HUMAN MUTATION 1:258-259 (1992)
MUTATION IN BRIEF
A Sequence Variation in Intron 17B of the Cystic Fibrosis Transmembrane Conductance Regulator Gene R.B. Parad* and C. Gerard Divisrons of Pulmonary (R. B. P., C. G.) (Ina Sue Perlmutter Cystic Fibrosis Research Center) and Newborn Medicine (R. B. P.) (Joint Program in Neonatology), Department of Pediatrics, Harward Medical School, Children’s Hospital, Boston, Massachusetts 02 1 I5 Communicuted by Lip-Chee Tsui
accession #M55125; Zielenski et al., 1 9 9 1 ~ ) ; Of the over 200 mutations and sequence variaA2: 3500-140 = C (GENBANK accession tions described to date in the cystic fibrosis trans#M8663 l)]. The transversion results in the loss of membrane conductance regulator (CFTR) gene a DdeI restriction enzyme cleavage site. This se(chromosome 7 q31Lq32), the most common to quence variation is not located in a position which result in cystic fibrosis (CF) is AF508 (allele frewould obviously alter RNA splicing. quency 70%) (Kerem, 1989). The significance of Sixteen alleles from unrelated controls without polymorphisms in introns 6A, 8, and 17B is unCF and 46 alleles from CF patients were evaluated. clear (Gaspirini et al., 1991; Morral et al., 1991; All subjects were Caucasian and Ashkenazi jews Zielenski et al., 1991a). Each of these 3 polymorwere excluded. Alleles from 3 categories of unrephic regions show at least one pattern strongly associated with presence of a AF508 allele. Intronic lated CF patients were analyzed for intron 17B SSCP patterns consistent with A1 or A2: AF508 polymorphisms may either have no clear functional significance or may be located in regions homozygotes (n = lo), AF508hon-AF508 heterozygotes (n = 7), and AF508 on neither allele which affect RNA splicing and potentially CFTR (non-AF508/non-AF508) (n = 6). Results were as function (Chu et al., 1991; Zielenski et al., 1991b). We report a sequence variation of human shown in Table 1. CFTR intron 17B and describe the frequency of its Our evaluation of the polymorphism at the intron 17B 3500-140 locus is non-AF508/non-AF508 alleles among CF patients. We detected an intron 17B polymorphism by CF patients suggests that allele A2 is more comSSCP screening (Dean et al., 1990) of a PCR monly represented among CF patients carrying product which spanned the 3’ end of intron 17B, non-AF508 CFTR mutations (as a whole) than in exon 18, and the 5‘ end30f intron 18 (Fig. 1). the general population 1) = 4.67, P = 0.031. In addition, although our numbers are small, allele Six percent polyacrylamide (29 acry1amide:O.3 bis) nondenaturing SSCP gels were run at 60 W A2 may be less frequently associated with chromofor 4 hr (4°C). PCR amplification was performed somes carrying the AF508 mutation. on 150 ng of genomic DNA from a CF patient It is possible that inclusion of both CF carriers (25 cycles: 94°C 30 sec, 56°C 30 sec, 72°C 1 min) and subjects of different ethnic or racial backgrounds (different A1 and A2 frequencies) could in a 50 pl reaction mixture containing 50 mM skew the A2 frequency in our unrelated control KCI, 10 mM Tris-HC1, pH 8.8, 1.5 mM MgCl,, 100 p M dNTP, 0.1 ~1 of 32p dCTP (3000 population. Although the A2 allele appears more Ci/mmol), 0.5 U TqI polymerase, and primcommonly in the CF patient population with noners [(5’)GTAGATGCTGTGATGAACTG(3’), AF508 mutations than in this general population, (5’)AGTGGCTATCTATGAGAAGG(3’)] (200 ng). Subcloned alleles were sequenced using standard dideoxynucleotide methods. A n A to C transReceived March 31, 1992 accepted June 10, 1992 version was noted at sequence position 3500-140 *To whom reprint requestskorrespondence should be adof intron 17B [Al: 3500-140 = A (GENBANK dressed.
[x2(
0 1992 WILEY-LISS, INC.
VARIATION IN INTRON 178 OF CFTR GENE TABLE 1. Analysis of
259
Alleles From Three Categories of CF Patients Allele frequency CF
Allele A1 A2 Total
Controls # Alleles % 14 2 16
88 12
AF5081 AF508 # Alleles % 20 0 20
AF5081 non-AF508 # Alleles %
100 0
9 5
64 36
14
Non-AF5081 non AF508 # Alleles %
-
5 7 12
42 58
by SSCP or AS 0 could provide a useful tool in linkage analysis of families of CF patients with non-AF508 mutations not detected by common mutation testing.
ACKNOWLEDGMENTS This grant was supported by a Milton Fund Grant, Harvard Medical School and an NIH Biomedical Research Support Grant F07RR05899-10. Technical assistance was provided by Dr. Li Qing Chen. Support from Drs. Jeffrey Drazen and M.E.B. Wohl is appreciated. Thanks to Dr. Bruce Korf for DNA samples, and Drs. Alan Graubner, Ulrich Mueller, Alan Beggs, and Matthew Warman for manuscript review. FIGURE 1. Autoradiograph of 32p labeled CFTR intron 17B PCR product SSCP. Lane 1: A2 homozygote. Lane 2 AllA2 heterozygote.
it is possible that the A2 allele frequency among nonaffected chromosomes from obligate heterozygotes may be closer to that of the A2 allele frequency among CF patients carrying non-AF508 mutations. Because of this uncertainty, and our small sample size, we have embarked o n a larger and more in depth analysis which includes assessment of in phase obligate heterozygote chromosomes and association with specific non-AF508 genotypes. Our current data suggest that given the more common occurrence of allele A2 in non-AF508 compound heterozygotes, analysis for 3500-140 C
REFERENCES Chu C-S, Trapnell BC, Murtagh JJ, Moss 1, Dalemans W, Jallat S, Mercenier A, Pavirani A, Lecocq J-P, Cutting GR, Guggino WB, Crystal RG (1991) EMBO 10:1355-1363. Dean M, White MB, Amos J , Gerrard B, Stewart C , Khaw K,T, Leppert M (1990) Cell 61:863-870. Gasparini P, Dognini M, Bonizzato A, Pignatti PF, Morral N, Estivil X (1991) Hum Genet 86:625. Kerem BS, Rommens JM, Buchanan ]A, Markiewicz D, Cox TK, Chakravarti A, Buchwald M, Tsui LC (1989) Science 245: 1073-1080. Morral N, Nunes V, Casals T, Estivill X (1991) Genomics 10: 692-698. Zielenski J, Markiewicz M, Rininsland F, Rornmens 1, Tsui LC (1991a) Am J Hum Genet 49:1256-1262. Zielenski J , Bozon D, Kerem B-S, Markiewicz D, Durie P, Rommens JM, Tsui L-C (1991b) Genomics 10:229-235. Zielenski J, Rozmahel R, Bozon D, Kerem BS, Grzelczak A, Ri) 10:214ordan JR, Rommens J, Tsui LC ( 1 9 9 1 ~ Genomics 228.
MUTATION IN BRIEF
A Sequence Variation in Intron 17B of the Cystic Fibrosis Transmembrane Conductance Regulator Gene R.B. Parad* and C. Gerard Divisrons of Pulmonary (R. B. P., C. G.) (Ina Sue Perlmutter Cystic Fibrosis Research Center) and Newborn Medicine (R. B. P.) (Joint Program in Neonatology), Department of Pediatrics, Harward Medical School, Children’s Hospital, Boston, Massachusetts 02 1 I5 Communicuted by Lip-Chee Tsui
accession #M55125; Zielenski et al., 1 9 9 1 ~ ) ; Of the over 200 mutations and sequence variaA2: 3500-140 = C (GENBANK accession tions described to date in the cystic fibrosis trans#M8663 l)]. The transversion results in the loss of membrane conductance regulator (CFTR) gene a DdeI restriction enzyme cleavage site. This se(chromosome 7 q31Lq32), the most common to quence variation is not located in a position which result in cystic fibrosis (CF) is AF508 (allele frewould obviously alter RNA splicing. quency 70%) (Kerem, 1989). The significance of Sixteen alleles from unrelated controls without polymorphisms in introns 6A, 8, and 17B is unCF and 46 alleles from CF patients were evaluated. clear (Gaspirini et al., 1991; Morral et al., 1991; All subjects were Caucasian and Ashkenazi jews Zielenski et al., 1991a). Each of these 3 polymorwere excluded. Alleles from 3 categories of unrephic regions show at least one pattern strongly associated with presence of a AF508 allele. Intronic lated CF patients were analyzed for intron 17B SSCP patterns consistent with A1 or A2: AF508 polymorphisms may either have no clear functional significance or may be located in regions homozygotes (n = lo), AF508hon-AF508 heterozygotes (n = 7), and AF508 on neither allele which affect RNA splicing and potentially CFTR (non-AF508/non-AF508) (n = 6). Results were as function (Chu et al., 1991; Zielenski et al., 1991b). We report a sequence variation of human shown in Table 1. CFTR intron 17B and describe the frequency of its Our evaluation of the polymorphism at the intron 17B 3500-140 locus is non-AF508/non-AF508 alleles among CF patients. We detected an intron 17B polymorphism by CF patients suggests that allele A2 is more comSSCP screening (Dean et al., 1990) of a PCR monly represented among CF patients carrying product which spanned the 3’ end of intron 17B, non-AF508 CFTR mutations (as a whole) than in exon 18, and the 5‘ end30f intron 18 (Fig. 1). the general population 1) = 4.67, P = 0.031. In addition, although our numbers are small, allele Six percent polyacrylamide (29 acry1amide:O.3 bis) nondenaturing SSCP gels were run at 60 W A2 may be less frequently associated with chromofor 4 hr (4°C). PCR amplification was performed somes carrying the AF508 mutation. on 150 ng of genomic DNA from a CF patient It is possible that inclusion of both CF carriers (25 cycles: 94°C 30 sec, 56°C 30 sec, 72°C 1 min) and subjects of different ethnic or racial backgrounds (different A1 and A2 frequencies) could in a 50 pl reaction mixture containing 50 mM skew the A2 frequency in our unrelated control KCI, 10 mM Tris-HC1, pH 8.8, 1.5 mM MgCl,, 100 p M dNTP, 0.1 ~1 of 32p dCTP (3000 population. Although the A2 allele appears more Ci/mmol), 0.5 U TqI polymerase, and primcommonly in the CF patient population with noners [(5’)GTAGATGCTGTGATGAACTG(3’), AF508 mutations than in this general population, (5’)AGTGGCTATCTATGAGAAGG(3’)] (200 ng). Subcloned alleles were sequenced using standard dideoxynucleotide methods. A n A to C transReceived March 31, 1992 accepted June 10, 1992 version was noted at sequence position 3500-140 *To whom reprint requestskorrespondence should be adof intron 17B [Al: 3500-140 = A (GENBANK dressed.
[x2(
0 1992 WILEY-LISS, INC.
VARIATION IN INTRON 178 OF CFTR GENE TABLE 1. Analysis of
259
Alleles From Three Categories of CF Patients Allele frequency CF
Allele A1 A2 Total
Controls # Alleles % 14 2 16
88 12
AF5081 AF508 # Alleles % 20 0 20
AF5081 non-AF508 # Alleles %
100 0
9 5
64 36
14
Non-AF5081 non AF508 # Alleles %
-
5 7 12
42 58
by SSCP or AS 0 could provide a useful tool in linkage analysis of families of CF patients with non-AF508 mutations not detected by common mutation testing.
ACKNOWLEDGMENTS This grant was supported by a Milton Fund Grant, Harvard Medical School and an NIH Biomedical Research Support Grant F07RR05899-10. Technical assistance was provided by Dr. Li Qing Chen. Support from Drs. Jeffrey Drazen and M.E.B. Wohl is appreciated. Thanks to Dr. Bruce Korf for DNA samples, and Drs. Alan Graubner, Ulrich Mueller, Alan Beggs, and Matthew Warman for manuscript review. FIGURE 1. Autoradiograph of 32p labeled CFTR intron 17B PCR product SSCP. Lane 1: A2 homozygote. Lane 2 AllA2 heterozygote.
it is possible that the A2 allele frequency among nonaffected chromosomes from obligate heterozygotes may be closer to that of the A2 allele frequency among CF patients carrying non-AF508 mutations. Because of this uncertainty, and our small sample size, we have embarked o n a larger and more in depth analysis which includes assessment of in phase obligate heterozygote chromosomes and association with specific non-AF508 genotypes. Our current data suggest that given the more common occurrence of allele A2 in non-AF508 compound heterozygotes, analysis for 3500-140 C
REFERENCES Chu C-S, Trapnell BC, Murtagh JJ, Moss 1, Dalemans W, Jallat S, Mercenier A, Pavirani A, Lecocq J-P, Cutting GR, Guggino WB, Crystal RG (1991) EMBO 10:1355-1363. Dean M, White MB, Amos J , Gerrard B, Stewart C , Khaw K,T, Leppert M (1990) Cell 61:863-870. Gasparini P, Dognini M, Bonizzato A, Pignatti PF, Morral N, Estivil X (1991) Hum Genet 86:625. Kerem BS, Rommens JM, Buchanan ]A, Markiewicz D, Cox TK, Chakravarti A, Buchwald M, Tsui LC (1989) Science 245: 1073-1080. Morral N, Nunes V, Casals T, Estivill X (1991) Genomics 10: 692-698. Zielenski J, Markiewicz M, Rininsland F, Rornmens 1, Tsui LC (1991a) Am J Hum Genet 49:1256-1262. Zielenski J , Bozon D, Kerem B-S, Markiewicz D, Durie P, Rommens JM, Tsui L-C (1991b) Genomics 10:229-235. Zielenski J, Rozmahel R, Bozon D, Kerem BS, Grzelczak A, Ri) 10:214ordan JR, Rommens J, Tsui LC ( 1 9 9 1 ~ Genomics 228.
