discordant results were measured at 5.76 log10 copies/ml and 5.51 log10 copies/ml using the single-tube reagent and the HBV extraction kit reagent extraction methods, respectively. The mean difference in the HBV copy number (log10 copies/ml) between the single-tube and Kit extraction methods is 0.006, and the standard deviation is 0.127 (Table 3). The corresponding mean difference in Ct values is 3.091, and the standard deviation is 0.877 (Table 3). No difference was greater than 0.5 log10 . 4. Discussion Real-time PCR offers significant improvements for the quantification of viral load because of its enormous dynamic range, which can accommodate at least eight log10 copies of the nucleic acid template (Ishiguro et al., 1995; Abe et al., 1999; Kimura et al., 1999; Ryncarz et al., 1999; Locatelli et al., 2000; Monopoeho et al., 2000; Moody et al., 2000; Alexandersen et al., 2001; Brechtbuehl et al., 2001; Gruber et al., 2001; Najioullah et al., 2001). Real-time PCR has been reported to be at least as sensitive as the Southern blot assay (Capone et al., 2001). The analytical sensitivity of commercial PCR assays for human immunodeficiency virus (HIV) is currently as low as 20 copies/ml using 1 ml of the plasma sample (Sizmann et al., 2010). However, this high sensitivity was primarily achieved through an improvement of the nucleotide preparation technique because there is the PCR step cannot be improved markedly. Therefore, the nucleotide preparation technique is critical to the sensitivity of the PCR-mediated detection of virus. Using the same sample volume, a smaller nucleotide volume resulted in a more sensitive PCR-mediated virus detection. The single-tube reagent can use 8 l of the reverse transcription reagent or deionised water to dilute the nucleotide precipitate, resulting in a high sensitivity for virus detection. Then, 2 l of cDNA or DNA was added to the 25-l PCR, which resulted in a sensitivity of 50 copies/ml. In the present study, we used the singletube reagent to extract SIV from plasma and HBV from serum as examples of RNA and DNA viruses, respectively. Compared with the Trizol reagent, the single-tube reagent provided higher sensitivity for SIV RNA extraction, with a range of detection of 50–5 × 107 copies/ml. In contrast, the range of detection using the Trizol reagent is 500–5 × 107 copies/ml. Thus, the sensitivity of the single-tube reagent is tenfold higher than that of the Trizol reagent for SIV RNA extraction. Compared with the HBV DNA extraction kit, the single-tube reagent provides higher sensitivity for HBV DNA extraction, with a range of detection of 50–5 × 108 copies/ml. In addition, the dynamic range of the HBV DNA extraction kit is 500–5 × 108 copies/ml. Thus, the sensitivity using the single-tube
reagent is also tenfold higher than the HBV DNA extraction kit for HBV DNA extraction. Theoretically, the reproducibility of nucleotide extraction correlated with every sample processing step. If the nucleotide is lost in any of the extraction steps, the reproducibility will decrease. The Trizol reagent requires changing the reaction tube during the RNA extraction process, which results in RNA loss. Therefore, the use of the Trizol reagent for virus RNA isolation has been reported to provide low reproducibility (Verhofstede et al., 1996). In the present study, the single-tube reagent was designed for a single-tube protocol; namely, all of the extraction steps can be performed in a single tube. Thus, no nucleotide will be lost throughout the extraction process, ensuring excellent reproducibility. In the present study, using the single-tube reagent, the intra-assay CV of the SIV copy number measurement was found to be lower than 2.55%, and the inter-assay CV was lower than 4.73%, which indicates that both the intra-assay and inter-assay analyses indicate excellent reproducibility, as determined using eight samples at the same concentration. The intra-assay CV for the HBV copy number measurement was found to be lower than 2.4%, and the inter-assay CV was lower than 4.113%. Therefore, the use of the single-tube reagent can produce excellent reproducibility for virus detection through quantitative PCR. In the present study, the Trizol reagent was also used for SIV RNA isolation from standard virus dilutions, and the results were compared with those obtained using the single-tube reagent. The results revealed that the correlation coefficient cannot reach 0.9, despite the use of repeated trials (data not shown). Therefore, the reproducibility obtained using the Trizol reagent is low. Using the HBV DNA extraction kit to isolate HBV DNA, the HBV correlation coefficient of the quantitative PCR assay reaches 0.992, which indicates high reproducibility. This increased reproducibility may be due to the fact that the HBV DNA extraction kit is also a single-tube protocol. The single-tube reagent was also used to extract nucleotides from SIV-positive plasma and HBV-positive serum samples. The Trizol reagent and HBV extraction kit were used as the control extraction methods for SIV RNA and HBV DNA extraction, respectively. The results indicate that the single-tube reagent appeared to be a better nucleotide extraction reagent for the measurement of the viral load of both RNA and DNA viruses. First, 12 of the 50 differences in the SIV copy number were greater than 0.5 log10 , and four were higher 1 log10 , indicating that there are large differences between the single-tube reagent and Trizol extraction methods. However, none of the differences in the HBV copy number were higher 0.5 log10 , indicating that the difference between the use of the single-tube reagent and the HBV extraction kit is low. Second, the sensitivity of quantitative PCR using single-tube reagent extraction reaches 50 copies/ml for the analysis of both SIV and HBV standard viruses. However, the sensitivities of the Trizol method for SIV RNA extraction and the HBV extraction kit method for HBV DNA extraction are 500 copies/ml. Third, the analysis of the Ct values obtained using the SIV and HBV quantitative PCR assays also indicates that the Ct values quantified from samples obtained using the single-tube reagent are lower than those obtained using the Trizol reagent and the HBV extraction kit. Fourth, the intra-assay and inter-assay CV analyses of the SIV and HBV samples using the single-tube reagent revealed excellent reproducibility. Therefore,
H. Liu et al. / Journal of Virological Methods 203 (2014) 81–87
the single-tube reagent is suitable for both RNA and DNA virus extraction from cell-free fluid and provides better reproducibility and sensitivity than the commonly used nucleotide extraction reagents. The single-tube reagent is composed of guanidinium isothiocyanate, guanidine hydrochloride, urea, and other compounds and utilises the high-salt principle for the denaturation and precipitation of viral nucleotides (Thomas, 1993). The combination of these three types of salts into a cocktail for denaturation may be responsible for its high sensitivity. Additionally, all of the ingredients in the single-tube reagent are economical, and the reagent is easy to prepare. Moreover, the equipment required for the viral nucleotide extraction is only a high-speed freezing centrifuge. The stability of the single-tube reagent was observed at 25 ◦ C, 4 ◦ C, and −20 ◦ C for one year and at 37 ◦ C for four weeks. The results revealed that precipitation will occur at both 4 ◦ C and −20 ◦ C; however, if it is completely dissolved by incubation at 70 ◦ C for 10 min, the single-tube reagent can maintain its viral nucleotide extraction sensitivity and reproducibility throughout the one-year observation period. If incubated at 25 ◦ C, the single-tube reagent remains stable for six months, and if incubated at 37 ◦ C, it remains stable throughout the four weeks of observation (data not shown). 5. Conclusions This study describes a single-tube reagent and a single-tube protocol for viral nucleotide extraction that is suitable for both virus DNA and RNA extraction from serum or plasma and, theoretically, from other cell-free body fluids. This reagent/protocol can be coupled with quantitative PCR and reach a detection sensitivity as high as 50 copies/ml using only 100 l of sample and provides excellent reproducibility. The preparation costs are low, and the protocol is simple. The reagent is stable at 20 ◦ C for six months and at 4 ◦ C and −20 ◦ C for more than one year. The single-tube reagent is particularly suitable for laboratories that lack automated equipment and can be used to attain ultra-sensitive and excellent reproducibility in the measurements of viral load. Acknowledgements This research was sponsored by two grants from the National Natural Science Foundation of China (Nos. 81001490 and 81173252). The work was performed in the Laboratory of Clinical and Basic Study at Guangzhou University of Chinese Medicine. We thank Dr. GuoLi Lin for providing the HBV-positive serum and the related clinical data. References Abe, A., Inoue, K., Tanaka, T., Kato, J., Kajiyama, N., Kawaguchi, R., Tanaka, S., Yoshiba, M., Kohara, M., 1999. Quantitation of hepatitis B virus genomic DNA by real-time detection PCR. J. Clin. Microbiol. 37, 2899–2903. Alexandersen, S., Oleksiewicz, M.B., Donaldson, A.I., 2001. The early pathogenesis of foot-and-mouth disease in pigs infected by contact: a quantitative time-course study using TaqMan RT-PCR. J. Gen. Virol. 82, 747–755.
87
Alp, A., Hascelik, G., 2009. Comparison of 3 nucleic acid isolation methods for the quantitation of HIV-1 RNA by Cobas Taqman real-time polymerase chain reaction system. Diagn. Microbiol. Infect. Dis. 63 (4), 365–371. Brechtbuehl, K., Whalley, S.A., Dusheiko, G.M., Saunders, N.A., 2001. A rapid real-time quantitative polymerase chain reaction for hepatitis B virus. J. Virol. Methods 93, 105–113. Capone, R.B., Pai, S.I., Koch, W.M., Gillison, M.L., 2001. Detection and quantitation of human papillomavirus (HPV) DNA in the sera of patients with HPV-associated head and neck squamous cell carcinoma. Clin. Cancer Res. 6, 4171–4175. Ebner, K., Suda, M., Watzinger, F., Lion, T., 2005. Molecular detection and quantitative analysis of the entire spectrum of human adenoviruses by a two-reaction realtime PCR assay. J. Clin. Microbiol. 43, 3049–3053. Ebner, K., Rauch, M., Preuner, S., Lion, T., 2006. Typing of human adenoviruses in specimens from immunosupressed patients by PCR-fragment length analysis and real-time quantitative PCR. J. Clin. Microbiol. 44, 2808–2815. Fransen, K., Mortier, D., Heyndrickx, L., Verhofstede, C., Janssens, W., van der Groen, G., 1998. Isolation of HIV-1 RNA from plasma: evaluation of seven different methods for extraction (part two)? J. Virol. Methods 76 (1–2), 153–157. Ghaffari, S.H., Obeidi, N., Dehghan, M., Alimoghaddan, K., Gharehbaghian, A., Ghavamzadeh, A., 2008. Monitoring of cytomegalovirus reactivation in bone marrow tranplant recipients by real-time PCR. Pathol. Oncol. Res. 14, 399–409. Gruber, F., Falkner, F.G., Dorner, F., Hämmerle, T., 2001. Quantitation of viral DNA by real-time PCR applying duplex amplification, internal standardization and two-colour fluorescence detection. Appl. Environ. Microbiol. 67, 2837–2839. Hayden, R., Persing, D.H., 2001. Diagnostic molecular microbiology review. Curr. Clin. Top. Infect. Dis. 21, 323–348. Ho, N.T., Fan, A., Klapperich, C.M., Cabodi, M., 2012. Sample concentration and purification for point-of-care diagnostics. In: Conf. Proc. IEEE Eng. Med. Biol. Soc, pp. 2396–2399. Ishiguro, T., Saitoh, J., Yawata, H., Yamagishi, H., Iwasaki, S., Mitoma, Y., 1995. Homogeneous quantitative assay of hepatitis C virus RNA by polymerase chain reaction in the presence of a fluorescent intercalater. Anal. Biochem. 229, 207–213. Lee, W.C., Lien, K.Y., Lee, G.B., Lei, H.Y., 2008. An integrated microfluidic system using magnetic beads for virus detection. Diagn. Microbiol. Infect. Dis. 60 (1), 51–58. Locatelli, G., Santoro, F., Veglia, F., Gobbi, A., Lusso, P., Malnati, M.S., 2000. Realtime quantitative PCR for human herpesvirus 6 DNA. J. Clin. Microbiol. 38, 4042–4048. Kimura, H., Morita, M., Yabuta, Y., Kuzushima, K., Kato, K., Kojima, S., Matsuyama, T., Morishima, T., 1999. Quantitative analysis of Epstein-Barr virus load by using a real-time PCR assay. J. Clin. Microbiol. 37, 132–136. Monopoeho, S., Mignotte, B., Schwartzbrod, L., Marechal, V., Nicolas, J.-C., Billaudel, S., Férré, V., 2000. Quantitation of enterovirus RNA in sludge samples using single tube real-time RT-PCR. Biotechniques 29, 88–93. Moody, A., Sellers, S., Bumstead, N., 2000. Measuring infectious bursal disease virus RNA in blood by multiplex real-time quantitative RT–PCR. J. Virol. Methods 85, 55–64. Najioullah, F., Thouvenot, D., Lina, B., 2001. Development of a real-time PCR procedure including an internal control for the measurement of HCMV viral load. J. Virol. Methods 92, 55–64. Perandin, F., Cariani, E., Pollara, C.P., Manca, N., 2007. Comparison of commercial and in-house real-time PCR assays for quantitation of Epstein-Barr virus (EBV) DNA in plasma. BMC Microbiol. 7, 22. Ryncarz, A.J., Goddard, J., Wald, A., Huang, M.-L., Roizman, B., Corey, L., 1999. Development of a high-throughput quantitative assay for detecting herpes simplex virus DNA in clinical samples. J. Clin. Microbiol. 37, 1941–1947. Sizmann, D., Glaubitz, J., Simon, C.O., Goedel, S., Buergisser, P., Drogan, D., Hesse, M., Kröh, M., Simmler, P., Dewald, M., Gilsdorf, M., Fuerst, M., Ineichen, R., Kirn, A., Pasche, P., Wang, Z., Weisshaar, S., Young, K., Haberhausen, G., Babiel, R., 2010. Improved HIV-1 RNA quantitation by COBAS AmpliPrep/COBAS TaqMan HIV-1 Test, v2.0 using a novel dual-target approach. J. Clin. Virol. 49, 41–46. Thomas, R., 1993. The denaturation of DNA. Gene 135 (1–2), 77–79. Van Belkum, A., Niesters, H.G., 1995. Nucleic acid amplification and related techniques in microbiological diagnosis and epidemiology. Cell. Mol. Biol. 41, 615–623. Verhofstede, C., Fransen, K., Marissens, D., Verhelst, R., van der Groen, G., Lauwers, S., Zissis, G., Plum, J., 1996. Isolation of HIV-1 RNA from plasma: evaluation of eight different extraction methods. J. Virol. Methods 60 (2), 155–159.
